Mendel: Understanding Inheritance. What is Genetics?

Gregor Mendel The father of genetics 1822-1864 Mendelian Genetics & Punnett Squares What is Genetics? GENETICS - is the science of how traits are inherited. In other words, how traits pass from parent to offspring. What are TRAITS? TRAITS are characteristics (the way we look, are, or think). For example, eing tall or short, lond or dark-haired, rown eyes or lue eyes, light or dark skinned, funny or serious, etc Traits are genetic and are passed down from parent to offspring. Who was Gregor Mendel? Gregor Mendel was an Austrian monk, who lived in the 1800 s. Mendel conducted thousands of experiments on pea plants to see how traits (shape, color) were passed from generation to generation. Mendel is known as the Father of Genetics for figuring out the asic rules of how traits are inherited. What type of experiments did Mendel do? Mendel crossed pea plants with different traits (eg. tall & short). He started with PURERED plants (showed same trait for many generations short parents had short offspring) He crossed a tall parent with a short parent to see what the offspring plants would look like. The 1 st generation of offspring were ALL tall! The short trait was lost it had disappeared. What happened? In the 2 nd generation, the lost short trait reappeared in ¼ of the offspring. (Even though neither parent was short!) Mendel tested MANY traits and found that one form of the trait was always dominant in the first generation of offspring, ut that the hidden trait re-appeared in 25% of the second generation. So, what are Mendel s rules of inheritance? Mendel figured out that: Traits are controlled y PAIRS of factors (genes) that are inherited from your parents (one from mom, one from dad). Some factors are dominant - they mask or hide the other factor. (For example, the tallness gene hides the shortness gene in pea plants.) Let s get the new vocaulary straight GENES - are the factors that control an inherited trait. ALLELES are the different forms of a gene. (the TALL and SHORT alleles are the 2 forms of the HEIGHT gene in pea plants) *We inherit one allele (or form of a gene) from our mom and one allele from our dad, so we have 2 alleles for every gene. 1

Let s get the new vocaulary straight Let s get the new vocaulary straight Let s get the new vocaulary straight DOMINANT ALLELE - is one whose trait always shows up when the allele is present. It can mask or hide the other form of the trait. It is shown with an upper-case letter, for example T. Example: Tall stems = TT or Tt RECESSIVE ALLELE is one whose trait is hidden whenever the dominant allele is present. It will only show up if OTH alleles are recessive. It is shown with a lower-case letter, for example t. Example: Short stems = tt HOMOZYGOUS - Organisms with 2 same alleles. HETEROZYGOUS - Organisms with 2 different alleles. TT Tt tt Tt Let s review When you cross the tall and the short plant, the offspring get a Tall allele (T) from the tall plant and a short allele (t) from the short plant. In the first generation, the dominant TALL allele hides the recessive SHORT allele, so ALL the offspring are tall. They are all heterozygous. TT tt Tt Tt What happens if heterozygous plants cross? In the SECOND generation, the heterozygous plants cross and it s possile to have an offspring with the 2 recessive alleles. With 2 recessive alleles, the plant will e SHORT, not tall. TT tt Tt Tt TT Tt Tt tt SUMMARY When studying genetics, we need to take 2 things into account: PHENOTYPE - an organism s PHYSICAL appearance. (3 plants are tall, 1 is short) GENOTYPE an organism s GENETIC makeup (alleles). (1 plant is TT, 2 plants are Tt, and 1 plant is tt) TT Tt Tt tt Proaility & Heredity: Punnett Squares How can we figure out which traits will e inherited? To talk aout inheritance, we need to use our new vocaulary We ve learned aout dominant & recessive alleles: Dominant alleles are more powerful, and can hide a recessive trait. Shown with an upper-case letter ( T for tall stems) Recessive alleles can e hidden when a dominant allele is present. Shown with a lower-case letter ( t for short stems) How can we figure out which traits will e inherited? You know the differences etween genotype and phenotype: Genotype descries which genes (alleles) are present.» TT = 2 dominant alleles» Tt = 1 dominant & 1 recessive» tt = 2 recessive alleles Phenotype descries what the physical trait looks like.» Tall stems (TT and Tt)» Short stems (tt) 2

