Novel antimicrobial resistance genes among livestock-associated MRSA ST398 from swine and cattle Kristina Kadlec, Andrea Feßler and Stefan Schwarz Institute of Farm Animal Genetics,, Friedrich-Loeffler Loeffler-Institut (FLI) Neustadt-Mariensee, Germany
Two studies on the analysis of LA-MRSA ST398 for virulence and resistance properties little variation in virulence but considerable variation in antimicrobial resistance
Porcine MRSA ST398 Resistance phenotype N Resistance to BLA, TET, CHL/FFC, MLS B, TMP, GEN 1 BLA, TET, CHL, MLS B, TMP, SXT 1 BLA, TET, MLS B, TMP, SPE, TIA 3 BLA, TET, MLS B, TMP, GEN 1 BLA, TET, MLS B, TMP, ENR 1 BLA, TET, MLS B, TMP, TIA 1 BLA, TET, CHL/FFC, TMP 1 BLA, TET, MLS B, TMP 8 BLA, TET, MLS B, ENR 2 BLA, TET, MLS B, GEN 1 BLA, TET, TMP, ENR 1 BLA, TET, TMP, GEN 2 BLA, TET, TMP, TIA 1 BLA, TET, MLS B 4 BLA, TET, TMP 7 BLA, TET, GEN 1 BLA, TET, SPE 1 BLA, TET, TIA 1 BLA, TET 16 6 classes of antimicrobial agents 9.3% 5 classes of antimicrobial agents 5.6% 4 classes of antimicrobial agents 29.6% 3 classes of antimicrobial agents 25.9 % 29.6% 55.5% 85.1% Kadlec et al. (2009) J Antimicrob Chemother 64: 1156-64
Novel resistance genes Streptogramin A, Lincosamides, Pleuromutilins Apramycin dfrk vga(c) erm(t) apm(a) Trimethoprim Macrolides, Lincosamides, Streptogramin B
Novel trimethoprim resistance gene dfrk dfrk has 86.2% nucleotide sequence identity to dfrg Protein DfrK has 87.9% amino acid identity to DfrG 0.05 100 100 DfrS1 S. aureus DfrC Tn4003 S. epidermidis 100 99 DfrK MRSA DfrG S. aureus DfrD S. haemolyticus DfrB MRSA DfrB MRSA Kadlec & Schwarz (2009) Antimicrob Agents Chemother 53: 776-778
repu 3 end tet(l) pre/mob repu 5 end pbc16 0 1 2 3 4 CTTTTTG TTCCATTAAAGGGCGCGATTG CTGAATA CTTTTTG TTCCATTAAAGGGCGCGATTG TTCCATTAACGGGCGCGATTG CTGAATA Bgl repu 3 end tet(l) dfrk pre/mob repu 5 end Bgl tnp tnp pkks2187 IS257 TGCTGAAA TGCTGAAA IS257 0 1 2 3 4 5 6 7 Kadlec & Schwarz (2009) Antimicrob Agents Chemother 53: 776-778
dfrk Trimethoprim as part of a transposon present on structurally different plasmids in MRSA ST398 usually linked to the tetracycline resistance gene tet(l) However, during screening of staphylococci of the BfT-GermVet study, a porcine MSSA ST398 strain was detected, in which dfrk was not located on a plasmid dfrk was not linked to tet(l) cloning of the dfrk gene region from the chromosome and subsequent sequence analysis
GATGTA GATGTA Tn554 0 1 2 3 4 tnpa tnpb tnpc spc erm(a) 5 6 orf GATGTA CAAGTT Tn559 0 1 2 3 4 tnpa tnpb tnpc dfrk tnp 1 2 pkks2187 tnp IS257 0 1 2 3 4 5 6 7 repu 3 end tet(l) dfrk pre/mob repu 5 end IS257 Kadlec & Schwarz (2010) Antimicrob Agents Chemother 54: 3475-3477
Distribution of the dfrk gene among 54 porcine and 25 bovine MRSA ST398 isolates from Germany dfrk (n = 14) in MRSA ST398 from pigs dfrk (n = 12) in MRSA ST398 from dairy cattle (28 porcine and 14 bovine isolates were trimethoprim-resistant) Kadlec et al. (2009) J Antimicrob Chemother 64: 1156-64; Feßler et al. (2010) J Antimicrob Chemother 65: 619-25
Novel resistance gene vga(c) streptogramin A antibiotics: lincosamides: pleuromutilins: virginiamycin M1 lincomycin, pirlimycin, clindamycin tiamulin, valnemulin 100% 90% 80% 70% 60% 50% 40% 30% Vga(A) LC DQ823382 100% Vga(A) NC_011605 99% Vga(A) AF117259 81% Vga(A) v Vga(C) AF186237 CAY33094 63% 39% Vga(B) UB802085 Kadlec & Schwarz (2009) Antimicrob Agents Chemother 53: 3589-3591
pkks825 repulike aadd tet(l) dfrk pre/mob rep pre/mob rep tnpb vga(c) 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 CAACAAA CGGGCCA CGGGCCA TATTGTT CAACAAA CGGGCCA TATTGTT pkks2187 IS257 tnp tnp IS257 0 1 2 3 4 5 6 7 repu 3 end tet(l) dfrk pre/mob repu 5 end Kadlec & Schwarz (2009) Antimicrob Agents Chemother 53: 3589-3591
