Apicomplexan parasites of red foxes (Vulpes vulpes) in northeastern Poland

DOI: 10.2478/s11686-010-0030-6 W. Stefański Institute of Parasitology, PAS Acta Parasitologica, 2010, 55(3), 210 214; ISSN 1230-2821 Apicomplexan parasites of red foxes (Vulpes vulpes) in northeastern Poland Grzegorz Karbowiak 1 *, Viktória Majláthová 2, Joanna Hapunik 1, Branislav Pet ko 2,3 and Irena Wita 1 1 W. Stefański Institute of Parasitology of the Polish Academy of Sciences, Twarda 51/55, 00-818 Warsaw, Poland; 2 Parasitological Institute of Slovak Academy of Sciences, Hlinková 3, Košice, 040 01, Slovakia; 3 Faculty of Health Care, Catholic University in Ružomberok, Miloša Vesela 21, Ružomberok 034 01, Slovakia Abstract Molecular detection of apicomplexan parasites in splenic samples of red foxes collected from northeastern Poland was conducted by PCR amplification of a fragment of the 18S rrna spanning the V4 gene region of Apicomplexa. Positive PCR products were further analysed by restriction fragment length polymorphism (RFLP) and sequencing to identify species. One hundred and eleven red foxes (Vulpes vulpes) were acquired from 15 localities in the Mazovian Province and 27 foxes were acquired from the Mazurian Lakeland. Apicomplexan 18S rdna was detected in 15.9% of 138 fox spleens examined. Three apicomplexan species were identified: Hepatozoon canis was detected in 11.6% of the spleen samples, Toxoplasma gondii was detected in 3.6% of the spleen samples and a Babesia sp. was sequenced from 1 sample (0.7%). This data represent the first record of H. canis, T. gondii and a B. sp. from naturally infected red foxes in Poland. Infected foxes may act as sylvatic reservoirs of these apicomplexan parasites as well as serving as a source of infection for arthropod definitive hosts and vectors. Keywords Babesia sp., Hepatozoon canis, Toxoplasma gondii, molecular analysis, Vulpes vulpes Introduction The phylum Apicomplexa contains unicellular obligate parasites with great importance in terms of human and veterinary medicine. Species differ in their life cycles, modes of transmission, geographic distributions and disease potential. Red foxes are recognized as an important sylvatic reservoir for zoonotic helminthes in the Slovak Republic and Poland (Antolová et al. 2004, Gawor et al. 2004, Dubinský et al. 2006). However, very little is known about the prevalence of blood and tissue apicomplexan parasites, some of which are zoonotic, in foxes. Babesia canis, B. vogeli and B. gibsoni, apicomplexan parasites of red blood cells, are tick-borne agents of disease in dogs from Europe and North America (Cacciò et al. 2002, Birkenheuer et al. 2003, Adaszek and Winiarczyk 2008). Another pathogenic species morphologically similar to Babesia microti, a parasite of rodents and humans, was isolated from dogs in Spain and Germany (Camacho et al. 2001). Pairwise identities as well as analyses of the 18S rdna demonstrated that this Babesia, referred to as a B. microti-like agent, is only distantly related to the other canine Babesia: it is more closely related to B. microti, B. rodhaini, and Theileria equi. Zahler et al. (2000) suggest that the fauna of small piroplasms in dogs is more complex than previously assumed and that it includes at least two different species. They proposed therefore to name the new species described by them as Theileria annae which is used by some authors only. Hepatozoonosis, a less known but wide spread disease of dogs caused by H. canis and H. americanum, is prevalent in dogs from Europe, Northern and Southern America, and Asia (Ewing et al. 2000; Ewing and Panciera 2003; Criado-Fornelio et al. 2003, 2007; Jittapalapong et al. 2006; Forlano et al. 2007). In dogs in Poland this parasite was not recorded so far. Competent reservoirs of canine babesiosis and hepatozoonosis in Poland are unknown; however, it is known that these pathogens are able to infect wild carnivores. Both natural and experimental infections have been reported (Davis et al. 1978, Maede et al. 1982, Conceicão-Silva et al. 1988, Heerden et al. 1995, Alencar et al. 1997, Kocan et al. 1999, Garrett et al. 2005). Our study focused on molecular detection of apicomplexan parasites in blood and tissue of red foxes from northeastern Poland. Fox carcasses had been frozen then held before ship- *Corresponding author: grzgrz@twarda.pan.pl

