The Case of Color Vision Evolution in New World Monkeys

The Case of Color Vision Evolution in New World Monkeys slide version 2.0 http://www.evo-ed.com

About this Case: 1. These slides were created by the Evo-Ed Project: http://www.evo-ed.com 2. Funding for the Evo-Ed Project is provided by the National Science Foundation and by Lyman Briggs College, Michigan State University. 3. These slides are provided as a teaching resource. You are encouraged to modify them to meet your specific teaching and learning needs. 4. Please adhere to the copyright conditions specified on the following slide. 5. There is a reference slide at the end of the presentation that lists the sources for the images we have used in this presentation. 6. If you would be willing to be in involved in our research study examining how the use of these case studies impacts learning, please contact us at evoed@msu.edu. http://www.evo-ed.com

Copyright: Creative Commons Attribution-NonCommercial-ShareAlike 3.0 Unported (CC BY-NC-SA 3.0) You are free: to Share to copy, distribute and transmit the work to Remix to adapt the work Under the following conditions: Attribution You must attribute the work to the Evo-Ed Project at Michigan State University using the following url: http://www.evo-ed.com Noncommercial You may not use this work for commercial purposes. Share Alike If you alter, transform, or build upon this work, you may distribute the resulting work only under the same or similar license to this one. With the understanding that: Waiver Any of the above conditions can be waived if you get permission from Jim Smith, Merle Heidemann or Peter White at Michigan State University, evoed@msu.edu. Public Domain Where the work or any of its elements is in the public domain under applicable law, that status is in no way affected by the license. Other Rights In no way are any of the following rights affected by the license: Your fair dealing or fair use rights, or other applicable copyright exceptions and limitations; The author's moral rights; Rights other persons may have either in the work itself or in how the work is used, such as publicity or privacy rights. Notice For any reuse or distribution, you must make clear to others the license terms of this work. The best way to do this is with a link to the web page http://creativecommons.org/licenses/by-nc-sa/3.0.

Introduction These slides are provided as a teaching resource for the Monkey Opsins case as described on www.evoed.com. A fuller description of the case can be found on the website. Teaching notes can be found in the notes section beneath each slide when viewing the slides in Normal View in PowerPoint. To select this option in PowerPoint, go to the main menu, choose View and then Normal.

The Natural History of Color Vision and Colorblindness

What is colorblindness? Reduced ability to interpret light as color. 1 in 12 males are colorblind. < 1 in 100 females are colorblind.

Are You Colorblind? A) No (Female) A) Yes (Female) A) No (Male) A) Yes, very (Male) A) Yes, somewhat (Male)

Color Vision in Monkeys Species: Grey Cheeked Mangabey Lives: Africa Vision: Trichromatic vision (i.e. like most humans) Species: White Headed Capuchin Lives: Central and South America Vision: Dichromatic vision (i.e. colorblind.

Color Vision in Monkeys Species: Japanese Macaque Lives: Asia Vision: Trichromatic vision Species: Black Squirrel Monkey Lives: Central and South America Vision: Dichromatic vision

Color Vision in Monkeys Species: Guinea Baboon Lives: Africa Vision: Trichromatic vision Species: White Faced Saki Lives: Central and South America Vision: Dichromatic vision

Color Vision in Monkeys Species: Roloway Monkey Lives: Africa Vision: Trichromatic vision Species: Pied Tamarin Lives: Central and South America Vision: Dichromatic vision

What have you noticed? Is there a relationship between color vision and continent of origin among monkey species?

Monkeys of the World

Question - Why do most New World Monkeys have dichromatic vision while most Old World Monkeys have trichromatic vision?

The Ecology of Color Vision in Monkeys

Ecology: Why Trichromatic Vision? DICHROMATIC VISION One of the above leaves has black fungus on it. Can you tell which one?

Ecology: Why Trichromatic Vision? TRICHROMATIC VISION Leaf with black fungus

Ecology: Why Trichromatic Vision? DICHROMATIC VISION In the above picture, the red leaves are not palatable but the green leaves are nutritious. Which leaves are which?

Ecology: Why Trichromatic Vision? DICHROMATIC VISION TRICHROMATIC VISION With trichromatic vision, distinguishing between important colors becomes possible.

