Molecular study on Salmonella serovars isolated from poultry presented by Enas Fathy mohamed Abdallah
Under The Supervision of Prof. Dr. Mohamed Refai Professor of Microbiology Faculty of Veterinary Medicine, Cairo university Dr. Mahmoud Elhariri Professor Assistant of Microbiology Faculty of Veterinary Medicine, Cairo university Prof. DR. Soad Abd Elaziz Chief Researcher of Poultry Diseases Reference Laboratory for Veterinary Quality Control on Poultry Production Animal Health Research Institute, Dokki
INTRODCTION
Salmonella Salmonella species (Salmonella spp.) are members of the family Enterobacteriaceae. They are Gram-negative, facultative anaerobes, motile and rod-shaped bacteria that inhabit the intestinal tract of animals and may be thus recovered from a wide variety of hosts, specially poultry, humans, foods and environment. Besides, these bacteria may be pathogenic to wild and domestic animals as well as humans
Infection with salmonellae may lead sometimes to fetal salmonellosis, a disease that can remain localized in the gastrointestinal tract as gastro-enteritis, or become generalized septicemia and affect several organ systems. Salmonellae are major pathogen in both humans and animals. They possess several virulence determinants that interact with the host in complex way including haemaglutinins, adhesions invasions, fimbria,exotoxins and endotoxins. Salmonellae has been frequently identified as the etiological agent of foodborne outbreaks.
The Aim Of This Study
1)Prevalence and phenotypic characterization of the isolated Salmonella from poultry through: cultural isolation and biochemical identification of the salmonellae, serological identification of the isolated salmonellae using specific antisera and antimicrobial susceptibility of the isolated Salmonella. 2) Detection of multidrug resistance index.
3) Detection of antibiotic resistance by screening for 4 antibiotic resistance genes (dfra, aada2 blatem, qnrs). 3) Detection of virulence by screening for 6 potential virulence genes (inva, avra, ssaq, mgtc, siid and sopb) by polymerase chain reaction.
MATERIAL AND METHODS
Specimens 400 different samples (liver- gall bladder -yolk saccecum-paper lining chicks, duckling and poult boxes ) were aseptically collected from native and imported chickens, ducks and turkeys for Salmonella isolation.
Isolation and Identification of Salmonella According to ISO 6579(2002) 1_Preenrichment in non selective liquid media Buffered Peptone Water, 2_Enrichment in selective liquid RVS broth Tetrathionate 3_selective solid media XLD agar- HEA
TSI 4_Biochemical tests Lysine iron agar Urea agar 5-Serotyping of Salmonella by different O" and "H" antisera 6_Antimicrobial sensitivity tests Plating on Muller Hinton agar
Antibiotic discs used for sensitivity test (Clinical and Laboratory Standards Institute, CLSI, 2007) Antibiotic Code Disk Concentration 1 Amoxicillin AX 25 μg 2 penicillin P 10 μg 3 Ciprofloxacin CIP 5 μg 4 Doxycycline hydrochloride DO 30 μg 5 Nalidixic acid NA 30 μg 6 Norfloxacin NOR 10 μg 7 Streptomycin S 10 μg 8 Trimethoprim /Sulphamethazole SXT 25 μg
Target genes for antibiotic resistance Genotypic characterization Gene designation dfra aada2 bla TEM qnrs Oligonucleotide sequences (5'-3') AGC ATT ACC CAA CCG AAA GT TGT CAG CAA GAT AGC CAG AT TGTTGGTTACTGTGGCCGTA Function Responsible for trimethoprim resistance Responsible for streptomycin resistance ATCAGCAATAAACCAGC Responsible for B- lactamers resistance GATCTCGCCTTTCACAAAGC CCCCGAAGAACGTTTTC ACGACATTCGTCAACTGCAA TAAATTGGCACCCTGTAGGC Responsible for quinolones resistance PCR product size (in bp) 817 bp 622 bp 516 bp 417 bp