Apicomplexa of red foxes in Poland 211 ment to our laboratory until rabies testing was completed. Splenic tissue represented a suitable organ for molecular analysis of haemotagenous parasites since the spleen functions as a reservoir for blood components and removes damaged or parasitized cells. Materials and methods Animals Frozen spleen samples (total 138) from 111 red foxes were acquired from the Sanitary and Epidemiological Station in Ostrołęka located in the Mazovian Province, Poland and 27 spleen samples were acquired from hunters in the Mazurian Lakeland. Habitats of the Mazovian Province (51 00 53 30 N; 19 00 22 30 E) consist of marshy floodplains bordered by dry terraces of river Vistula. The foxes were collected from 15 localities in the Mazovian Province. All animals were shot during routine huntings and delivered to Epidemiological Stations by the hunters. The Mazurian Lakeland (53 52 53 45 N; 21 35 21 19 E) includes more than 2,000 lakes originally formed by meltwaters from the Vistula ice sweet. This region contains numerous marshes, forest mosaics, meadows, pastures and sand dunes. PCR amplification each positive sample, 13 µl amplified DNA was digested at 65 C overnight in a solution containing 5U of Tru1I (300 U/ml) and 1 buffer R (Fermentas). Electrophoresis was conducted in 16% polyacrylamide gel at 150 V for 3 h. The gels were stained with SYBR gold nucleic acid gel stain (Molecular Probes, Leiden, the Netherlands) for 20 min, and bands were visualized with a UV transilluminator. The profile of H. canis, T. gondii and the Babesia sp. contain products in size: 250 bp, 175 bp, 50 bp, 40 bp, 35 bp; 250 bp, 175 bp, 50 bp, 45 bp, 40 bp, 35 bp, 30 bp; 250 bp, 200 bp, 125 bp, 100 bp, 75 bp, 65 bp, 50 bp, 45 bp, 40 bp, 35 bp, 30 bp, respectively. Specimen of different RFLP profiles were further analysed by sequence analysis (Fig. 1). DNA sequencing of PCR products Sequencing was performed at the Department of Molecular Biology (Faculty of Natural Science Commenius University, Bratislava, Slovak Republic). PCR products were purified by using a QIAquick PCR purification kit (Qiagen). The complementary strands of each sequenced product were manually assembled. Sequences were compared with GenBank entries by Blast N2.2.13. Sequence similarity was calculated by EMBOSS Align, a pairwise alignment algorithm (http:// www.ebi.ac.uk/emboss/align). The following sequences were sent to GenBank: H. canis (EU165370), T. gondii (EU165368), and a Babesia sp. (FJ480420). DNA from fox spleen samples were isolated and purified using Genomic Mini AX tissue kit (A&A Biotechnology), according to the manufacturer s protocol. PCR amplification was performed in a 25-µl reaction mixture from the MasterTaq DNA polymerase kit (Eppendorf AG, Hamburg, Germany) containing 10.4 µl deionized water, 5 µl 5 TaqMaster PCR Enhancer, 2.5 µl 10 Taq buffer (with 15 mmol/l Mg 2+ ), 1.5 µl 25-mmol/l solution of Mg (OAc) 2, 0.1 µl Taq DNA polymerase (5 U/µl), 0.5 µl deoxynucleoside triphosphate (dntp) mix (10 mmol/l) (Fermentas, Vilnius, Lithuania), 1.25 µl of each primer (10 pmol/µl) (Invitrogen, Paisley, Scotland), and 2.5 µl DNA template. For detection of apicomplexan parasites, primers amplifying a fragment of the 18S rrna spanning the V4 region of apicomplexans were used, RLB-F (GAGGTAGTGACAAGAAATAACAATA) and RLB-R (TCTTCGATCCCCTAACTTTC) were originally designed for use in reverse line blot (Gubbels et al. 1999). B. canis isolate (EU165369) was used as a positive control. PCR products were electrophoresed on 1% agarose gels stained with GoldView Nucleic Acid Stain (Bejing SBS Genetech Co. Ltd.). The size of amplified fragments was ~ 530 bp. RFLP analysis The PCR products of the 18S rdna were further analysed by restriction fragment length polymorphism (RFLP), according to previously described protocol (Majláthová et al. 2006). For Fig.1. RFLP profiles of apicomplexan parasites identified in red foxes. Abbreviations: a ladder; b and c Hepatozoon canis; d Toxoplasma gondii; e Babesia sp.

