Modelling Aspergillus fumigtus infections in rcing pigeons (Columb livi domestic) Lies Angèle Beernert, Frnk Psmns, Freddy Hesebrouck, An Mrtel To cite this version: Lies Angèle Beernert, Frnk Psmns, Freddy Hesebrouck, An Mrtel. Modelling Aspergillus fumigtus infections in rcing pigeons (Columb livi domestic). Avin Pthology, Tylor Frncis, 2008, 37 (05), pp.545-549. <10.1080/03079450802382280>. <hl-00540133> HAL Id: hl-00540133 https://hl.rchives-ouvertes.fr/hl-00540133 Submitted on 26 Nov 2010 HAL is multi-disciplinry open ccess rchive for the deposit nd dissemintion of scientific reserch documents, whether they re published or not. The documents my come from teching nd reserch institutions in Frnce or brod, or from public or privte reserch centers. L rchive ouverte pluridisciplinire HAL, est destinée u dépôt et à l diffusion de documents scientifiques de niveu recherche, publiés ou non, émnnt des étblissements d enseignement et de recherche frnçis ou étrngers, des lbortoires publics ou privés.
Avin Pthology Modelling Aspergillus fumigtus infections in rcing pigeons (Columb livi domestic) Journl: Avin Pthology Mnuscript ID: CAVP-2008-0063.R1 Mnuscript Type: Review Dte Submitted by the Author: 22-Jul-2008 Complete List of Authors: Beernert, Lies; Fculty of Veterinry Medicine, Ghent University, Deprtment of Pthology, Bcteriology nd Avin Diseses Psmns, Frnk; Fculty of Veterinry Medicine, Ghent University, Deprtment of Pthology, Bcteriology nd Avin Diseses Hesebrouck, Freddy; Fculty of Veterinry Medicine, Ghent University, Deprtment of Pthology, Bcteriology nd Avin Diseses Mrtel, An; Fculty of Veterinry Medicine, Ghent University, Deprtment of Pthology, Bcteriology nd Avin Diseses Keywords: Aspergillus fumigtus, mycology, pigeon, experimentl spergillosis E-mil: cvngh@metronet.co.uk URL: http://mc.mnuscriptcentrl.com/cvp
Pge 1 of 19 Avin Pthology Cvp-2008-0063.R1 Modelling Aspergillus fumigtus infections in rcing pigeons (columb livi domestic) L. A. Beernert 1*, F. Psmns 1, F. Hesebrouck 1, A. Mrtel 1 1 The Deprtment of Pthology, Bcteriology nd Avin Diseses, Fculty of Veterinry Medicine, Ghent University, Slisburyln 133, 9820 Merelbeke. Short Title: Aspergillus fumigtus infections in rcing pigeons To whom correspondence should be ddressed. Tel: +32 9 264 74 42. Fx: +32 9 264 74 90. E- mil: lies.beernert@ugent.be Received: 16 April 2008 E-mil: cvngh@metronet.co.uk URL: http://mc.mnuscriptcentrl.com/cvp 1
Avin Pthology Pge 2 of 19 Abstrct In vivo modelling of spergillosis in birds llows the evlution of control mesures nd the study of host-pthogen interctions. In this study the impct of the use of different inocultion routes nd immunosuppression on the course of n infection with Aspergillus fumigtus in rcing pigeons (Columb livi domestic) ws exmined. A. fumigtus conidi were inoculted in the thorcic ir sc, lung or trche in immunocompetent or immunosuppressed pigeon squbs. Immunosuppression ws induced by three dexmethsone injections before inocultion. Mortlity in the A. fumigtus inoculted groups vried between 1/4 to 4/4. The highest nd more cute mortlity ws seen in immunocompetent pigeons inoculted in the thorcic ir sc nd in pigeons inoculted in the thorcic ir sc or lung fter immunosuppression. Pigeons inoculted in the lung or inoculted intrtrchelly fter immunosuppression developed n spergillosis infection with slower course of disese nd more prominent clinicl symptoms. Using Microstellite Length Polymorphism it ws confirmed tht ll mycoses were cused by the inoculted strin except for one isolte in dexmethsone-treted pigeon. In conclusion, inocultion in the lung is selected s the preferred model for chronic spergillosis in pigeons nd inocultion in the thorcic ir sc s the one for cute spergillosis. The use of immunosuppressed birds seems to be contr-indicted due to the risk of opportunistic infections. E-mil: cvngh@metronet.co.uk URL: http://mc.mnuscriptcentrl.com/cvp 2