Food Selection The Driver of Trichromacy Evolution?

Research has linked color vision with the ability to select ripe food when foraging. Food Selection

Which peaches are ripe? A) A B) B C) Both A and B D) Neither A nor B E) I can t tell A B

Which peaches are ripe? A. A B. B C. Both A and B D. Neither A nor B E. I can t tell A B

Food Selection The Research Part I TRICHROMATS DICHROMATS Given choice of food vs. Selected ripe fruit 53% of the time. Selected ripe fruit 37% of the time. F 1,10 = 8, p < 0.05, Smith et al., 2003

Food Selection The Research Part II Caine and Mundy, 2000

Predict: What was the result of the Kix experiment? 1. There was no difference in dichromat and trichromat ability to find the Kix in both environments. 2. Trichromats were superior to dichromats in finding orange Kix; there was no difference in ability to find green Kix. 3. Trichromats could find orange AND green Kix better than dichromats. 4. Trichromats were superior to dichromats in finding orange Kix; dichromats were superior to trichromats in finding green Kix.

Food Selection The Research Part II Caine and Mundy, 2000

Food Selection The Research Part II Trichromats are more effective than dichromats selecting orange food in a green environment but dichromats are more effective than trichromats selecting green food in a green environment. Could there be an advantage to being dichromatic in certain environments? Caine and Mundy, 2000

Online Food Foraging Game and Sim: We ve created an online game and simulation versions of Caine and Mundy s research. Try it out for yourself! http://www.evo-ed.com/pages/primates/foraging/foraging.html

If you were in a food-foraging competition, would having color vision give you an advantage over someone who was colorblind? A) Almost certainly. B) Sometimes. C) Unsure. D) Probably not. E) Absolutely not.

If you were in a food-foraging competition, would having color vision give you an advantage over someone who was colorblind? Let s investigate further Go to: http://www.evo-ed.com/pages/primates/patchgame/patchgame.html

Online Color-Vision Game Visit the online color vision game at: http://www.evo-ed.com/pages/primates/patchgame/patchgame.html

The DESIGN Food Selection The Research Part III Saito et al, 2005

The EXPERIMENT Food Selection The Research Part III TRICHROMATIC VISION DICHROMATIC VISION Photo: KENPEI, J Smith Saito et al, 2005

The TRAINING Food Selection The Research Part III Photo: KENPEI Saito et al, 2005

The TRAINING Food Selection The Research Part III Photo: KENPEI Saito et al, 2005

The TEST Food Selection The Research Part III Photo: KENPEI Saito et al, 2005

The TEST Food Selection The Research Part III Photo: KENPEI Saito et al, 2005

The TEST Food Selection The Research Part III Photo: KENPEI Saito et al, 2005

The TEST Food Selection The Research Part III Photo: KENPEI Saito et al, 2005

The TEST Food Selection The Research Part III Photo: KENPEI Saito et al, 2005

The TEST Food Selection The Research Part III Photo: KENPEI Saito et al, 2005

The TEST Food Selection The Research Part III Photo: KENPEI Saito et al, 2005

Food Selection The Research Part III TRICHROMATIC VISION DICHROMATIC VISION Saito et al, 2005

The RESULTS Food Selection The Research Part III Saito et al, 2005

Food Selection Summary Research suggests that trichromatic vision is more likely to be selected for when food is distinguished from non-food by color. Research suggests that dichromatic vision is more likely to be selected for when food is distinguished from non-food by shape.

The Cell Biology of Color Vision in Monkeys

How Does Color Vision Work? Cell Biology

How Does Color Vision Work?

Three types of Cone Cell Different kinds of opsin proteins embedded in the membrane of cone cells. Central Dogma of Molecular Biology: DNA RNA Protein Genes code for. proteins.

Chromatic Vision: Cone Cells Cone cells in the retina of the eye allow light of different wavelengths to be interpreted as color in the brain. Light Waves The Cone cell The Brain Color

Opsin Image modified from Scientific American, April 09 All-trans-retinal 11-cis-retinal Opsin To The All-trans-retinal When produce cone 11-cis-retinal cell the sends signal stimulates a absorbs signal for color the to a the photon vision, opsin brain, retinal (a the resulting basic membrane must unit in of stimulate vision. of light), the it cone changes the cell. opsin from protein 11-cis-retinal but this cannot to All-trans-retinal. occur while the retinal molecule is in its cis- conformation.