212 Grzegorz Karbowiak et al. Results The DNA of apicomplexan parasites was detected in 22 (15.9%) spleen samples from red foxes, all originating from the Mazovian Province. There was no evidence of parasites in spleen samples of foxes from the Mazurian Lakeland. Three species of apicomplexan parasites were identified: H. canis, T. gondii and a Babesia sp. H. canis, detected in 16 samples, was the most prevalent (11.6%). T. gondii was present in 5 samples (3.6%) and a Babesia sp. was found in 1 sample (0.7%). Infection rates for H. canis and T. gondii were variable among localities within the Province, ranging from 0 to 50% for H. canis and 0 to 12.5% for T. gondii. Hepatozoon sequence obtained from foxes in Poland was identical to H. canis sequence from Canis familiaris in Brazil (EU 165370). A comparison of the sequence from red foxes in Poland (EU165370) with the sequence of H. canis 5LIMI strain (DQ869309) obtained from red foxes in Slovakia revealed 99% identity. Despite the high degree of sequence similarity the restriction profiles for the 2 fox isolates were different (Fig. 1), indicating different strains of H. canis in red foxes from the 2 locations. Sequence (EU165368) obtained from one of 5 PCR products revealed 99% identity with T. gondii (TGU03070, M97703, L37415). Sequence (FJ480420) from the Babesia sp. was different from B. canis sequences, and revealed 100% identity with a sequence of B. microti (AY144702) found in foxes in the USA as well as with a sequence (AY144700) detected in dogs from Spain. Discussion Canine hepatozoonosis is an emerging tick transmitted disease. The brown dog tick Rhipicephalus sanguineus is the main vector of the causative agent, H. canis. The autochthonous occurrence of this parasite is restricted to regions where the tick vector occurs. However, H. canis has been detected in naturally infected red foxes in Slovakia where R. sanguineus is not known to be present (Majláthová et al. 2007). R. sanguineus is rarely found in Poland (Siuda 1993). Finding evidence of H. canis in Poland might imply that the range of the tick vector has expanded. Alternatively, another tick species may act as a suitable definitive host and vector of H. canis in Poland and Slovakia. A wide range of carnivorous hosts including domestic dogs, jackals (Shamir et al. 2001), coyotes (Davis et al. 1978), foxes (Conceicão-Silva et al. 1988) and wild dogs (Heerden et al. 1995) are susceptible to H. canis, with high infection rates detected in red foxes from France and Portugal (48%) (Conceicão-Silva et al. 1988), Israel (24%) (Fishman et al. 2004), Japan (Maede et al. 1982) and Spain (Criado-Fornelio et al. 2003). A high prevalence (15.3%) in red foxes from the Mazovian Province was also observed. A high infection rate without pathology and signs of illness might suggest that H. canis is non-pathogenic in red foxes. Conceicão-Silva et al. (1988) arrived at that conclusion based on light-microscopic and histological studies of foxes in Portugal. However, Maede et al. (1982) described the pathological symptoms of hepatozoonosis in young foxes as similar to that observed in ill dogs. Toxoplasma gondii is a widespread apicomplexan parasite that infects a broad range of animals and man. The definitive host is the cat while other animals and man act as intermediate hosts. Transmission can occur through