Pge 3 of 19 Avin Pthology Introduction Avin spergillosis is n infectious nd noncontgious disese cused by Aspergillus spp. These fungi re ubiquitous nd cn be isolted from soil, ir nd vegettion. The most commonly isolted species is Aspergillus fumigtus but other Aspergillus spp. including A. flvus, A. niger, A. glucus nd A. nidulns cn lso ply role (Okoye nd Okeke, 1986; Brton et l., 1992; Perelmn nd Kuttin, 1992; de Wit et l., 1993; Oglesbee, 1997; Joseph, 2000). Mixed infections occsionlly occur (Perelmn nd Kuttin, 1992). A. fumigtus is n opportunistic pthogen, cusing clinicl infections t high infection pressure or in immunosuppressed hosts. Phgocytic cells nd norml respirtory microbil clernce mechnisms re the first line defense ginst inhled spores. Disese occurs when this intrpulmonry defensive mechnism becomes indequte nd doesn t succeed in eliminting the orgnism (Oglesbee, 1997). In vivo models llowing reproducing spergillosis in birds re very useful for studying host-pthogen interctions nd evluting the effect of different control mesures. Depending on the ims of such studies, more cute or chronic model is required. A rther chronic infection model would be more suitble for exmple in studies ssessing the efficcy of ntimycotic tretment. The more cute model my llow the detection of strin dependent differences of virulence. Although experimentl infections with A. fumigtus hve been crried out in quils, strlings, pigeons, turkeys nd chickens using different inocultion routes (intrvenously, intrtrchelly, in the bdominl/thorcic ir sc, intrpulmonry nd using erosol) there is n bsolute necessity to compre these routes in one bird species in order to select the pproprite model (Chute & O Mer, 1958; Wright et l., 1960; Richrd et l., 1973; Richrd et l., 1981; Richrd & Thurston, 1983; Dyr et l., 1984; Vn Cutsem et l., 1989; Julin & Goryo, 1990; E-mil: cvngh@metronet.co.uk URL: http://mc.mnuscriptcentrl.com/cvp 3
Avin Pthology Pge 4 of 19 Elmubrk & Fdlelmul, 1991; Peden & Rhodes, 1992; Perelmn, 1993; Kunkle & Rimler, 1996; Kunkle et l., 1999; Atsever & Gümüssoy, 2004; Gümüssoy et l., 2004; Femeni et l., 2007). It ws therefore, the im of this study to select n cute nd chronic spergillosis model in pigeons. For this purpose, A. fumigtus conidi were inoculted in the thorcic ir sc, lung or trche of immunocompetent or immunosuppressed pigeons. Mterils nd methods Animls. In the first experiment eighteen cliniclly helthy dult rcing pigeons (Columb livi domestic) were divided into three groups of six pigeons. In the second experiment thirty five cliniclly helthy, 4-5-week-old pigeon squbs were divided into seven groups of four nd one group of seven pigeons. The nimls were free from Slmonell sp. nd endoprsites. During the experiment ech bird ws housed individully t 20-22 C nd 31-55% reltive humidity with 12-hour photoperiod. The birds received commercil pigeon diet d libitum nd hd free ccess to fresh drinking wter. All experiments were performed with the permission of the Ethicl Committee of the Fculty of Veterinry Medicine, Merelbeke, Ghent University, Belgium (EC 2006/099). Experimentl inoculum. The Aspergillus fumigtus strin used in this study ws isolted from rcing pigeon, which ws losing weight for four weeks nd ws presented with severe dyspne. Five dy old cultures of this strin on Sbourud dextrose gr (CM0041, Oxoid Ltd., Bsingstoke, Hmpshire, Englnd) were wshed with 5 ml 0.01% Tween 80 in Hnk s blnced slt solution (HBSS) to hrvest A. fumigtus conidi. The conidi were wshed three times in E-mil: cvngh@metronet.co.uk URL: http://mc.mnuscriptcentrl.com/cvp 4