The Role of Opsins There are three types of opsins: Short Wave Sensitive (SWS) Medium Wave Sensitive (MWS) Long Wave Sensitive (LWS) An individual possessing only SWS and MWS opsins will have dichromatic vision. An individual possessing SWS, MWS and LWS opsins will have trichromatic vision.

How Does Color Vision Work?

Chromatic Vision: Opsins 3D Visualization 2D Visualization The opsin protein is composed of a string of amino acids. Each green dot in the 2D visualization represents one amino acid.

Opsin Structure MWS opsin LWS opsin The LWS opsin differs from the MWS opsin in three significant places in the amino acid sequence: Position 180: alanine to serine Position 277: phenylalanine to tyrosine Position 285: alanine to threonine

Opsin Response to Light The responses to light of each opsin protein (S, M and L) in trichromats are shown to the right. Note how similar the curves look for M and L. The L curve is shifted by about 30 nm response maximum to the right (longer wavelength).

Opsin Response to Light A third opsin provides another channel for sending color signals to the brain. Three opsin proteins allow the eye to detect a richer variety of light wavelengths resulting in the ability to distinguish more colors.

The Genetics of Color Vision in Monkeys

The Genetics of Color Vision The section of DNA on a chromosome that codes for an opsin protein is called an opsin gene.

Location of Opsin Genes The gene coding for the SWS opsin protein is located on chromosome #7. The gene coding for the MWS and LWS opsins are located on the X-chromosome.

Evolution of LWS Opsin Gene The LWS gene arose through gene duplication and gene mutation of the MWS gene on the X- chromosome.

Origin of the LWS Opsin Gene The LWS gene arose through gene duplication and gene mutation of the MWS gene on the X- chromosome.

Gene Duplication

Unequal Crossing Over (Meiosis, Prophase 1)

Origin of the LWS Opsin Gene The LWS gene arose through gene duplication and gene mutation of the MWS gene on the X- chromosome.

Origin of the LWS Opsin Gene The LWS gene arose through gene duplication and gene mutation of the MWS gene on the X- chromosome.

The MWS Opsin Gene

The MWS Opsin Gene 1092 Nucleotides

The MWS Opsin Gene GTCGTTAGATAG 1092 Nucleotides

MWS Opsin Gene vs. LWS Opsin Gene Each opsin gene is exactly the same length (1092 nucleotides) MWS Opsin Protein vs. LWS Opsin Protein These 1092 nucleotides undergo transcription and translation and result in a protein that is 364 amino acids in length.

LWS GENE MWS GENE MWS Opsin Protein vs. LWS Opsin Protein maqqwslqrl agrhpqdsye dstqssifty tnsnstrgpf egpnyhiapr wvyhltsvwm ifvviasvft nglvlaatmk fkklrhplnw ilvnlavadl aetviastis vvnqvygyfv lghpmcvleg ytvslcgitg lwslaiiswe rwmvvckpfg nvrfdaklai vgiafswiwa avwtappifg wsrywphglk tscgpdvfsg ssypgvqsym ivlmvtccit plsiivlcyl qvwlairava kqqkesestq kaekevtrmv vvmvlafcfc wgpyaffacf aaanpgypfh plmaalpaff aksatiynpv iyvfmnrqfr ncilqlfgkk vddgselssa sktevssvss vspa maqqwslqrl agrhpqdsye dstqssifty tnsnstrgpf egpnyhiapr wvyhltsvwm ifvvtasvft nglvlaatmk fkklrhplnw ilvnlavadl aetviastis ivnqvsgyfv lghpmcvleg ytvslcgitg lwslaiiswe rwlvvckpfg nvrfdaklai vgiafswiws avwtappifg wsrywphglk tscgpdvfsg ssypgvqsym ivlmvtccii plaiimlcyl qvwlairava kqqkesestq kaekevtrmv vvmifaycvc wgpytffacf aaanpgyafh plmaalpayf aksatiynpv iyvfmnrqfr ncilqlfgkk vddgselssa sktevssvss vspa