several routes of exposure. Ingestion of sporulated oocysts passed in the faeces of an infected cat through contamination of drinking water, food or objects, ingestion of cysts contained in the tissues of infected meat animals, or transplacental transmission from an infected mother to the offspring are the main methods of transmission. The presence of T. gondii in ticks has been shown (Siuda 1993); however, the significance of this finding is not clear. T. gondii has previously been detected in wild carnivores (Hůrková and Modrý 2006, Prestrud et al. 2008); however, this is the first report of T. gondii in red foxes from Poland. Consumption of infected rodents or infected meat would be the most likely source of exposure for red foxes to this parasite. However, T. gondii infections in red foxes does not represent a direct health risk to people in Poland. Evidence of Babesia sp. in red foxes from Poland should alert veterinarians to the presence of this parasite, a newly recognized pathogen of dogs associated with a high risk of azotemia and mortality (Camacho et al. 2001). Based on the observation of Camacho et al. (2001), Ixodes hexagonus is the main candidate as a vector for this protozoan parasite. I. hexagonus is a widespread nidicolous tick which is present in Poland (Siuda et al. 1993). The decision to use spleen samples was motivated by difficulties in obtaining fresh blood from foxes and the necessity to test foxes for rabies. Fox carcasses were frozen before transport to the Sanitary and Epidemiological Station. Moreover, for the safety of the investigators, rabies testing had to be completed before transporting materials to the laboratory. However, spleen samples should be adequate for diagnosis of blood and tissue parasites through molecular techniques since the spleen is part of the reticuloendothelial system and a reservoir for blood components. This was verified previously by Criado-Fornelio et al. (2003) who used this material to diagnose H. canis in foxes. Identical materials have also been used successfully to detect B. microti in Microtus oeconomus (Karbowiak, unpubl.). Our results confirm the usefulness of spleen samples for molecular diagnosis of blood parasites when fresh blood cannot be obtained, as well as for apicomplexan parasites located in internal organs. Some parasites, such as Hepatozoon and Toxoplasma, are present in almost every internal organ (Conceicão-Silva et al. 1988, Criado-Fornelio et al. 2003). This data represents the first record of H. canis, T. gondii, and a Babesia sp. in red foxes from Poland. Currently, fox populations in Poland have been increasing (Panek and Bresiński 2002, Goszczyński et al. 2008). Foxes frequently en-

Apicomplexa of red foxes in Poland 213 croach on human settlements; thus, red foxes in Poland and the Slovak Republic may serve as sylvatic reservoirs of these apicomplexan parasites posing a health risk to domestic carnivores and to humans. Acknowledgements. This work was supported by the MNISW project N308 017 31/1488, VEGA 2/6163/26 and No. APVV-51-009205. We would like to express our great thanks to Dr. Maria Borlikowska-Bystrzyńska for giving us the biological material for this study. References Adaszek Ł., Winiarczyk S. 2008. Molecular characterisation of Babesia canis canis isolates from naturally infected dogs in Poland. Veterinary Parasitology, 