More vocaulary Geneticist use 2 terms to descrie GENOTYPE: Homozygous the organism has 2 same alleles.» TT = 2 dominant alleles» tt = 2 recessive alleles Heterozygous the organism has 2 different alleles.» Tt = 1 dominant & 1 recessive allele So, how do we know which genotype or phenotype the offspring will e? We can use a tool called a punnett square to predict how likely it is for an offspring to inherit certain traits. A PUNNETT SQUARE: is a chart that shows ALL the possile cominations of a genetic cross. shows genotype and phenotype of the offspring. is also used to predict the proaility (the chance) that an offspring will have a certain trait. How do we draw a Punnett Square? R is dominant for Round seeds. r is recessive for wrinkled seeds. oth parents are heterozygous and have round seeds. The two-letter cominations are the possile genotypes of the offspring. They are RR, Rr, Rr, and rr genotypes. From this it is possile to determine the proaility (chance) that a seed will have: a round seed phenotype (3/4 or 75%) OR a wrinkled seed phenotype (1/4 or 25%) Try one on your own Cross a homozygous guinea pig with lack fur () with a homozygous guinea pig with white fur (). 3

The result? All 4 possile offspring will e heterozygous and have one dominant allele for lack fur and 1 recessive allele for white fur. All the guinea pigs will have the lack fur phenotype; and genotype. More practice prolems 1) Cross a heterozygous tall pea plant (Tt) with a homozygous short pea plant (tt). Tall stems (T) are dominant over short stems (t). What are the possile offspring from this cross? 2) Cross a rait who is heterozygous for short ears (Ee) with another rait who is heterozygous for short ears (Ee). Short ears (E) are dominant over long, floppy ears (e). What are the possile offspring from this cross? Proaility & Heredity: Punnett Squares How can we figure out which traits will e inherited? To talk aout inheritance, we need to use our new vocaulary We ve learned aout dominant & recessive alleles: Dominant alleles are more powerful, and can hide a recessive trait. Shown with an upper-case letter ( T for tall stems) Recessive alleles can e hidden when a dominant allele is present. Shown with a lower-case letter ( t for short stems) How can we figure out which traits will e inherited? You know the differences etween genotype and phenotype: Genotype descries which genes (alleles) are present.» TT = 2 dominant alleles» Tt = 1 dominant & 1 recessive» tt = 2 recessive alleles Phenotype descries what the physical trait looks like.» Tall stems (TT and Tt)» Short stems (tt) More vocaulary Geneticist use 2 terms to descrie GENOTYPE: Homozygous the organism has 2 same alleles.» TT = 2 dominant alleles» tt = 2 recessive alleles Heterozygous the organism has 2 different alleles.» Tt = 1 dominant & 1 recessive allele So, how do we know which genotype or phenotype the offspring will e? We can use a tool called a punnett square to predict how likely it is for an offspring to inherit certain traits. A PUNNETT SQUARE: is a chart that shows ALL the possile cominations of a genetic cross. shows genotype and phenotype of the offspring. is also used to predict the proaility (the chance) that an offspring will have a certain trait. How do we draw a Punnett Square? R is dominant for Round seeds. r is recessive for wrinkled seeds. oth parents are heterozygous and have round seeds. 4

The two-letter cominations are the possile genotypes of the offspring. They are RR, Rr, Rr, and rr genotypes. From this it is possile to determine the proaility (chance) that a seed will have: a round seed phenotype (3/4 or 75%) OR a wrinkled seed phenotype (1/4 or 25%) Try one on your own Cross a homozygous guinea pig with lack fur () with a homozygous guinea pig with white fur (). (lack fur is dominant over white fur). Try one on your own Cross a homozygous guinea pig with lack fur () with a homozygous guinea pig with white fur (). Try one on your own Cross a homozygous guinea pig with lack fur () with a homozygous guinea pig with white fur (). Try one on your own Cross a homozygous guinea pig with lack fur () with a homozygous guinea pig with white fur (). The result? All 4 possile offspring will e heterozygous and have one dominant allele for lack fur and 1 recessive allele for white fur. All the guinea pigs will have the lack fur phenotype; and genotype. 5