Pge 5 of 19 Avin Pthology 0.01% Tween 80 in HBSS (3200 g, ten minutes t 4 C) nd the suspension ws djusted to concentrtion of 10 6 or 10 8 A. fumigtus conidi/ml in HBSS by hemcytometer count. Experimentl design. The first experiment ws crried out in order to determine n pproprite infection dose. Three groups of six pigeons were inoculted intrtrchelly either with 0.2 ml of 10 6 or 10 8 A. fumigtus conidi/ml suspension in HBSS or with 0.2 ml HBSS. The second experiment ws crried out in order to exmine the impct of the use of different inocultion routes nd immunosuppression on the course of n infection with A. fumigtus. Seven groups of four pigeons were inoculted either with 0.2 ml of 10 8 A. fumigtus conidi/ml suspension in HBSS (groups 4, 5, 6, 7 nd 8) or with 0.2 ml HBSS (control groups 1 nd 2) using one of the following inocultion routes: intrtrchel (group 8), inocultion in the right thorcic ir sc (group 1, 4 nd 6) nd inocultion in the picl prt of the right lung (groups 2, 5 nd 7). The pigeons of three groups received three dexmethsone injections (2 mg/kg IM q48h) before inocultion with A. fumigtus (group 6, 7 nd 8). One group of pigeons (n=7) only received three dexmethsone injections (control group 3). The nimls were observed t lest twice dily. The presence of ruffled fethers, dyspne, sneezing nd stridor were scored blindly. Out of ethicl considertions, pigeons with severe dyspne (open bek brething) or extreme wekness were euthnized. This ws noted s mortlity. In the first experiment t twenty two dys post inocultion (p.i.) nd in the second experiment t seven dys p.i., ll remining pigeons were euthnized by n intrvenous injection of 0.2 ml T61 (Intervet, Mechelen, Belgium) in the ven bsilic. At necropsy, mcroscopic lesions were described nd smples were collected for mycologicl nd bcteriologicl exmintion. E-mil: cvngh@metronet.co.uk URL: http://mc.mnuscriptcentrl.com/cvp 5
Avin Pthology Pge 6 of 19 Weight. All pigeons were weighted t the time of the first dexmethsone injection, t the time of inocultion nd t necropsy. Sttisticl nlysis ws performed using Two-Smple T test (Microsoft Office Excel). Clinicl score. Every dy score for til hopping nd bdominl brething ws given to ech pigeon. These scores rnged from 0-1 (0=bsent, 0.2=brely visible, 0.4=mild, 0.6=moderte, 0.8=pronounced, 1=highly pronounced). The sum of those two scores forms the dyspne score for certin pigeon on certin dy. The presence or bsence of ruffled fethers, s generl sign of sickness ws lso noted dily for ech pigeon. Mycologicl nd bcteriologicl exmintion. In the first experiment, smples of the trche, lungs nd ir scs nd in the second experiment of the trche, lungs, ir scs, hert, pericrdium, liver, kidney, brin, pectorl muscle nd bdominl fluid were inoculted on Sbourud dextrose gr pltes nd incubted t 37 C t erobic conditions to isolte A. fumigtus. Growth of A. fumigtus ws ssessed two dys fter plte inocultion. Bcteriologicl exmintion ws performed on the livers of ll pigeons using stndrd microbiologicl isoltion techniques. Microstellite Length Polymorphism. Microstellite Length Polymorphism (MLP) ws used to confirm tht mycoses during this study originted from the inoculted strin. DNA ws extrcted by the following technique. For ech isolte piece of mycelium ws cut out from the gr plte. After melting the gr, the mycelium ws crushed mnully in order to relese DNA from the cells. After centrifugtion (16100 g; 2.5 minutes) the superntnt ws used for PCR. E-mil: cvngh@metronet.co.uk URL: http://mc.mnuscriptcentrl.com/cvp 6