LWS GENE MWS GENE There are 15 differences between the proteins: maqqwslqrl agrhpqdsye dstqssifty tnsnstrgpf egpnyhiapr wvyhltsvwm ifvviasvft nglvlaatmk fkklrhplnw ilvnlavadl aetviastis vvnqvygyfv lghpmcvleg ytvslcgitg lwslaiiswe rwmvvckpfg nvrfdaklai vgiafswiwa avwtappifg wsrywphglk tscgpdvfsg ssypgvqsym ivlmvtccit plsiivlcyl qvwlairava kqqkesestq kaekevtrmv vvmvlafcfc wgpyaffacf aaanpgypfh plmaalpaff aksatiynpv iyvfmnrqfr ncilqlfgkk vddgselssa sktevssvss vspa maqqwslqrl agrhpqdsye dstqssifty tnsnstrgpf egpnyhiapr wvyhltsvwm ifvvtasvft nglvlaatmk fkklrhplnw ilvnlavadl aetviastis ivnqvsgyfv lghpmcvleg ytvslcgitg lwslaiiswe rwlvvckpfg nvrfdaklai vgiafswiws avwtappifg wsrywphglk tscgpdvfsg ssypgvqsym ivlmvtccii plaiimlcyl qvwlairava kqqkesestq kaekevtrmv vvmifaycvc wgpytffacf aaanpgyafh plmaalpayf aksatiynpv iyvfmnrqfr ncilqlfgkk vddgselssa sktevssvss vspa

LWS GENE MWS GENE Differences at positions 277 and 285 result in spectral shifts of +16-24nm maqqwslqrl agrhpqdsye dstqssifty tnsnstrgpf egpnyhiapr wvyhltsvwm ifvviasvft nglvlaatmk fkklrhplnw ilvnlavadl aetviastis vvnqvygyfv lghpmcvleg ytvslcgitg lwslaiiswe rwmvvckpfg nvrfdaklai vgiafswiwa avwtappifg wsrywphglk tscgpdvfsg ssypgvqsym ivlmvtccit plsiivlcyl qvwlairava kqqkesestq kaekevtrmv vvmvlafcfc wgpyaffacf aaanpgypfh plmaalpaff aksatiynpv iyvfmnrqfr ncilqlfgkk vddgselssa sktevssvss vspa maqqwslqrl agrhpqdsye dstqssifty tnsnstrgpf egpnyhiapr wvyhltsvwm ifvvtasvft nglvlaatmk fkklrhplnw ilvnlavadl aetviastis ivnqvsgyfv lghpmcvleg ytvslcgitg lwslaiiswe rwlvvckpfg nvrfdaklai vgiafswiws avwtappifg wsrywphglk tscgpdvfsg ssypgvqsym ivlmvtccii plaiimlcyl qvwlairava kqqkesestq kaekevtrmv vvmifaycvc wgpytffacf aaanpgyafh plmaalpayf aksatiynpv iyvfmnrqfr ncilqlfgkk vddgselssa sktevssvss vspa

What difference does 24nm make? The difference between the sensitivity of the MWS opsin protein and the LWS opsin protein is only 30nm (534nm vs. 564nm). Most of the difference between MWS and LWS opsins can therefore be explained by these two differences.

LWS GENE MWS GENE A change from alanine to serine at position 180 results in an additional spectral shift of 3-7nm. maqqwslqrl agrhpqdsye dstqssifty tnsnstrgpf egpnyhiapr wvyhltsvwm ifvviasvft nglvlaatmk fkklrhplnw ilvnlavadl aetviastis vvnqvygyfv lghpmcvleg ytvslcgitg lwslaiiswe rwmvvckpfg nvrfdaklai vgiafswiwa avwtappifg wsrywphglk tscgpdvfsg ssypgvqsym ivlmvtccit plsiivlcyl qvwlairava kqqkesestq kaekevtrmv vvmvlafcfc wgpyaffacf aaanpgypfh plmaalpaff aksatiynpv iyvfmnrqfr ncilqlfgkk vddgselssa sktevssvss vspa maqqwslqrl agrhpqdsye dstqssifty tnsnstrgpf egpnyhiapr wvyhltsvwm ifvvtasvft nglvlaatmk fkklrhplnw ilvnlavadl aetviastis ivnqvsgyfv lghpmcvleg ytvslcgitg lwslaiiswe rwlvvckpfg nvrfdaklai vgiafswiws avwtappifg wsrywphglk tscgpdvfsg ssypgvqsym ivlmvtccii plaiimlcyl qvwlairava kqqkesestq kaekevtrmv vvmifaycvc wgpytffacf aaanpgyafh plmaalpayf aksatiynpv iyvfmnrqfr ncilqlfgkk vddgselssa sktevssvss vspa