More practice prolems Review Review 1) Cross a heterozygous tall pea plant (Tt) with a homozygous short pea plant (tt). Tall stems (T) are dominant over short stems (t). What are the possile offspring from this cross? 2) Cross a rait who is heterozygous for short ears (Ee) with another rait who is heterozygous for short ears (Ee). Short ears (E) are dominant over long, floppy ears (e). What are the possile offspring from this cross? Tall eyealls (T) are dominant over short eyealls (t). Mr. Kras is homozygous for tall eyealls. What is his genotype? T T Mrs. Kras is heterozygous (Tt). Does she have tall eyealls or short eyealls? Tall eyealls (the short allele is hidden). Draw the punnett square for Mr. and Mrs. Kras. T t T TT Tt T TT Tt Any ay that Mr. and Mrs. Kras would have tall eyes (100% chance), ecause they get a dominant TALL eyeall allele from Mr. Kras. While 50% of their kids might have the short eyeall gene from their mom, it is ALWAYS hidden if the dominant (T) gene is present! Punnett Square Practice Prolems To test his genotype, she Dalmatians A She dog will reeder only are reed has often a the male orn dog dog deaf. if reeds him to a deaf (dd) These that his genotype she dogs would are is like DD, deaf to so if reed. there they will female. Use Punnett squares to inherit The e no dog risk two can of copies hear, deafness so of she the in the knows predict the outcomes if the recessive his puppies. genotype allele is either for hearing DD or (d). Dd. male is DD or Dd. 1)Show your punnett square for each cross. 2) Give the phenotypes of the offspring. Will the puppies e deaf or hearing? Punnett Square Practice Prolems To test his genotype, she reeds him to a deaf (dd) female. Use Punnett squares to predict the outcomes if the male is DD or Dd. If D the male D is If the male is homozygous D d heterozygous (Dd), d Dd Dd dominant (DD), d Ddall puppies half of the puppies will dd will e ale to hear. The e orn deaf. They will d Dd Dd recessive d deaf Dd allele dd is e homozygous for the hidden. recessive deaf allele. Punnett Square Practice Prolems Cindy wants to know if their Jimmy Neutron and Cindy children will all have ig, poofy Vortex may pretend not to hair ( or ), the dominant like each other, ut they end trait in Retroville. Jimmy and up marrying later in life! Cindy are oth heterozygous for the ig hair trait. What are Jimmy and Cindy s genotypes? Jimmy = Cindy = Punnett Square Practice Prolems Cindy, who is proud of her ig hair, does not want a flathaired child (). Set up a Punnett square to figure out whether Cindy will e disappointed or not. rain last! 25% of our kids will have flat hair. Sorry Cindy! Challenge Question! In purple people-eaters, 2-horns is dominant (H), and no horns is recessive (h). Two purple people-eaters crossed and they had 4 children shown elow. (What are the genotypes?) Work ackwards from a punnett square to find out the genotypes and phenotypes of the parents. Hh hh hh Hh Challenge Question! What are the genotypes and phenotypes of the parents? Genotype = Hh, hh Phenotype = One parent had horns, the other parent had no horns! h? h?? H? h Hh Hh hh hh Hh hh hh Hh 6