152, 235 241. DOI: 10.1016/ j.vetpar.2007.12.024. Alencar N.X., Kohayagawa A., Santarém V.A. 1997. Hepatozoon canis infection of wild carnivores in Brazil. Veterinary Parasitology, 70, 279 282. DOI: 10.1016/S0304-4017(96)011 19-3. Antolová D., Reiterová K., Miterpáková M., Stanko M., Dubinský P. 2004. Circulation of Toxocara spp. in suburban and rural ecosystems in the Slovak Republic. Veterinary Parasitology, 126, 317 324. DOI: 10.1016/j.vetpar.2004.08.005. Birkenheuer A.J., Levy M.G., Breitschwerdt E.B. 2003. Development and evaluation of a seminested PCR for detection and differentiation of Babesia gibsoni (Asian genotype) and B. canis DNA in canine blood samples. Journal of Clinical Microbiology, 41, 4172 4177. DOI: 10.1128/JCM.41.9.4172-41 77.2003. Cacciò S.M., Antunovic B., Moretti A., Mangili V., Marinculic A., Baric R.R., Slemenda S.B., Pieniazek N.J. 2002. Molecular characterisation of Babesia canis canis and Babesia canis vogeli from naturally infected European dogs. Veterinary Parasitology, 106, 285 292. DOI: 10.1016/S0304-4017(02)00 112-7. Camacho A.T., Pallas E., Gestal J.J., Guitián F.J., Olmeda A.S., Goethert H.K., Telford S.R. 2001. Infection of dogs in northwest Spain with a Babesia microti-like agent. Veterinary Record, 149, 552 555. Conceicão-Silva F.M., Abranches P., Silva-Pereira M.C., Janz J.G. 1988. Hepatozoonosis in foxes from Portugal. Journal of Wildlife Diseases, 24, 344 347. Criado-Fornelio A., Martinez-Marcos A., Buling-Saraña A., Barba- Carretero J.C. 2003. Molecular studies on Babesia, Theileria and Hepatozoon in southern Europe*1: Part I. Epizootiological aspects. Veterinary Parasitology, 113, 189 201. DOI: 10.1016/S0304-4017(03)00078-5. Criado-Fornelio A., Rey-Valeiron C., Buling A., Barba-Carretero J.C., Jefferies R., Irwin P. 2007. New advances in molecular epizootiology of canine hematic protozoa from Venezuela, Thailand and Spain. Veterinary Parasitology, 144, 261 269. DOI: 10.1016/j.vetpar.2006.09.042. Davis D.S., Robinson R.M., Craig T.M.J. 1978. Naturally occurring hepatozoonosis in a coyote. Journal of Wildlife Diseases, 14, 244 246. Dubinský P., Malczewski A., Miterpáková M., Gawor J., Reiterová K. 2006. Echinococcus multilocularis in the red fox Vulpes vulpes from the East Carpathian region of Poland and the Slovak Republic. Journal of Helminthology, 80, 243 247. DOI: 10.1079/JOH2006354. Ewing S.A., Panciera R.J. 2003. American canine hepatozoonosis. Clinical Microbiology Reviews, 16, 688 697. DOI: 10.1128/ CMR.16.4.688-697.2003. Ewing S.A., Panciera R.J., Mathew J.S., Cummings C.A., Kocan A.A. 2000. American canine hepatozoonosis. An emerging disease in the New World. Annals of the New York Academy of Sciences, 916, 81 92. Fishman Z., Gonena L., Harrus S., Strauss-Ayali D., King R., Baneth G. 2004. A serosurvey of Hepatozoon canis and Ehrlichia canis antibodies in wild red foxes (Vulpes vulpes) from Israel. Veterinary Parasitology, 119, 21 26. DOI: 10.1016/j.vetpar.2003.08.012. Forlano M.D., Teixeira K.R.S., Scofield A., Elisei C., Yotoko K.S.C., Fernandes K.R., Linhares G.F.C., Ewing S.A., Massard C.L. 2007. Molecular characterization of Hepatozoon sp. from Brazilian dogs and its phylogenetic relationship with other Hepatozoon spp. Veterinary Parasitology, 145, 21 30. DOI: 10.1016/j.vetpar.2006.10.023. Garrett J.J., Kocan A.A., Reichard M.V., Panciera R.P., Bahr