Positions 180, 277 and 285 Differences in amino acid identity at these three positions can result in a spectral sensitivity shift of 31nm.

LWS GENE MWS GENE Differences at positions 116, 230 and 233 result in smaller spectral shifts of 1-3nm. maqqwslqrl agrhpqdsye dstqssifty tnsnstrgpf egpnyhiapr wvyhltsvwm ifvviasvft nglvlaatmk fkklrhplnw ilvnlavadl aetviastis vvnqvygyfv lghpmcvleg ytvslcgitg lwslaiiswe rwmvvckpfg nvrfdaklai vgiafswiwa avwtappifg wsrywphglk tscgpdvfsg ssypgvqsym ivlmvtccit plsiivlcyl qvwlairava kqqkesestq kaekevtrmv vvmvlafcfc wgpyaffacf aaanpgypfh plmaalpaff aksatiynpv iyvfmnrqfr ncilqlfgkk vddgselssa sktevssvss vspa maqqwslqrl agrhpqdsye dstqssifty tnsnstrgpf egpnyhiapr wvyhltsvwm ifvvtasvft nglvlaatmk fkklrhplnw ilvnlavadl aetviastis ivnqvsgyfv lghpmcvleg ytvslcgitg lwslaiiswe rwlvvckpfg nvrfdaklai vgiafswiws avwtappifg wsrywphglk tscgpdvfsg ssypgvqsym ivlmvtccii plaiimlcyl qvwlairava kqqkesestq kaekevtrmv vvmifaycvc wgpytffacf aaanpgyafh plmaalpayf aksatiynpv iyvfmnrqfr ncilqlfgkk vddgselssa sktevssvss vspa

What difference does 1-3nm make? Smaller shifts are called spectral tuning and can result in very slight differences in color perception. Changes resulting from amino acid differences at spectral tuning sites are not significant enough to classify each variant as a separate functional allele.

LWS GENE MWS GENE Differences at positions 65, 111, 153, 236, 274, 275, 279 & 298 do not cause changes in spectral properties maqqwslqrl agrhpqdsye dstqssifty tnsnstrgpf egpnyhiapr wvyhltsvwm ifvviasvft nglvlaatmk fkklrhplnw ilvnlavadl aetviastis vvnqvygyfv lghpmcvleg ytvslcgitg lwslaiiswe rwmvvckpfg nvrfdaklai vgiafswiwa avwtappifg wsrywphglk tscgpdvfsg ssypgvqsym ivlmvtccit plsiivlcyl qvwlairava kqqkesestq kaekevtrmv vvmvlafcfc wgpyaffacf aaanpgypfh plmaalpaff aksatiynpv iyvfmnrqfr ncilqlfgkk vddgselssa sktevssvss vspa maqqwslqrl agrhpqdsye dstqssifty tnsnstrgpf egpnyhiapr wvyhltsvwm ifvvtasvft nglvlaatmk fkklrhplnw ilvnlavadl aetviastis ivnqvsgyfv lghpmcvleg ytvslcgitg lwslaiiswe rwlvvckpfg nvrfdaklai vgiafswiws avwtappifg wsrywphglk tscgpdvfsg ssypgvqsym ivlmvtccii plaiimlcyl qvwlairava kqqkesestq kaekevtrmv vvmifaycvc wgpytffacf aaanpgyafh plmaalpayf aksatiynpv iyvfmnrqfr ncilqlfgkk vddgselssa sktevssvss vspa