Target genes for Virulo-polymerase chain Reaction Gene designation Function location Oligonucleotide sequences (5'-3') PCR product size (in bp) Inv A enables the invasion of epithelial cell SPI-1 F-gtg aaa tta tcg cca cgt tcg ggcaa R-tca tcg cac cgt caa agg aacg 284 Avr A causes local rearrangement of the actin cytoskeleton leading to cell membrane ruffling, and the active uptake of bacteria by the host cell. SPI-1 F-cct gta ttg ttg agc gtc tgg R-aga aga gct tcg ttg aat gtcc 422 Sop B essential for induction of inflammation) SPI-5 F-tca gaa grc gtc taa cca ctc R-tac cgt cct cat gca cac tc 517 mgtc Intramacrophage survival protein SPI-3 F-tga cta tca atg ctc cag tga at R-att tac tgg ccg cta tgc tgt tg 677 ssaq Secretion system apparatus protein, component of second T3SS SPI-2 F-gaa tag cga atg aag agc gtcgtc c R-cat cgt gtt atc ctc tgt cag c 455 siid HLYD family secretion protein SPI-4 F-gaa tag aag aca aag cga tca tc R-gct ttg ttc acg cct ttc atc 655
RESULTS
The incidence of salmonellae among the examined samples Types of flocks No. of Examined samples No. of Positive samples % Chickens 58 7 12 Ducks 319 9 2.8 Turkeys 23 1 4.3 Total 400 17 4.25 * * The percentage was calculated according to the total number of samples examined.
Results of identification of Salmonella isolates 100% of isolates showed characteristic red colonies with or without black center on XLD at 37 o C and greenish colonies with or without black center on Hekton Enteric agar at 37 o C Salmonella on XLD Salmonella on Hektone enteric agar.
Results of biochemical identification of Salmonella isolates Type of media Urea agar Triple sugar iron agar Lysine agar result of biochemical identification Negative result the color of urea agar was yellow Positive result Gas production, H 2 S production, yellow butt (acidic) and red slant (alkaline). Positive result no gas production, no H 2 S production, deep purple (alkaline )
Results of serotyping of Salmonella isolates Serovars Somatic (O) antigen Flagellar(H) antigen Phase 1 Phase 2 Salmonella Brandenburg 4, 5,12 l,v e,n,z15 Salmonella Braenderup 6,7,14 e,h e,n,z15 Salmonella Colindale 6,7 r 1,7 Salmonella Nigeria 6,7 r 1,6 Salmonella Grampian 6,7 r l,w Salmonella Newport 6,8,20 e,h 1,2 Salmonella Noyao 8 r 1, 7 Salmonella Enteritidis 1,9,12 g,m - Salmonella Newlands 3,10,15,34 e,h e,n,x Salmonella SekondiII 3,10 e,n,x 1,7 Salmonella Lamberhurst 3,10 e,n,z15 - Salmonella Give 3,10,15,34 l,v 1,7 Salmonella Ruzizi 3,10 l,v e,n,z15 Salmonella Sinchew 3,10 l,v Z35 Salmonella Southbank 3,10,34 m,t - Salmonella Harrisonburg 3,10,15,34 Z10 1,6 Salmonella Jedburgh 3,10,15 Z29 -
The percentage of sensitive and resistant of 17 salmonella serovars isolated against 8 antibiotic discs Antibiogram Phenotypic Pattern Resistance Sensitive Intermediat Resistant Total % * No. % * Antibiotic e Amoxicillin 5 2 7 41.2 10 58.5 41.2 Penicillin 7 1 8 47.0 9 53.0 47.0 Doxycycline 1 3 4 23.5 13 76.5 Nalidixic acid 4 0 4 23.5 13 76.5 Streptomycin 5 0 5 29.5 12 70.5 29.5 Ciprofloxacin 1 3 4 23.5 13 76.5 Norfloxacin 2 1 3 17.6 14 82% Trimethoprim 12 0 12 70.6 5 29.4% 70.6 *% according to the total number of examined isolates (17 isolates )
Multidrug resistance patterns for Salmonella isolated (MRD) isolates No. of antibiotics to which the isolate was resistant (a) MAR index(a/b) Salmonella Nigeria 8 1 Salmonella Noyao 7 0.88 Salmonella Grampian 6 0.75 Salmonella Braenderup 5 0.63 Salmonella Brandenburg 4 0.5 Salmonella Harrisonburg 3 0.37 Salmonella Give 3 0.37 Salmonella Lamberhurst 2 0.25 Salmonella Ruzizi 2 0.25 No. of antibiotic to which the isolates were subjected= 8(b)
Detection of antibiotic resistance genes of Salmonella serovars by using conventional PCR 1. Result of PCR for Quinolones resistance gene (qnrs) from DNA of Salmonella. As shown in Photo the agarose gel electrophoresis revealed no amplification product for the 417 bp of qnrs gene.
