List of new names and new combinations previously effectively, but not validly, published

Similar documents
List of new names and new combinations previously effectively, but not validly, published

List of new names and new combinations previously effectively, but not validly, published

List of bacterial type strains available for distribution at CRB-JD

REFERENCE STRAIN CATALOGUE PERTAINING TO ORGANISMS FOR PERFORMANCE TESTING OF CULTURE MEDIA

Antimicrobial Resistance: Do we know everything? Dr. Sid Thakur Assistant Professor Swine Health & Production CVM, NCSU

Aquatic Animal Bacterial Pathogen

Juehuaornis gen. nov.

Genome sequence analyses show that Neisseria oralis is the same species as Neisseria mucosa var. heidelbergensis

REFERENCE MATERIALS CATALOGUE FOR PHYSICAL-CHEMICAL AND MICROBIOLOGICAL LABORATORIES

Enterobacter aerogenes

Evaluation of antimicrobial activity of Salmonella species from various antibiotic

Drug resistance analysis of bacterial strains isolated from burn patients

Phenotypic Plasticity in Embryonic Development of Reptiles: Recent Research and Research Opportunities in China

Increasing trends in mcr-1 prevalence among ESBL-producing E. coli in French calves

Application of sewage in pisciculture in order to augment fish production has been an

ESCHERICHIA COLI RESISTANCE AND GUT MICROBIOTA PROFILE IN PIGS RAISED WITH DIFFERENT ANTIMICROBIAL ADMINISTRATION IN FEED

in wastewater treatment plant

I. БАКТЕРИИ. Acetobacter aceti (Pasteur 1864) Beijerinck 1898

Myxosporeans and myxosporidiosis of common carp and gibel carp in China

Seroprevalence and risk factors of Chlamydia abortus infection in free-ranging white yaks in China

Testimony of the Natural Resources Defense Council on Senate Bill 785

Animal Chlamydioses and the Zoonotic Implications

Research on pathogenic bacteria and antibiotic resistance of Enterobacteriaceae in hospitalized elderly patients.

Understanding and prevention of transmission of antibiotic resistance between bacterial populations and One Health reservoirs

Course: Microbiology in Health and Disease Office Hours: Before or after Class or by appointment

Course: Microbiology in Health and Disease

Classification of Bacteria

Pathogens and antibiotic resistance of children with community-acquired pneumonia.

Antimicrobial Susceptibility of Clinically Relevant Gram-Positive Anaerobic Cocci Collected over a Three-Year Period in the Netherlands

Occurrence, molecular characterization and predominant genotypes of Enterocytozoon bieneusi in dairy cattle in Henan and Ningxia, China

Specificity (target gene) Primer name Sequence Product length[bp] GGATTAGATACCCTGGTAGTC TACCTTGTTACGACTT

The role of the environment in the selection and spread of antimicrobial resistance

Aerobic Bacterial Profile and Antimicrobial Susceptibility Pattern of Pus Isolates in a Tertiary Care Hospital in Hadoti Region

ANTIBIOTIC SENSITIVITY PATTERN OF YERSINIA ENTEROCOLITICA ISOLATED FROM MILK AND DAIRY PRODUCTS*

Species: Panthera pardus Genus: Panthera Family: Felidae Order: Carnivora Class: Mammalia Phylum: Chordata

Parasites and their vectors

Ozone Inactivation Kinetics of Multiple Antibiotic Resistant Strains of Bacteria in Water.

Co-transfer of bla NDM-5 and mcr-1 by an IncX3 X4 hybrid plasmid in Escherichia coli 4

Key words: Campylobacter, diarrhea, MIC, drug resistance, erythromycin

Supplementary Information

BIOL 2900 D 4.00 Microbiology in Health/Disease

Session Fur & Wool. Qian Q.X., Ma J.X., Zhang G.Z., Xie C.S., Ren L., Qian B.Q. BREEDING AND APPLICATION OF ZHEXI ANGORA RABBITS.

Epidemic and Information Research and Development Monitoring and Detection Education Training International Cooperation

Mine Spills and Antibiotic Resistance: What is the Connection?