Incomplete Dominance With some traits, there is a situation where the What dominant you think allele will is not happen completely in this dominant. cross? When RR (red the flowers) organism x is rr heterozygous, (white flowers) the trait is expressed as a lend. All offspring will e heterozygous ut NOT red (ecause it is not completely dominant). R R They will e a lend of red and white PINK! r Rr Rr r Rr Rr Incomplete Dominance What if we cross 2 of the pink flowers? Rr (pink flowers) x Rr ( pink flowers) R r R RR Rr r Rr rr 1 (RR) has RED flowers. 2 are a lend (Rr) PINK flowers. 1 (rr) has white flowers. Exit Slip In humans, rown eyes () are dominant over lue (). A man who is heterozygous for rown eyes marries a lue-eyed woman and they have 3 kids. 1) What is the genotype of the father? 2) What is the genotype of the mother? 3) Draw a punnett square for this cross. 4) What are the possile phenotypes and genotypes of their children? 5) What is the proaility (% chance) that their child will have lue eyes? rown eyes? Genetics: The Science of Heredity What is Genetics? GENETICS - is the science of how traits are inherited. In other words, how characteristics pass from parent to offspring. So, what are genes anyway? Genes are: The asic unit of inheritance (they are what you get from your parents). Pieces of DNA (more on that later ) The recipe for making YOU. (Genes make proteins & proteins make up your cells). What make you different from one another. No one else has your exact, unique comination of genes. Where are my genes? Your genes are inside all the cells of your ody. Inside the nucleus of your cells, are chromosomes. Chromosomes are made of tightly wound up DNA (called chromatin). The DNA code makes up your genes. Chromosomes?!?! Chromosomes are tightly wound-up packages of DNA. Humans have 23 pairs of chromosomes, 46 in all. (Sperm & Egg cells only have 23 single chromosomes!) Each parent contriutes one chromosome to each pair, so you get half your chromosomes from your mom and half from your dad. Tell me more aout DNA DNA stands for: deoxyrionucleic acid. Sound it out. DE OXY RYE OW NEWK LAY IC ACID. DNA is a giant molecule made of certain chemicals. 7

The Structure of DNA DNA looks like a long, twisted ladder called a DOULE HELIX. There are 2 long strands. These are the sugar-phosphate ackones of DNA. The steps of the ladder that connect the strands are asepairs. There are only 4 different chemicals that ond the 2 strands together: ADENINE (A) THYMINE (T) CYTOSINE (C) GUANINE (G) The Structure of DNA Only ond with each other! Only ond with each other! Order of the ase Pairs = Genetic Code The order of the ase pairs (ACGTGCGATAT) are the recipe for how the proteins will e made If you have 1 of the strands, you can uild a protein y matching up the missing ases: G T C A This is how DNA copies itself and makes proteins! Mutations Sometimes, mistakes are made when DNA is copied. These mistakes are called MUTATIONS. There are 3 types: sustitution, deletion, addition. Effects of Mutations Some mutations are harmful, some are helpful, and others don t make much of difference. Mutations add GENETIC VARIETY. We are all different ecause mutations have occurred in our genetic code. Weed toes! So, how many genes do we have anyway? The HUMAN GENOME: Has 3 illion ase pairs of DNA! Includes aout 35,000 genes! 99.9% of your DNA is identical to everyone else s. All our differences come from that 0.1%! - The DNA Connection Review Inside your cells, you have chromosomes (23 pairs!). Chromosomes are made of long strands of DNA. DNA has a doule helix shape (twisted ladder). DNA is made of cominations of nitrogen ase-pairs (A-T, C-G). These cominations are the recipes for making proteins. GATGCTAC CRACKING AAT THE GEN TCCAGCA ETIC CODE TTCG What is DNA? DNA stands for deoxyrionucleic acid. DNA is the chemical that makes up our genes. Your DNA is your GENETIC CODE - it is the recipe or the set of instructions to make YOU! 8