Pge 7 of 19 Avin Pthology Primers were selected for the mplifiction of microstellites A, B, C nd D (Tble 1). One primer per set ws lbeled with the fluorescent dye 6-crboxyfluorescein (6-FAM) for detection with n utomted DNA sequencer. The PCR mplifiction ws performed in 20-µl volume contining 1.5 mm MgCl 2, 100 µm dntp s, 0.1 µm for ech primer, 0.025 U/µl Tq DNA polymerse nd 2 µl superntnt. Amplifiction ws done in n Eppendorf Mstercycler ep system, with denturtion for 5 min t 94 C, 35 time cycles of 30 s t 94 C, 30 s t 59 C, nd 30 s t 72 C, nd finl extension step t 72 C for 30 min. Two µl of the PCR product ws mixed with 12 µl deionized formmide nd 0.3 µl rox 500LIZ. This mixture ws denturted t 95 C during 2 min nd incubted on ice for 0.5 h. The smples were further nlyzed by cpillry electrophoresis (ABI 3100, Applied Biosystems). A reference strin (CBS 143.89, Centrl Bureu voor Schimmelculturen, Utrecht, the Netherlnds) ws included in ll nlyses s n internl control. Results Clinicl signs. Immunocompetent pigeons inoculted intrtrchelly showed no clinicl signs in the first experiment. In the second experiment significnt difference (p<0.01) between the verge weight of immunosuppressed nd immunocompetent pigeons ws observed on the dy of inocultion. After inocultion, weight loss ws detected in the groups inoculted with A. fumigtus except for group 6 (dexmethsone treted, inoculted with A. fumigtus in the ir sc) (Tble 2). Dyspne ws only seen in A. fumigtus inoculted pigeons, most pprent in group 5 (inoculted in the lung) nd group 8 (dexmethsone treted, inoculted in the trche). Dyspne ws lmost bsent in E-mil: cvngh@metronet.co.uk URL: http://mc.mnuscriptcentrl.com/cvp 7
Avin Pthology Pge 8 of 19 group 6 (dexmethsone treted, inoculted with A. fumigtus in the ir sc) nd group 7 (dexmethsone treted, inoculted with A. fumigtus in the lung) (Tble 3). Sneezing ws seen in one pigeon in group 4 (inoculted in the thorcic ir sc) on the fourth dy p.i. nd in one pigeon in group 5 (inoculted in the lung) on the fourth nd sixth dy p.i.. Stridor ws noticed in the ltter from the fifth dy p.i. on nd in one pigeon in group 8 (dexmethsone treted, inoculted in trche) on the fifth dy p.i.. Mortlity. In the first experiment, no mortlity ws observed in ny group. In the second experiment, no mortlity ws observed in the negtive control groups, except for two out of seven pigeons in group 3 (dexmethsone treted, not inoculted), which died due to Streptococcus gllolyticus septicemi. Mortlity in the A. fumigtus inoculted groups vried between 1/4 to 4/4, the lowest mortlity occurring in groups 5 nd 8 (inoculted in the lung; dexmethsone treted, inoculted in the trche), 100% mortlity occurring in groups 4, 6 nd 7 (inoculted in the ir sc; dexmethsone treted, inoculted in the ir sc; dexmethsone treted, inoculted in the lung). Mortlity ws more cute in groups 4, 6 nd 7 (inoculted in the ir sc; dexmethsone treted, inoculted in the ir sc; dexmethsone treted, inoculted in the lung), thn in groups 5 nd 8 (inoculted in the lung; dexmethsone treted, inoculted in trche) (Tble 4). Pthologicl findings. Immunocompetent pigeons inoculted intrtrchelly showed no mcroscopic lesions t necropsy. In the second experiment, no lesions were observed in the control groups with exception of two out of seven pigeons in group 3 (dexmethsone treted, not inoculted) tht died of Strepococcus gllolyticus septicemi. In these pigeons, ple spect of the liver nd pectorl E-mil: cvngh@metronet.co.uk URL: http://mc.mnuscriptcentrl.com/cvp 8