R.J., Ewing S.A. 2005. Experimental infection of adult and juvenile coyotes with domestic dog and wild coyote isolates of Hepatozoon americanum (Apicomplexa: Adeleorina). Journal of Wildlife Diseases, 41, 588 592. Gawor J., Malczewski A., Stefaniak J., Nahorski W., Paul M., Kacprzak E., Myjak P. 2004. Zagrożenie bąblowicą wielojamową (alweokokozą) dla ludzi w Polsce. Przegląd Epidemiologiczny, 58, 459 465. Goszczyński J., Misiorowska M., Juszko S. 2008. Changes in the density and spatial distribution of red fox dens and cub numbers in central Poland following rabies vaccination. Acta Theriologica, 53, 121 127. Gubbels J.M., Vos A.P., Weide M., Viseras J., Schouls L.M., Vries E., Jongejan F. 1999. Simultaneous detection of bovine Theileria and Babesia species by reverse line blot hybridization. Journal of Clinical Microbiology, 37, 1782 1789. Heerden J., Mills M.G., Vuuren M.J., Kelly P.J., Dreyer M.J. 1995. An investigation into the health status and diseases of wild dogs (Lycaon pictus) in the Kruger National Park. Journal of the South African Veterinary Association, 66, 18 27. Hůrková L., Modrý D. 2006. PCR detection of Neospora caninum, Toxoplasma gondii and Encephalitozoon cuniculi in brains of wild carnivores. Veterinary Parasitology, 15, 150 154. DOI: 10.1016/j.vetpar.2006.01.005. Jittapalapong S., Rungphisutthipongse O., Maruyama S., Schaefer J.J., Stich R.W. 2006. Detection of Hepatozoon canis in stray dogs and cats in Bangkok, Thailand. Annals of the New York Academy of Sciences, 1081, 479 488. DOI: 10.1196/annals.1373.071. Kocan A.A., Breshears M.A., Panciera R.J., Ewing S.A., Barker R.W. 1999. Naturally occurring hepatozoonosis in coyotes from Oklahoma. Journal of Wildlife Diseases 35, 86 89. Maede Y., Ohsugi T., Ohotaishi N. 1982. Hepatozoon infection in wild fox (Vulpes vulpes schrencki Kishida) in Japan. Japanese Journal of Veterinary Science, 44, 137 142. Majláthová V., Hurníková Z., Majláth I., Pet ko B. 2007. Hepatozoon canis infection in Slovakia: imported or autochthonous? Vector-Borne and Zoonotic Diseases, 7, 199 202. DOI: 10. 1089/vbz.2006.0598. Majláthová V., Majláth I., Derdáková M., Víchová B., Pet ko B. 2006. Borrelia lusitaniae and green lizards (Lacerta viridis), Karst Region, Slovakia. Emerging Infectious Diseases, 12, 1895 1901. Panek M., Bresiński W. 2002. Red fox Vulpes vulpes density and habitat use in a rural area of western Poland in the end of 1990s, compared with the turn of 1970s. Acta Theriologica, 47, 433 442.

214 Grzegorz Karbowiak et al. Prestrud K.W., Dubey J.P., Asbakk K., Fuglei E., Su C. 2008. First isolate of Toxoplasma gondii from arctic fox (Vulpes lagopus) from Svalbard. Veterinary Parasitology, 151, 110 114. DOI: 10.1016/j.vetpar.2007.11.011. Shamir M., Yakobson B., Baneth G., King R., Dar-Verker S., Markovics A., Arochm I. 2001. Antibodies to selected canine pathogens and infestation with intestinal helminths in golden jackals (Canis aureus) in Israel. Veterinary Journal, 162, 66 72. DOI: 10.1053/tvjl.2000.0572. Siuda K. 1993. Kleszcze Polski (Acari: Ixodida). II. Systematyka i rozmieszczenie. Polskie Towarzystwo Parazytologiczne, Warsaw, 381 pp. Zahler M., Rinder H., Schein E., Gothe R. 2000. Detection of a new pathogenic Babesia microti-like species in dogs. Veterinary Parasitology, 89, 241 248. DOI: 10.1016/S0304-4017(00)00 202-8. (Accepted April 9, 2010)