Myxosporeans and myxosporidiosis of allogynogenetic gibel carp (Carassius auratus gibelio Bloch) in China

Int.J.Curr.Microbiol.App.Sci (2017) 6(3):

Enzootic abortion in sheep and its economic consequences

Freshwater turtle trade in Hainan and suggestions for effective management

Classification. Chapter 17. Classification. Classification. Classification

RETROSPECTIVE STUDY OF GRAM NEGATIVE BACILLI ISOLATES AMONG DIFFERENT CLINICAL SAMPLES FROM A DIAGNOSTIC CENTER OF KANPUR

A Study on Bacterial Flora on the Finger printing Surface of the Biometric Devices at a Tertiary Care Hospital

The Disinfecting Effect of Electrolyzed Water Produced by GEN-X-3. Laboratory of Diagnostic Medicine, College of Medicine, Soonchunhyang University

Aerobic bacterial infections in a burns unit of Sassoon General Hospital, Pune

DRUG-RESISTANT ACINETOBACTER BAUMANNII A GROWING SUPERBUG POPULATION. Cara Wilder Ph.D. Technical Writer March 13 th 2014

Antimicrobial Resistance Monitoring Program in Food-Producing Animals in Japan

Martin Chénier, Ph.D. Microbiology. Antibiotics in Animal Production: Resistance and Alternative Solutions

Summary 1. INLAND WATER STREPTOCOCCOSIS Synopsis

Short Communication. Received 8 May 2017; received in revised form 23 May 2017; accepted 25 May 2017

Supplementary Information. Chlamydia gallinacea is the endemic chlamydial species in chicken (Gallus gallus) Chengming Wang 1 **

Epidemiological Characteristics and Drug Resistance Analysis of Multidrug-Resistant Acinetobacter baumannii in a China Hospital at a Certain Time

Peng GUO 1, 2*, Qin LIU 1, 2, Jiatang LI 3, Guanghui ZHONG 2, Yueying CHEN 3 and Yuezhao WANG Introduction. 2. Material and Methods

Accurate identification and epidemiological characterization of Burkholderia cepacia complex: an update

JAC Bactericidal index: a new way to assess quinolone bactericidal activity in vitro

Feeding Original XPC TM can help reduce Campylobacter in broilers and turkeys

Antimicrobial Resistance (AMR) in Aquaculture

OIE Collaborating Centres Reports Activities

Effects of different doses of dexmedetomidine on inflammatory factors and T lymphocyte subsets in elderly patients undergoing laparoscopic surgery

Short information about the ZOBA. Participating on proficiency tests. Monitoring programme

GROUP 4: ANTIMICROBIAL SUSCEPTIBILITY TESTING FOR SELECETED SPECIES

Phages. The Tbilisi phage (Vershilova and

Design of antimicrobial susceptibility testing programmes relevant to aquaculture and aquacultural products

Ch. 17: Classification

QUICK REFERENCE. Pseudomonas aeruginosa. (Pseudomonas sp. Xantomonas maltophilia, Acinetobacter sp. & Flavomonas sp.)

Aberdeen Hospital. Antibiotic Susceptibility Patterns For Commonly Isolated Organisms For 2015

The Journal of Veterinary Medical Science

Cause Analysis of Asphalt Pavement Rutting on Section N5 in Pakistan

Acinetobacter species-associated infections and their antibiotic susceptibility profiles in Malaysia.

CHINA: Progress report on the aquaculture component of country NAPs on AMR

albendazole praziquantel

Laboratory determination of the susceptibility to antibiotics of bacteria isolated from aquatic animals Peter Smith

VERTEBRATA PALASIATICA

Antibiotic Discovery and Development

DESCRIPTIONS OF THREE NEW SPECIES OF PETALOCEPHALA STÅL, 1853 FROM CHINA (HEMIPTERA: CICADELLIDAE: LEDRINAE) Yu-Jian Li* and Zi-Zhong Li**

Received 4 April 2003/Returned for modification 23 May 2003/Accepted 11 June 2003

Scientific Program. 08:30 Phylogenomic transduction networks reveal genetic barriers for phagemediated lateral gene transfer Tal Dagan, Germany

Isolation of antibiotic producing Actinomycetes from soil of Kathmandu valley and assessment of their antimicrobial activities

Reproductive ecology of Sichuan digging frogs (Microhylidae: Kaloula rugifera)

OIE Reference Laboratory Reports Activities

S PRINGER PROTOCOLS HANDBOOKS

Prevalence of Metallo-Beta-Lactamase Producing Pseudomonas aeruginosa and its antibiogram in a tertiary care centre

No limbs Eastern glass lizard. Monitor lizard. Iguanas. ANCESTRAL LIZARD (with limbs) Snakes. No limbs. Geckos Pearson Education, Inc.