LWS GENE MWS GENE MWS Opsin Gene vs. LWS Opsin Gene (mutations at the nucleotide level that result in protein functional changes) atggcccagcagtggagcctccaaaggctcgcaggccgccatccgcaggacagctatgaggacagcacccagtccagcatcttca cctacaccaacagcaactccaccagaggccccttcgaaggcccgaattaccacatcgctcccagatgggtgtaccacctcaccag tgtctggatgatctttgtggtcattgcatccgtcttcacaaatgggcttgtgctggcggccaccatgaagttcaagaagctgcgc cacccgctgaactggatcctggtgaacctggcggtcgctgacctggcagagaccgtcatcgccagcactatcagcgttgtgaacc aggtctatggctacttcgtgctgggccaccctatgtgtgtcctggagggctacaccgtctccctgtgtgggatcacaggtctctg gtctctggccatcatttcctgggagaggtggctggtggtgtgcaagccctttggcaatgtgagatttgatgccaagctggccatc gtgggcattgccttctcctggatctgggctgctgtgtggacagccccgcccatctttggttggagcaggtactggccccacggcc tgaagacttcatgcggcccagacgtgttcagcggcagctcgtaccccggggtgcagtcttacatgattgtcctcatggtcacctg ctgcatcaccccactcagcatcatcgtgctctgctacctccaagtgtggctggccatccgagcggtggcaaagcagcagaaagag tctgaatccacccagaaggcagagaaggaagtgacgcgcatggtggtggtgatggtcctggcattctgcttctgctggggaccat acgccttcttcgcatgctttgctgctgccaaccctggctaccccttccaccctttgatggctgccctgccggccttctttgccaa aagtgccactatctacaaccccgttatctatgtctttatgaaccggcagtttcgaaactgcatcttgcagcttttcgggaagaag gttgacgatggctctgaactctccagcgcctccaaaacggaggtctcatctgtgtcctcggtatcgcctgcatga atggcccagcagtggagcctccaaaggctcgcaggccgccatccgcaggacagctatgaggacagcacccagtccagcatcttca cctacaccaacagcaactccaccagaggccccttcgaaggcccgaattaccacatcgctcccagatgggtgtaccacctcaccag tgtctggatgatctttgtggtcattgcatccgtcttcacaaatgggcttgtgctggcggccaccatgaagttcaagaagctgcgc cacccgctgaactggatcctggtgaacctggcggtcgctgacctggcagagaccgtcatcgccagcactatcagcgttgtgaacc aggtctatggctacttcgtgctgggccaccctatgtgtgtcctggagggctacaccgtctccctgtgtgggatcacaggtctctg gtctctggccatcatttcctgggagaggtggctggtggtgtgcaagccctttggcaatgtgagatttgatgccaagctggccatc gtgggcattgccttctcctggatctggtctgctgtgtggacagccccgcccatctttggttggagcaggtactggccccacggcc tgaagacttcatgcggcccagacgtgttcagcggcagctcgtaccccggggtgcagtcttacatgattgtcctcatggtcacctg ctgcatcaccccactcagcatcatcgtgctctgctacctccaagtgtggctggccatccgagcggtggcaaagcagcagaaagag tctgaatccacccagaaggcagagaaggaagtgacgcgcatggtggtggtgatggtcctggcatactgcttctgctggggaccat acaccttcttcgcatgctttgctgctgccaaccctggctaccccttccaccctttgatggctgccctgccggccttctttgccaa aagtgccactatctacaaccccgttatctatgtctttatgaaccggcagtttcgaaactgcatcttgcagcttttcgggaagaag gttgacgatggctctgaactctccagcgcctccaaaacggaggtctcatctgtgtcctcggtatcgcctgcatga