Pge 9 of 19 Avin Pthology muscle ws noticed. The pthologicl findings of the A. fumigtus inoculted pigeons re summrized in Tble 5. Necropsy showed lesions suggestive of spergillosis in ll A. fumigtus inoculted pigeon groups. The most pronounced lesions were noticed in the respirtory trct nd viscerl orgns. Air sc lesions included the presence of grnulomtous foci nd clouding. Lung lesions included the presence of grnulomtous nd hemorrhgic foci. Lesions on the pericrd included the presence of grnulomtous foci nd content of yellow fluid. Liver lesions included grnulomtous foci nd congestion. A ple spect of the kidneys, lrge grnulomtous focus in the brin nd the presence of ple spect nd grnulomtous foci on the pectorl muscles were lso noticed occsionlly. Mycologicl findings. In the first experiment A. fumigtus could not be isolted from trche, lungs nd ir scs of ny of the pigeons. In the second experiment A. fumigtus ws isolted from different orgns of ll inoculted pigeons nd could not be isolted from orgns of non-a. fumigtus-inoculted pigeons (Tble 5). Microstellite Length Polymorphism. All isolted strins hd the sme MLP chrcteristics s the inoculted strin (A 123 B 102 C 167 D 112 ) except for one strin (A 127 B 161 C 165 D 78 ). This strin ws isolted from ple kidneys of one pigeon in group 7 (dexmethsone treted, inoculted in the picl prt of the right lung). The strin isolted from the trche of the sme pigeon hd the sme MLP chrcteristics s the inoculted strin. Discussion E-mil: cvngh@metronet.co.uk URL: http://mc.mnuscriptcentrl.com/cvp 9
Avin Pthology Pge 10 of 19 Immunocompetent dult pigeons inoculted intrtrchelly showed no clinicl signs, mortlity or lesions t necropsy. A. fumigtus could not be isolted from the trches or other orgns of these nimls. Apprently, the pigeons were cpble of clering the infection even t very high infection doses. This finding suggests tht cliniclly helthy pigeons re not prone to develop spergillosis. This low susceptibility might be species (Chudhry & Sdn, 1988; Femeni et l., 2007) nd ge dependent (O Mer & Chute, 1959; Femeni et l., 2007). Therefore, pigeon squbs (4-5-week-old) were used in the second experiment. In the second experiment A. fumigtus inoculted pigeons developed mycosis. Becuse of the risk of contmintion by irborne conidi, especilly in the dexmethsone pretreted groups, we used MLP nlysis to ensure tht the mycosis ws cused by the inoculted strin. Hereby, it ws confirmed tht ll isolted A. fumigtus strins hd the sme MLP chrcteristics s the inoculted strin except for one isolte of dexmethsone treted pigeon. Probbly due to the dexmethsone injections, environmentl, irborne A. fumigtus conidi cused co-infection. This finding emphsizes the role of immunosuppression in the development of vin spergillosis. Clinicl symptoms were present in ll inoculted pigeons. However, the most obvious symptoms were noticed in pigeons inoculted in the lung or inoculted intrtrchelly fter immunosuppression. This coincides with delyed mortlity in nimls from both groups. Hence, the more severe symptoms cn probbly be merely ttributed to the slower course of infection. Both experimentl designs cn thus be used s model for chronic spergillosis. Due to the more cute mortlity in pigeons inoculted in the thorcic ir sc nd in pigeons inoculted in the thorcic ir sc or lung fter immunosuppression, these designs re more suitble s model for cute spergillosis. In this experiment mortlity ws observed from the second dy nd within five dys p.i.. In the models for cute spergillosis four out of four pigeons died within five dys p.i. while in the models for chronic spergillosis only one out of four pigeons died on the fifth E-mil: cvngh@metronet.co.uk URL: http://mc.mnuscriptcentrl.com/cvp 10