What does DNA look like? It is shaped like a twisted ladder called a doule helix. There are 2 long strands the sugar-phosphate ackones. The steps of the ladder are the ase-pairs that connect the 2 strands. What is the Genetic Code? There are only 4 different chemicals that ond the 2 strands together: C only onds with G A only onds with T What is the Genetic Code? The order of the ase-pairs is your genetic code! ATGCTGCATGCCTGAAATAGCTA TACGACGTACGGACTTTATCGAT This code isn t nonsense! It s the recipe for making the proteins that make up YOU! How does your ody read this code and know which proteins to make? The Each ody codon reads is one the small code part 3-ases of the at a time. instructions Each group that tells of 3-ases the ody is called to a make CODON. a specific protein. ATG TTCCAA GCC TCATTC Genetic Code-reaking! Try using the codon key to decode a set of instructions! Why were there different pictures? The original code said GAC AGA GCA TGG ATT GCA ATT CAC CCG ACG AGC GAA ATT DRAW GCA AAC A HOUSE GAC ATT GCA AND ATT A AGA RED GAA FISH GAC ATT IN TTC A OWL. ATA AGC CAC ATT ATA AAC ATT GCA ATT GCG CCG TGG TTA ut one group had one codon switched GAC AGA GCA TGG ATT GCA ATT CAC ATG CCG ACG AGC GAA ATT DRAW GCA AAC A MOUSE GAC ATT GCA AND ATT A AGA RED GAA FISH GAC ATT IN TTC A OWL. ATA AGC CAC ATT ATA AAC ATT GCA ATT GCG CCG TGG TTA Another group had a codon switched and an extra codon inserted GAC AGA GCA TGG ATT GCA ATT CAC CCG ACG AGC GAA ATT DRAW GCA AAC A HOUSE GAC ATT GCA AND ATT A AGA DEAD GAC GAA FISH GAA GAC IN ATT A OWL. TTC ATA AGC CAC ATT ATA AAC ATT GCA ATT GCG CCG TGG TTA The last group had several codons deleted GAC AGA GCA TGG ATT GCA ATT CAC CCG ACG AGC GAA DRAW A HOUSE AND A ATT GCA AAC GAC ATT GCA ATT AGA GAA RED GAC FISHOWL. ATT TTC ATA AGC CAC ATT ATA AAC ATT GCA ATT GCG CCG TGG TTA 9

What happens if there is a mistake in the code? Sometimes, These mistakes mistakes are called are made MUTATIONS. when DNA is There copied. are 3 types: SUSTITUTION DELETION ADDITION What is the effect of a mutation? The mutation changes the meaning of the code It messes up the instructions! For example look at the effect of taking out one letter from this sentence THE ATC FAT CAT ATA ATE TET THE HER RAT. DELETION Mutation ut Deleting rememer, even 1 codons ase pair are read can make in 3 letter a ig difference! sections, so all the letters move over What is the effect of a mutation? THE AT FAT CAT ATE THE RAT. SUSTITUTION Mutation Changing 1 ase pair may make a small difference or THE FAT FAAT TCA CAT TAT ATE ETH THE ERA RAT. ADDITION Mutation a ig difference! What is the effect of a mutation? Some Mutations mutations add GENETIC are harmful VARIETY. UT, We are some all different can e helpful, ecause and others don t mutations make have much occurred difference. in our genetic code. Weed toes! What is a pedigree chart? How is it used? One important tool a geneticist uses to trace the inheritance of traits is a pedigree chart. A pedigree chart is one that geneticists use to track an inherited trait through several generations of a family to try to understand how it is inherited. How do you read a pedigree chart? A CIRCLE represents a FEMALE. A SQUARE represents a MALE. A horizontal line represents marriage. A vertical line and rackets connects parents to children. How do you read a pedigree chart? A shape that is not shaded indicates that the person does NOT have the trait. A shape that is half-shaded indicates that the person is a carrier (has 1 allele). A shape that is completely-shaded indicates that the person has the trait (homozygous oth alleles for the trait). 10

What does this pedigree chart show? What does this pedigree chart show? How many people are unaffected carriers? How many people are affected y the disorder? How many carriers are female? If only 1 parent is a carrier, what is the proaility of having a child with the disorder? How many people are unaffected carriers? How many people are affected y the disorder? Can we tell if the disorder is dominant or recessive? If 1 parent has the disorder, what is the proaility of having a child with the disorder? Genetic Disorders What are genetic disorders? A genetic disorder is an anormal condition that a person inherits through their genes or chromosomes. What are genetic disorders? Some are caused y mutations in DNA. For example, sickle cell disease! What are genetic disorders? This is a picture of ALL your chromosomes called a karyotype. Others are caused y igger changes in the chromosome. For example, having too many chromosomes Down Syndrome. How do you get a genetic disorder? Genetic disorders like Cystic Firosis are NOT contagious! You can t catch them from someone else who is sick! You inherit them from your parents. Sickle Cell Disease What is Sickle Cell Disease? Affects millions around the world, mostly in Africa Aout 70,000 Americans are estimated to have the disease Aout 1000 aies are orn with the disease in the US each year 11