LWS GENE MWS GENE MWS Opsin Gene vs. LWS Opsin Gene (mutations at the nucleotide level that result in protein functional changes) atggcccagcagtggagcctccaaaggctcgcaggccgccatccgcaggacagctatgaggacagcacccagtccagcatcttca cctacaccaacagcaactccaccagaggccccttcgaaggcccgaattaccacatcgctcccagatgggtgtaccacctcaccag tgtctggatgatctttgtggtcattgcatccgtcttcacaaatgggcttgtgctggcggccaccatgaagttcaagaagctgcgc cacccgctgaactggatcctggtgaacctggcggtcgctgacctggcagagaccgtcatcgccagcactatcagcgttgtgaacc aggtctatggctacttcgtgctgggccaccctatgtgtgtcctggagggctacaccgtctccctgtgtgggatcacaggtctctg gtctctggccatcatttcctgggagaggtggctggtggtgtgcaagccctttggcaatgtgagatttgatgccaagctggccatc gtgggcattgccttctcctggatctgggctgctgtgtggacagccccgcccatctttggttggagcaggtactggccccacggcc tgaagacttcatgcggcccagacgtgttcagcggcagctcgtaccccggggtgcagtcttacatgattgtcctcatggtcacctg ctgcatcaccccactcagcatcatcgtgctctgctacctccaagtgtggctggccatccgagcggtggcaaagcagcagaaagag tctgaatccacccagaaggcagagaaggaagtgacgcgcatggtggtggtgatggtcctggcattctgcttctgctggggaccat acgccttcttcgcatgctttgctgctgccaaccctggctaccccttccaccctttgatggctgccctgccggccttctttgccaa aagtgccactatctacaaccccgttatctatgtctttatgaaccggcagtttcgaaactgcatcttgcagcttttcgggaagaag gttgacgatggctctgaactctccagcgcctccaaaacggaggtctcatctgtgtcctcggtatcgcctgcatga atggcccagcagtggagcctccaaaggctcgcaggccgccatccgcaggacagctatgaggacagcacccagtccagcatcttca cctacaccaacagcaactccaccagaggccccttcgaaggcccgaattaccacatcgctcccagatgggtgtaccacctcaccag tgtctggatgatctttgtggtcattgcatccgtcttcacaaatgggcttgtgctggcggccaccatgaagttcaagaagctgcgc cacccgctgaactggatcctggtgaacctggcggtcgctgacctggcagagaccgtcatcgccagcactatcagcgttgtgaacc aggtctatggctacttcgtgctgggccaccctatgtgtgtcctggagggctacaccgtctccctgtgtgggatcacaggtctctg gtctctggccatcatttcctgggagaggtggctggtggtgtgcaagccctttggcaatgtgagatttgatgccaagctggccatc gtgggcattgccttctcctggatctggtctgctgtgtggacagccccgcccatctttggttggagcaggtactggccccacggcc tgaagacttcatgcggcccagacgtgttcagcggcagctcgtaccccggggtgcagtcttacatgattgtcctcatggtcacctg ctgcatcaccccactcagcatcatcgtgctctgctacctccaagtgtggctggccatccgagcggtggcaaagcagcagaaagag tctgaatccacccagaaggcagagaaggaagtgacgcgcatggtggtggtgatggtcctggcatactgcttctgctggggaccat acaccttcttcgcatgctttgctgctgccaaccctggctaccccttccaccctttgatggctgccctgccggccttctttgccaa aagtgccactatctacaaccccgttatctatgtctttatgaaccggcagtttcgaaactgcatcttgcagcttttcgggaagaag gttgacgatggctctgaactctccagcgcctccaaaacggaggtctcatctgtgtcctcggtatcgcctgcatga

MWS Opsin Gene vs. LWS Opsin Gene (mutations at the nucleotide level that result in protein functional changes) G T T A G A Three simple substitution mutations change the properties of the opsin protein. Now, rather than being maximally stimulated at ~534nm, the resulting opsin protein is maximally stimulated at ~564nm.

What difference does this make at the protein level?

Evolution of LWS Opsin Gene The LWS gene arose through gene duplication and gene mutation of the MWS gene on the X- chromosome.

Clicker Question: Fact or Fiction? A monkey researcher in South America discovered that some monkey females are trichromatic. 1. Definitely Fact 2. Possibly Fact 3. Possibly Fiction 4. Definitely Fiction

The Case of Trichromatic Females

Genes code for opsin proteins; the opsin proteins facilitate color vision.

The Phylogenetics of Color Vision in Monkeys

Biogeography of Global Monkeys Photo: Frans de Waal, M Arunprasaad, D Wright, P Gonnet, L DeVoldor, W Endo

Monkeys of the World

Phylogenetics Exploring Relationships Among Species

Geology: Plate Tectonics and Drift

How Old are Primates? ~70-80 Million Years Ago

When did primates first inhabit North America?