Pge 11 of 19 Avin Pthology dy p.i.. These findings re in contrst with A. fumigtus experimentl infections in other vin species. In turkeys inoculted with A. fumigtus spores in the thorcic ir sc no mortlity ws seen the first four dys p.i. while quils nd strlings inoculted with A. fumigtus spores intrtrchelly demonstrted mortlity s soon s two-three dys p.i. (Peden & Rhodes, 1992; Kunkle & Rimler, 1996; Atsever & Gümüssoy, 2004; Gümüssoy et l., 2004; Femeni et l., 2007). On the other hnd, pigeons inoculted with A. fumigtus spores intrvenously showed similr results s the models for cute spergillosis in this study (Vn Cutsem et l., 1989; Elmubrk & Fdlelmul, 1991). Discrepncy with literture cn be cused by species dependent susceptibility for A. fumigtus infections nd/or vribility of pthogenicity of the A. fumigtus isoltes used in the different studies (Peden & Rhodes, 1992). Lesions suggestive of spergillosis were present in ll A. fumigtus inoculted pigeons. In this study s well s in generl (prt from the used inocultion route nd vin species), cute mortlity is consistent with disseminted mycosis while reduced nd delyed mortlity is consistent with mycotic lesions restricted to the respirtory trct (Chudry & Sdn, 1988; Peden & Rhodes, 1992; Kunkle & Rimler, 1996; Atsever & Gümüssoy, 2004; Gümüssoy et l.,2004; Femeni et l., 2007). Dexmethsone tretment clerly enhnced the risk of opportunistic infections, such s streptococcosis or interference with environmentl A. fumigtus strins. The use of immunocompetent pigeons thus seems preferble in spergillosis models. Bsed on our results, we propose inocultion of A. fumigtus in the picl prt of the right lung using immunocompetent pigeon squbs s the preferred chronic spergillosis model. Inoculting A. fumigtus in the right thorcic ir sc of immunocompetent pigeon squbs ppers to be the best model for cute spergillosis. E-mil: cvngh@metronet.co.uk URL: http://mc.mnuscriptcentrl.com/cvp 11
Avin Pthology Pge 12 of 19 Acknowledgements This work ws supported by the Institute for the Promotion of Innovtion by Science nd Technology in Flnders (IWT Vlnderen), Brussels, Belgium. References Atsever, A. & Gümüssoy K.S. (2004). Pthologicl, clinicl nd mycologicl findings in experimentl spergillosis infections of strlings. Journl of Veterinry Medicine A, 51, 19-22. Brt-Delbesse, E., Humbert, J.-F., Delbesse, E. & Bretgne, S. (1998). Microstellite mrkers for typing Aspergillus fumigtus isoltes. Journl of Clinicl Microbiology, 36, 2413-2418. Brton, J.T., Dft, B.M., Red, D.H., Kinde, H. & Bickford, A.A. (1992). Trchel spergillosis in 6 1/2 -week-old chickens cused by Aspergillus flvus. Avin Diseses, 36, 1081-1085. Chudhry, S.K. & Sdn, S.R. (1988). Experimentl spergillosis in Jpnese quils (Coturnix coturnix jponic), clinicl signs nd hemtologicl chnges. Mycopthologi, 102, 179-184. Chute, H.L. & O Mer, D.C. (1958). Experimentl fungous infections in chickens. Avin Diseses, 2, 154-166. de Wit, J.J., vn Cutsem, J., Schoenmker, G.J.W., Brunius, W.W. & vn den Bergh, J.P.A.M. (1993). Een ernstige Aspergillus flvus-infectie bij slchtkuikens en het effect vn desinfectie met enilconzole: een cse study. Tijdschrift voor diergeneeskunde, 118, 511-513. E-mil: cvngh@metronet.co.uk URL: http://mc.mnuscriptcentrl.com/cvp 12
