Congratulations on obtaining your Canine Breed Composition DNA Analysis Thank you for choosing Viaguard Accu-Metrics In the following pages you will find: Your dog s Canine Breed Composition DNA Analysis Certificate Key breeds detected Key breed characteristics, health and behaviour MDR1 and EIC Screening
"Semper Fidelis" Level 1 Not Present Dog s Name Alice Level 2 Kintamani Dog & Whippet Family Name Geoffrey Foster-Taylor Level 3 Not Present Date Analyzed Level 4 Chinese Shar-Pei & Rat Terrier 2017/10/17 ID Number 1293341 A person not a dog Level 5 Chow Chow
What your dogs breed composition means Level 1 This category is intended to help owners recognize when their pet's DNA contains a majority of a specific breed (75% or greater). If your dog has a strong match to one of our validated breeds, then it is categorized as Level 1. Most mixed breed dogs will not usually have a breed in this category unless one or both of their parents are purebred. Level 2 This category reports breeds that are easily recognizable within your dog. While these breeds may have a strong influence on your pet, each breed listed makes up less than the majority of your dog's DNA, between 37%-74%. This usually means one of the parents was a purebred. Level 3 This category identifies breeds that have between 20%-36% of the listed breed(s), usually coming from a grandparent. Level 4 Represents 10%-20% of the breed DNA, usually coming from a great grandparent Level 5 This level represents the lowest level of breed in your dog occurring at 5% or less. However, they still appear at a low and measurable amount in your dog's DNA. Please be aware that this breed identification test is designed for the sole purpose of identifying breeds found in the genetic composition of mixed breed dogs. The test can only identify breeds, from those present in our database. It cannot be used to exclude the chance of any other breed being present at some point in the lineage.
Canine Breed Determination Importance of breed results: Acquiring genetic breed heritage knowledge will help educate you about your dog and his or her special health and behaviour traits. You can now be proactive about many of the important factors affecting your dog?s life. You possess insight into your dog?s unique genetic background, including the history of its breed, personality traits, exercise levels, and much more! You have information on any diseases to which your dog may be predisposed. Please make sure to discuss any health issues with your vet and be proactive before any serious illness strikes. Your Dog's Dominant Characteristics Level 1: Not Present Level 2: Kintamani Dog Description: Having an independent nature this breed may be highly territorial on one hand leading to aggressive behavior when other dogs enter into its arena, yet displaying an affectionate and caring nature towards the family they dwell in. They display an intense sense of loyalty when associated with a particular owner. They would even mingle with kids in the family being their perfect playmate when brought up with them. They are excellent climbers and would enjoy going up the roof or even spend an entire day sleeping or lazing comfortably upon the garden wall. Being light-footed they move around with immense ease, and also serve as great guard dogs because of their alert and curious nature as well as their ability to let out a bark at anything strange they see or hear. The Chairman of the National Narcotics Board Republic of Indonesia (BNN) has decided to train Kintamanis along with Beagles as sniffer dogs owing to their small stature that would help them access narrow areas with ease. An extremely hardy breed - no major health issues reported.
Whippet Description: Whippets are quiet, intelligent, and not prone to barking, but require regular exercise. They are generally gentle dogs and may be content to spend much of the day resting. They have been described as 'quiet and dignified in their owner's living room' and make excellent house dogs. They are generally healthy, and are not prone to the frequent ear infections, skin allergies, or digestive problems that can afflict other breeds. Genetic eye defects, though quite rare, have been noted in the breed. Because of this, it is recommended that breeders test for this defect in their breeding stock. Level 3: Not Present Level 4: Chinese Shar-Pei Description: The Chinese Shar-Pei is loyal to their handler, but will not slavishly follow all commands. They are intelligent, dominant and brave. They need a confident owner, or will attempt to assume the role of boss. They will often only follow orders from one family member, unless others establish leadership over them. They hate water, and will go to great lengths to avoid it. The Chinese Shar-Pei may exhibit hereditary skin problems. They may have kidney problems which be displayed in fevers and swollen hocks syndrome. Rat Terrier
Description: Rat Terriers often are less aggressive than Parson Russells; although they have a terrier personality they also have an 'off switch' and love lounging on the sofa in a lap as much as tearing about the yard. Rat Terriers are normally cheerful dogs, and they tend to be calmer and more sensitive than Jack Russells to changes in their environment, owner's moods, or to unexpected noises, people, and activities. The social sensitivity of Rat Terriers makes them very trainable and easier to live with for the average pet owner. It is very important to socialize these dogs from an early age. Proper socialization of a Rat Terrier puppy includes exposing the animal to a wide variety of people and places. Skin and coat Allergies, cardiac abnormalities, hip dysplasia, The average lifespan of a Rat Terrier is 18 years. Level 5: Chow Chow Description: The Chow Chow has an innate sense of dignity, and may seem aloof and detached. They may be restrained with their affections and are very independent. They are usually well mannered, but can be protective and suspicious of strangers. They can learn, but do not have a strong desire to please their masters, and must see the point of commands given. They may have limited peripheral vision, and should always be approached from the front. Chow Chows may be self-willed to the point of seeming obstinate. The Chow Chow is prone to hip dysplasia and eye problems such as entropion, which is an inward rolling of the eyelid.
VIA-PET uses a computer algorithm that performs 30 million calculations to predict the most likely pedigree. The combination of breeds for the last 30 generations are displayed depicting the best statistical results are. Your Dog's Unique Genetic Sequence CCAACCTTGCTCCCGACCAAGGCGGCCTGGAGAGAGGAAGCGCGAATCTGCTCGGGGTTGCATTGTGGAT GCCAATCTCAGTGTTCTCAATTTGGTTATTGTGAAAAAATGGGAGAAGGATACTCCTGGACTCACTGATA CTACTGTGCCTCGTCGCCTGGGGCCCAAAAGAGCCAGCAGAATCCCAAAGCTTTCTAATCTGTCAAAAGA AGACGATGCCCACCAGTATGCTGCTGGAAAGCCCCTAAACAAAGAAGGTAAGAAACCTAGAACCAAAGCA CCCAAGATTCAGCGTCTTGTTACTCCACGTGTCCTCCAACACAAACGTCGGCGTATTGCTTTGAAGAAAC AGCGTACTAAGAAAAATAAGGTAGAGGCTGCAGAATATGCTAAACTTTTGGCCAAGAGTTTGTTCGAGGG
MDR1 and EIC Screening Results Condition Tested Gene Test Results Multi Drug Resistance MDR1 Negative Exercise Induce Collapse EIC Negative