International Research Journal of Biological Sciences ISSN Vol. 4(1), 16-24, January (2015)

COURSE SYLLABUS. (Clinical Bacteriology-1

I yellow, a great assortment of shades of red and yellow being known. The

There are two international organisations that set up guidelines and interpretive breakpoints for bacteriology and susceptibility

Global comparisons of beta diversity among mammals, birds, reptiles, and amphibians across spatial scales and taxonomic ranks

Karyological Studies on Six Anuran Species from Yunnan Province, China

European Committee on Antimicrobial Susceptibility Testing

Whit I e y G. P The fishes of Michaelmas Cay, North Queensland. Ree. Austrar. Mus., v \V hit I e y G. P Studies in ichthyology no

Quality assurance of antimicrobial susceptibility testing

Transcription:

International Journal of Systematic and Evolutionary Microbiology (2015), 65, 2017 2025 DOI 10.1099/ijs.0.000317 Validation List no. 164 Correspondence Aharon Oren aharon.oren@mail.huji.ac.il George M. Garrity garrity@msu.edu List of new names and new combinations previously effectively, but not validly, published Aharon Oren 1 and George M. Garrity 2 1 The Institute of Life Sciences, The Hebrew University of Jerusalem, The Edmond J. Safra Campus, Givat Ram, 91904 Jerusalem, Israel 2 Department of Microbiology & Molecular Genetics, Biomedical Physical Sciences, Michigan State University, East Lansing, MI 48824-4320, USA The purpose of this announcement is to effect the valid publication of the following effectively published new names and new combinations under the procedure described in the Bacteriological Code (1990 Revision). Authors and other individuals wishing to have new names and/or combinations included in future lists should send three copies of the pertinent reprint or photocopies thereof, or an electronic copy of the published paper to the IJSEM Editorial Office for confirmation that all of the other requirements for valid publication have been met. It is also a requirement of IJSEM and the ICSP that authors of new species, new subspecies and new combinations provide evidence that types are deposited in two recognized culture collections in two different countries. It should be noted that the date of valid publication of these new names and combinations is the date of publication of this list, not the date of the original publication of the names and combinations. The authors of the new names and combinations are as given below. Inclusion of a name on these lists validates the publication of the name and thereby makes it available in the nomenclature of prokaryotes. The inclusion of a name on this list is not to be construed as taxonomic acceptance of the taxon to which the name is applied. Indeed, some of these names may, in time, be shown to be synonyms, or the organisms may be transferred to another genus, thus necessitating the creation of a new combination. Actibacterium atlanticum Li et al. 2014, 329 sp. nov. 22II-S11-z10 (5LMG 26 24 271585MCCC 1A09298) Actinopolysporales Goodfellow and Trujillo ord. nov. Actinopolyspora 6 12 2012, 162d Aquimarina penaei Li et al. 2014, 1227 sp. nov. P3-1 (5LMG 279435MCCC 27 25 1A09871) Arcobacter aquimarinus Levican et al. 2015, sp. nov. W63 (5CECT 84425LMG 27923) 2 23 33 Arcobacter ebronensis Levican et al. 2015, 31 sp. nov. F128-2 (5CECT 84415LMG 2 23 27922) Bifidobacterium commune Praet et al. 2015, sp. nov. LMG 28292 (5DSM 28792) 28 35 1311 Bosea vaviloviae Safronova et al. 2015, 917 sp. nov. Vaf-18 (5LMG 283675RCAM 25 40 02129) Caldisalinibacter Ben Hania et al. 2015, 353 gen. nov. Caldisalinibacter kiritimatiensis 35 2 Caldisalinibacter kiritimatiensis Ben Hania sp. nov. L21-TH-D2 (5DSM 268265JCM 35 2 et al. 2015, 353 18664) Catenulisporales Donadio et al. 2012, 225" ord. nov. Catenulispora 6 4 Cellvibrionaceae Spring et al. 2015, 13# ** fam. nov. Cellvibrio 40 46 Cellvibrionales Spring et al. 2015, 13# ord. nov. Cellvibrio 40 46 Chlamydia abortus (Everett et al. 1999) Sachse et al. 2015, 102 Chlamydophila abortus Everett et al. 1999) B577 (5ATCC VR-6565DSM 27654) 23 39 000317 G 2015 IUMS Printed in Great Britain 2017