Pge 13 of 19 Avin Pthology Dyr, P.M., Fletcher, O.J. & Pge, R.K. (1984). Aspergillosis in turkeys ssocited with use of contminted litter. Avin Diseses, 28, 250-255. Elmubrk, A.K. & Fdlelmul, A. (1991). Pthogenesis of Aspergillus fumigtus infection in pigeons in the Sudn. Revue d Elevge et de Medicine Vétérinire des Pys Tropicux, 44, 26-28. Femeni, F., Fontine, J., Lir-Fulleringer, S., Berkov, N., Huet, D., Townou, N., Rkotovo, F., Grnet, O.-I., Le Loc h, G., Arné, P. & Guillot, J. (2007). Clinicl, mycologicl nd pthologicl findings in turkeys experimentlly infected by Aspergillus fumigtus. Avin Pthology, 36, 213-219. Gümüssoy, K.S., Uynik, F., Atsever, A. & Cm, Y. (2004). Experimentl Aspergillus fumigtus infection in quils nd results of tretment with itrconzole. Journl of Veterinry Medicine B, 51, 34-38. Joseph V. (2000). Aspergillosis in rptors. Seminrs in Avin nd Exotic Pet Medicine, 9(2), 66-74. Julin, R.J. & Goryo, M. (1990). Pulmonry spergillosis cusing right ventriculr filure nd scites in met-type chickens. Avin Pthology, 19, 643-654. Kunkle R.A. & Rimler R.B. (1996). Pthology of cute spergillosis in turkeys. Avin Diseses, 40, 875-886. Kunkle, R.A., Rimler, R.B. & Stedhm, E.M. (1999). Absence of protection ginst chllenge with Aspergillus fumigtus by doptive trnsfer of splenocytes from convlescent turkeys. Avin Diseses, 43, 678-684. Oglesbee, B.L. (1997). Mycotic diseses. In R.B. Altmn (1997), Avin medicine nd surgery 1st edn (pp. 323-361). Phildelphi: W.B. Sunders Compny. E-mil: cvngh@metronet.co.uk URL: http://mc.mnuscriptcentrl.com/cvp 13
Avin Pthology Pge 14 of 19 Okoye, J.O.A. & Okeke, C.N. (1986). Pthogenicity of n isolte of Aspergillus flvus in chickens. Avin Pthology, 15, 259-270. O Mer, D.C. & Chute, H.L. (1959). Aspergillosis experimentlly produced in htching chicks. Avin Diseses, 3, 404-406. Peden, W.M. & Rhodes, K.R. (1992). Pthogenicity differences of multiple isoltes of Aspergillus fumigtus in turkeys. Avin Diseses, 36, 537-542. Perelmn, B. (1993). Evlution of zole nti-mycotic gents using n experimentl model of spergillosis in turkey poults. Proceedings of the Europen Conference on Avin Medicine nd Surgery (p. 120) Utrecht, The Netherlnds. Perelmn, B. & Kuttin, E.S. (1992). Aspergillosis in ostriches. Avin Pthology, 21, 159-163. Richrd, J.L., Cutlip, R.C., Thurston, J.R. & Songer, J. (1981). Response of turkey poults to erosolized spores of Aspergillus fumigtus nd fltoxigenic nd nonfltoxigenic strins of Aspergillus flvus. Avin Diseses, 25, 53-67. Richrd, J.L. & Thurston, J.R. (1983). Rpid hemtogenous dissemintion of Aspergillus fumigtus nd A. flvus spores in turkey poults following erosol exposure. Avin Diseses, 27, 1025-1033. Richrd, J.L., Pier, A.C., Cysewski, S.J. & Grhm, C.K. (1973). Effect of fltoxin nd spergillosis on turkey poults. Avin Diseses, 17, 111-121. Vn Cutsem, J., Vn Gerven, F. & Jnssen, P.A.J. (1989). Orl nd prenterl therpy with sperconzole (R 66905) of invsive spergillosis in norml nd immunocompromised nimls. Antimicrobil Agents nd Chemotherpy, 33, 2063-2068. Wright, M.L., Anderson, G.W. & Epps, N.A. (1960). Htchery snittion s control mesure for spergillosis in fowl. Avin Diseses, 4, 369-379. E-mil: cvngh@metronet.co.uk URL: http://mc.mnuscriptcentrl.com/cvp 14
Pge 15 of 19 Avin Pthology Tble 1: Primer sequences (5 to 3 ) for multipliction of microstellites A, B, C nd D (Brt- Delbesse et l., 1998). Microstellite Primer sequences (5 to 3 ) A GCCTACGATGACCGAAATGA CTGTTTTGAGAAGCGGATGG TTGCCATCGCTTGTCATAGA GCAGGTGGTTCAATAGGACAG CGAAGCTCTCCCCTGCAAATC GATGCCGCTGGTGGTGTTGT AGGGATACGGCTACGGACAA AAAGCGTCTGTCAGCGTGTCT B C D E-mil: cvngh@metronet.co.uk URL: http://mc.mnuscriptcentrl.com/cvp 15