What is Sickle Cell Disease? Sickle cell is passed on y a recessive gene People with only one copy of the gene are healthy Since they can still pass on the recessive sickle-cell gene, these people are called carriers Sickle cell gene in lue Can e covered up y the dominant gene (red). What is Sickle Cell Disease? People with two copies of the sickle cell gene have sickle cell disease + If two people who are oth carriers have children, what is the possiility of their child having sickle cell disease? Set up a Punnett square on the ack of your video guide to figure this out! = sickle cell disease Punnett Square Carriers are heterozygous (they have one dominant gene and one recessive gene) H h H HH Hh h Hh hh There is a 25% chance that their child will have the sickle cell disease. What does it do to you? People with two copies of the sickle cell gene have sickle cell disease The gene codes for hemogloin, an important protein in red lood cells The anormal form of hemogloin clumps together, which changes the shape of the red lood cells + = sickle cell disease What does it do to you? Sickled cells are fragile, sticky, and stiff These cells can get trapped in lood vessels, making it impossile for lood to get through Muscles and organs that depend on lood for oxygen and nutrients can suffer or even stop working Genetics & Heredity Unit Review Where in the cell do you find the genetic material? A. riosome. cell memrane C. rain D. nucleus What does Tt mean to geneticists? A. Two dominant alleles. Two recessive alleles C. One dominant and one recessive allele D. Homozygous allele What is the proaility of producing a tall pea plant from a genetic cross etween 2 hyrid tall plants? A. 1 in 4 (25%). 2 in 4 (50%) C. 3 in 4 (75%) D. 4 in 4 (100%) 12

4/3/2015 What determines the genetic code? A. the order of nitrogen ase-pairs along a gene. the numer of nitrogen asepairs in a DNA molecule C. the order of amino acids in a protein D. The numer of cytosine and guanines in a molecule A homozygous lack rait () is crossed with a homozygous white rait (). What is the % proaility the offspring will have white fur? A. 0%. 25% C. 50% D. 75% Which comination of sex chromosomes result in a male human eing? A.. C. D. XX YY XY Either XX or YY What is the missing genotype in the punnett square? A.. C. D.? We know that the alleles for detached/free earloes (E) is dominant over attached earloes (e). What is the dominant phenotype? A. EE. Ee C. Detached earloes D. Attached earloes An organism s genotype is its: A.. C. D. genetic makeup chromosome numer physical appearance stem height What is the total magnification of a microscope when the eyepiece is 10x magnification and the medium power ojective is 10x? A. 10x. 100x C. 1x D. 20x What is a mutation? A. Any change that is harmful to an organism. Any change in a gene or chromosome C. Any change that is helpful to an organism D. Any change in phenotype Chromosomes are made up of: A. one pair of alleles. messenger RNA C. cells D. Many genes joined together 13

4/3/2015 Genetic disorders are caused y: What is the purpose of the Human Genome Project? A. pedigrees.. DNA mutations or changes in chromosomes C. Dominant alleles only. D. Recessive alleles only. A. to identify the DNA sequence of every gene in the human genome. To clone every gene on a single chromosome in human DNA C. To cure genetic diseases D. To inreed the est genes on every chromosome of human DNA How do geneticists use pedigree charts? What would e the est way to determine the proaility of a ay having cystic firosis? A. to create genetic crosses. To replicate strands of DNA C. To prove recessive traits are most common D. To trace inheritance of traits in a family A. y studying the parents cells. y studying the family s pedigree chart C. y exploring new methods of genetic engineering D. y determining if the parents have co-dominant alleles What genetic disorder results in anormally shaped lood cells? What controls the variation in skin color among humans? A. A person s diet. Many genes C. Multiple alleles of a single gene D. Two alleles of a single gene A. Hemophilia. Down syndrome C. Cystic firosis D. Sickle-Cell Disease The Human Genome Project (HGP) can help genetic engineers produce human proteins ecause: A. Identical twins have identical DNA. The HGP has determined the structure of trna. C. The HGP has determined the structure of proteins. D. To produce a protein, geneticists must know the sequence of DNA ases that code for a protein. 14