2. Result for polymerase chain reaction for Trimethoprim resistance gene from DNA (dfra) of Salmonella. The result shown in Photo revealed only 2 isolates were positive both belong to Salmonella Braenderup and Salmonella Brandenburg with percentage 11%.
3. Result for polymerase chain reaction for Streptomycin resistance gene from DNA (aada2) of Salmonella. The result shown in Photo revealed that 8 samples were positive for the gene aada2 of the serovars Salmonella Ruzizi, Salmonella Noyao, Salmonella Give, Salmonella Enteritidis, Salmonella Lamberhurst, Salmonella Newport, Salmonella Grampian and Salmonella Nigeria with percentage 47%.
4. Result for polymerase chain reaction for B-lactams resistance gene from DNA (Blatem) of Salmonella. The result shown in Photo (8) revealed that 7 serovars were positive for Blatem gene. These serovars were Salmonella Harrisonburg, Salmonella Braenderup, Salmonella Newlands, Salmonella Southbank, Salmonella SekondiII, Salmonella Sinchew and Salmonella Brandenburg with percentage 41%.
Genotypic characterization of virulence genes of Salmonella serovars by conventional PCR 1. Result of multiplex PCR for the (inv A) gene from the DNA of Salmonella. The result shown in Photo revealed that 16 serovars were positive with percentage of 94%.These serovars were Salmonella Jedburgh, Salmonella Harrisonburg, Salmonella Braenderup, Salmonella Newlands, Salmonella Southbank, Salmonella SekondiII, Salmonella Sinchew, Salmonella Brandenburg, Salmonella Ruzizi, Salmonella Give, Salmonella Colindale, Salmonella Enteritidis, Salmonella Lamberhurst, Salmonella Newport, Salmonella Grampian and Salmonella Nigeria.
2. Results of multiplex PCR for amplification of the avra gene of Salmonella. The results shown in Photo (10) revealed that 15 serovars were positive with percentage of 88%. These serovars were Salmonella Jedburgh, Salmonella Braenderup, Salmonella Newlands, Salmonella Southbank, Salmonella SekondiII, Salmonella Sinchew, Salmonella Brandenburg, Salmonella Ruzizi, Salmonella Give, Salmonella Colindale, Salmonella Enteritidis, Salmonella Lamberhurst, Salmonella Newport, Salmonella Grampian and Salmonella Nigeria.
3. Results for multiplex PCR for amplification of mtgc gene of Salmonella. The results shown in Photo (revealed that 14 samples were positive with percentage of 82%. These serovars were Salmonella Jedburgh, Salmonella Braenderup, Salmonella Newlands, Salmonella Southbank, Salmonella Sinchew, Salmonella Brandenburg, Salmonella Ruzizi, Salmonella Give, Salmonella Colindale, Salmonella Lamberhurst, Salmonella Newport, Salmonella Grampian and Salmonella Nigeria.
4. Results for multiplex PCR for amplification of ssaq gene of Salmonella. The result shown in Photo revealed that 12 samples were positive with percentage of 70.5%.
5. Results for multiplex PCR for amplification of siid gene of Salmonella. The result shown in Photo revealed that 10 samples were positive with percentage of 59%.
6. Results of PCR for amplification of sopb gene from the DNA of Salmonella. The result shown in photo reveled that 13 samples were positive with percentage of 76.5%.
Conclusion
It could be concluded from the present study that Salmonella was isolated from poultry by percent 4.25%. The traditional culture method consumed more time than PCR. most of strains showed MDR to more than antimicrobial agents, so we must avoid indiscriminate use of antibiotics in treatment or as promoters in animal feed. PCR indicated that most of strains are virulent.