Avin Pthology Pge 16 of 19 Tble 2. Averge totl weight loss s percentge of the initil weight in pigeons, either inoculted with A. fumigtus or shm inoculted, t seven dys p.i.(or t euthnsi). Group % weight loss HBSS in right thorcic ir sc (n=4) HBSS in right lung (n=4) -1.3-3.6 Dexmethsone (n=7) 1.4 A. fumigtus in right thorcic ir sc (n=4) 8.1 A. fumigtus in right lung (n=4) 6.6 A. fumigtus in right thorcic ir sc fter dexmethsone injections (n=4) -0.011 A. fumigtus in right lung fter dexmethsone injections (n=4) 8.9 A. fumigtus in trche fter dexmethsone injections (n=4) 12.4 x% weight loss = weight gin E-mil: cvngh@metronet.co.uk URL: http://mc.mnuscriptcentrl.com/cvp 16
Pge 17 of 19 Avin Pthology Tble 3. Averge dily clinicl scores for dyspne nd the presence or bsence of ruffled fethers per dy in pigeons, either inoculted with A. fumigtus or shm inoculted. DYSPNEA SCORE Dy Group p.i. 1 2 3 4 5 6 7 8 1 0 0 0 0 0 0 0 0 2 0 0 0 0 0 3 0 0 0 1 0.48 4 0 0 0 0.1 0.25 5 0 0 0 0.3 0.4 6 0 0 0 7 0 0 0 0.2 0.27 0 0 0.2 0.5 FRACTION OF PIGEONS WITH RUFFLED FEATHERS Dy Group p.i. 1 2 3 4 5 6 7 8 1 0/4 0/4 0/7 1/4 1/4 1/4 2/4 0 2 0/4 0/4 2/7 3/4 1/4 3 0/4 0/4 0/5 1/2 0/4 4 0/4 0/4 0/5 1/2 2/4 5 0/4 0/4 0/5 1/2 1/3 6 0/4 0/4 0/5 7 0/4 0/4 0/5 All pigeons died 0/3 1/3 0.4 0.7 0.4 0.67 3/4 2/4 1/1 2/4 3/4 3/4 1/3 1/3 Group 1: HBSS in right thorcic ir sc, Group 2: HBSS in right lung, Group 3: dexmethsone, Group 4: A. fumigtus in right thorcic ir sc, Group 5: A. fumigtus in right lung, Group 6: A. fumigtus in right thorcic ir sc fter dexmethsone injections, Group 7: A. fumigtus in right lung fter dexmethsone injections, Group 8: A. fumigtus in trche fter dexmethsone injections E-mil: cvngh@metronet.co.uk URL: http://mc.mnuscriptcentrl.com/cvp 17
Avin Pthology Pge 18 of 19 Tble 4. Dily mortlity in pigeons, either inoculted with A. fumigtus or shm inoculted. Dy Group p.i. 1 2 3 4 5 6 7 8 Dy 1 Dy 2 2 4 2 Dy 3 2 1 Dy 4 1 1 Dy 5 1 1 1 Dy 6 Dy 7 Totl 0 0 2/7 4/4 1/4 4/4 4/4 1/4 Group 1: HBSS in right thorcic ir sc, Group 2: HBSS in right lung, Group 3: dexmethsone, Group 4: A. fumigtus in right thorcic ir sc, Group 5: A. fumigtus in right lung, Group 6: A. fumigtus in right thorcic ir sc fter dexmethsone injections, Group 7: A. fumigtus in right lung fter dexmethsone injections, Group 8: A. fumigtus in trche fter dexmethsone injections E-mil: cvngh@metronet.co.uk URL: http://mc.mnuscriptcentrl.com/cvp 18
Pge 19 of 19 Avin Pthology Tble 5. Pthologicl nd mycologicl findings in pigeons inoculted with A. fumigtus. Orgns Number of nimls showing lesions (L) nd number of nimls from which A. fumigtus ws isolted (I) in the different groups 4 5 6 7 8 L I L I L I L I L I Trche swb 0 0 0 0 0 1 0 2 3 1 Left bdominl ir sc 4 0 2 0 1 0 2 1 4 1 Right bdominl ir sc 4 2 1 1 1 4 2 1 2 0 Left thorcic ir sc 4 3 2 0 2 1 2 1 4 0 Right thorcic ir sc 4 2 2 1 4 3 2 1 4 0 Left lung 2 3 1 2 2 4 0 3 4 1 Right lung 2 3 4 1 2 4 4 4 4 1 Pericrd 4 2 1 1 3 2 2 1 0 0 Hert 0 1 0 0 0 1 0 0 0 1 Liver 4 4 1 1 4 4 3 3 1 0 Spleen 4 b 4 b 0 b 1 b 0 b Kidney 2 0 0 0 3 3 1 1 0 0 Brin 1 1 0 0 0 0 0 0 0 0 Ascites 4 2 1 0 1 1 0 b 0 b Pectorl muscle 2 1 1 1 4 2 3 0 1 0 Ech group consisted of four nimls. Group 4: A. fumigtus in right thorcic ir sc, Group 5: A. fumigtus in right lung, Group 6: A. fumigtus in right thorcic ir sc fter dexmethsone injections, Group 7: A. fumigtus in right lung fter dexmethsone injections, Group 8: A. fumigtus in trche fter dexmethsone injections b Not determined E-mil: cvngh@metronet.co.uk URL: http://mc.mnuscriptcentrl.com/cvp 19