Plasmid pkks825 repulike aadd tet(l) dfrk pre/mob rep pre/mob rep tnpb vga(c) 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 mediates resistance to tetracycline, trimethoprim, kanamycin/neomycin, streptogramin A antibiotics, lincosamides, and pleuromutilins carries three different rep genes for potential replication in different bacterial hosts carries two different pre/mob genes for plasmid mobilization and plasmid recombination well equipped for horizontal gene transfer and maintenance in different hosts Kadlec & Schwarz (2009) Antimicrob Agents Chemother 53: 3589-3591
vga(c) on a small plasmid from porcine MRSA ST398 pcps49 pkks825 0 1 2 3 4 5 vga(c) pre/mob rep 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 pre/mob rep vga(c) pre/mob rep repulike aadd tet(l) dfrk tnpb Kadlec et al. (2010) J Antimicrob Chemother 65: 2692-2693
Geographical distribution of the gene vga(c) among 54 porcine and 25 bovine MRSA ST398 isolates from Germany vga(c) (n = 4) in MRSA ST398 from pigs vga(c) (n = 1) in MRSA ST398 from dairy cattle Kadlec et al. (2009) J Antimicrob Chemother 64: 1156-64; Feßler et al. (2010) J Antimicrob Chemother 65: 619-25
MLS B resistance gene erm(t) erm(t) described in Streptococcus pyogenes, Streptococcus pasteurianus, Lactobacillus reuteri, Lactobacillus spp. and Enterococcus faecium commonly located on small plasmids which do NOT replicate in Staphylococcus first described in Staphylococcus in 2010 Kadlec & Schwarz (2010) Antimicrob Agents Chemother 54: 915-918
MLS B resistance gene erm(t) 0 1 2 3 erm(t) rep mob 4 prw35 (S. pyogenes) ISSau10 tnp ISSau10 tnp pkks25 IS257 0 1 2 3 erm(t) dfrk 4 tet(l) 5 6 IS257 tnp tnp pkks2187 7 6 5 4 repu 3 end pre/mob 3 dfrk 2 tet(l) 1 0 repu 5 end Kadlec & Schwarz (2010) Antimicrob Agents Chemother 54: 915-918
Macrolide / lincosamide resistance of porcine MRSA ST398 erm(b) 6 1 erm(t) erm(a) 3 12 1 1 erm(c) erm(a) + erm(c) erm(a) + erm(b) bovine MRSA ST398 erm(b) 5 4 erm(t) erm(a) 1 1 erm(a) + erm(c) erm(a) + erm(b) 1 1 erm(c) Kadlec et al. (2009) J Antimicrob Chemother 64: 1156-64; Feßler et al. (2010) J Antimicrob Chemother 65: 619-25
Geographical distribution of the gene erm(t) among 54 porcine and 25 bovine MRSA ST398 isolates from Germany erm(t) (n = 1) in MRSA ST398 from pigs erm(t) (n = 4) in MRSA ST398 from dairy cattle (24 porcine and 13 bovine isolates were ML-resistant) Kadlec et al. (2009) J Antimicrob Chemother 64: 1156-64; Feßler et al. (2010) J Antimicrob Chemother 65: 619-25
Distribution of apramycin MICs Number of isolates 25 21 20 19 15 13 10 8 6 5 4 3 2 1 1 1 0 0.25 0.5 1 2 4 8 16 32 64 MICs of apramycin (mg/l) 54 MRSA ST398 from pigs 25 MRSA ST398 from dairy cattle Feßler et al. (2011) Antimicrob Agents Chemother (in press)
Novel apramycin resistance gene apma E N N N E tnp 0 1 2 3 4 5 6 7 8 9 10 11 erm(b) apma rep para IS257 icac icab -like -like Feßler et al. (2011) Antimicrob Agents Chemother (in press) Apramycin Gentamicin 1 0.25 2 0.25 1 0.25 32 2
Geographical distribution of the gene apm(a) among 54 porcine and 25 bovine MRSA ST398 isolates from Germany apm(a) (n = 4) in MRSA ST398 from pigs apm(a) (n = 2) in MRSA ST398 from dairy cattle Feßler et al. (2011) Antimicrob Agents Chemother (in press)
Conclusions MRSA ST398 can acquire resistance genes from other bacteria plasmids play an important role in these acquisition processes multiresistance plasmids enable the co-selection and persistence of resistance genes even in the absence of a direct selective pressure
Perspective detailed analysis of (multi)resistance plasmids in MRSA ST398 will be performed in the MedVetStaph project MedVetStaph is a BMBFfunded joint project of human and veterinary medicine (http://medvetstaph.net)