Human Chimpanzee Gorilla Orangutan Gibbon Rhesus Baboon Mangabey Mona Langur Colobus Capuchin Squirrel Monkey Owl Monkey Marmoset Sakis Spider Monkey Wooly Monkey Continents Split 50 Million Years Ago Color Vision Evolves! Gene Duplication and Mutation Primates In New/Old World 55 Million Years Ago Rise of Primates 75 Million Years Ago

Summary and Application - Color Vision in Monkeys

Complete Evolutionary Picture Genetics Cell Biology Biogeography Ecology Phylogenetics Paleontology Geology

Monkey Color Vision: Natural History

Monkey Color Vision: Ecology Apple Photo: Abhijit Tembhekar

Monkey Color Vision: Cell Biology MWS opsin LWS opsin

Monkey Color Vision: Genetics

Human Chimpanzee Gorilla Orangutan Gibbon Rhesus Baboon Mangabey Mona Langur Colobus Capuchin Squirrel Monkey Owl Monkey Marmoset Sakis Spider Monkey Wooly Monkey Monkey Color Vision: Phylogenetics Continents Split 50 Million Years Ago Color Vision Evolves! Gene Duplication and Mutation Primates In New/Old World 55 MA Rise of Primates 75 MYA

Application Question Many marine mammals have monochromatic vision. Describe this system in terms of its a) Ecology b) Cell Biology c) Genetics d) Phylogenetics

Application Question Research indicates that some human females have tetra-chromatic vision. Describe how this can be possible from a cell biology and genetic perspective.

References The sources for the images we used in this presentation are listed below. If an image is not listed it is believed to be Public Domain. Did we use one of your pictures and not give you proper credit? If so, please let us know: evoed@msu.edu. Section Title, Credit Natural History Section: Mangabey photo, Duncan Wright; Capuchin photo, Jim Smith. Macaque photo, KENPEI; Squirrel Monkey, Claudio Timm Baboon photo, Trisha Sears; Saki photo, Skyscraper Roloway monkey, Public Domain; Tamarin, Whaldener Endo Left column top to bottom: Primate, Public Domain; Bonnet macaque, M Arunprasad; Crested mangabey, Duncan Wright; Blue monkey, Pedro Gonnet. Right column top to bottom: Spider monkey, Public Domain; Capuchin, Whaldener Endo; Squirrel monkey, Linda DeVolder; Capuchins, Frans dewaals. Continental pictures are believed to be Public Domain. All images are previously referenced above. If unreferenced above, they are believed to be Public Domain. Ecology Section: Pears, Public Domain. Black spot, Public Domain; Red and green leaf, Nick Eisen Leaves, 松岡明芳 Apple, Abhujit Tembhekar; Oranges, aliraqicz; Starfruit, S Masters; Lychee, B Navez. Colored shape swatches, Saito, A. et al (2005) American Journal of Primatology 67: 425-436. Cell Biology Section: Chimpanzee, Thomas Lersch; Eye, believed to be Public Domain; Cone Cell, Ivo Kruusamägi. Light Waves, unknown; Cone cell, as above; Brain, unknown. 3D Opsin, Knierim, B. et al. (2007) PNAS 104: 20290 20295. 2D Opsin, Neitz and Neitz (2000) Arch Ophthalmology 118: 691-700. Stimulation curve, www.answers.com/topic/photopsin Molecular Genetics Section: Chromosome, designs and dream designs / FreeDigitalPhotos.net; Primate, Trisha Shears. Chromosome, National Institutes of Health Chromosomes, Evo-Ed Meiosis, Marek Kultys Crossing Over, http://bio3400.nicerweb.com/locked/media/ch08/unequal_crossing_over.html DNA, Unknown Spectral tuning, Neitz and Neitz (2000) Arch Ophthalmology 118: 691-700. Biogeography and Phylogenetics: Plate Tectonics, McGraw Hill Companies Inc. Primate, Journal of Mammalian Evolution Phylogenetic tree, Evo-Ed.

http://www.evo-ed.com