Chlamydia avium Sachse et al. 2014, 86 sp. nov. 10DC88 (5CSUR P35085DSM 24 38 27005) Chlamydia felis (Everett et al. 1999) Sachse FP Baker (5ATCC VR-1205DSM 23 39 et al. 2015, 102 Chlamydophila felis Everett et al. 1999) 26967) Chlamydia gallinacea Sachse et al. 2014, 87 sp. nov. 08-1274/3 (5CSUR P35095DSM 27451) 24 38 Chromobacterium amazonense Menezes sp. nov. CBMAI 310 (5DSM 26508) 16 31 et al. 2015, 1062 Chryseobacterium profundimaris Xu et al. sp. nov. DY46 (5CGMCC 1.126635JCM 19 51 2015, 986 19801) Convivina Praet et al. 2015, 1346 gen. nov. Convivina intestini 29 36 Convivina intestini Praet et al. 2015, 1346 sp. nov. LMG 28291 (5DSM 28795)DD 29 36 Corynebacteriales Goodfellow and Jones ord. nov. Corynebacterium 6 11 2012, 235dd Edwardsiella anguillarum Shao et al. 2015, sp. nov. ET080813 (5CCUG 642155DSM 36 42 45 272025MCCC 1K00238) Emcibacter Liu et al. 2015, 899 gen. nov. Emcibacter nanhaiensis 30 27 Emcibacter nanhaiensis Liu et al. 2015, 899 sp. nov. HTCJW17 (5CGMCC 30 27 1.124715LMG 27419)"" Enterobacillus Patil et al. 2015, 1214 gen. nov. Enterobacillus tribolii## 38 33 Enterobacillus tribolii Patil et al. 2015, 1215 sp. nov. IG-V01 (5KCTC 421595MCC 38 33 2532) Flavobacterium seoulense Shin et al. 2014, 6# sp. nov. EM1321 (5JCM 301455KACC 42 43 18114) Glycomycetales Labeda 2012, 546DDD ord. nov. Glycomyces 6 19 Halieaceae Spring et al. 2015, 13# ddd fam. nov. Haliea 40 46 Halodurantibacterium Lv et al. 2015, 147 gen. nov. Halodurantibacterium flavum 7 30 Halodurantibacterium flavum Lv et al. 2015, sp. nov. DQW12E6-69-1 (5CGMCC 7 30 147 1.127565LMG 27742) Idiomarina atlantica Du et al. 2015, 399 sp. nov. G5_TVMV8_7 (5KCTC 31 5 421415MCCC 1A10513) Jiangellales Tang et al. 2012, 555 ord. nov. Jiangella 6 48 Keratinibaculum Huang et al. 2013, 61 gen. nov. Keratinibaculum 20 16 paraultunense""" Keratinibaculum paraultunense Huang et al. sp. nov. KD-1 (5DSM 267525JCM 20 16 2013, 61 18769) Kineosporiales Kämpfer 2012, 561### ord. nov. Kineosporia 6 17 Kushneria pakistanensis Bangash et al. 2015, sp. nov. NCCP-934 (5LMG 285255KCTC 14 1 997**** 42082)DDDD Lactobacillus bombicola Praet et al. 2015, sp. nov. LMG 28288 (5DSM 28793)dddd 29 36 1345 Marinobacter shengliensis Luo et al. 2015, sp. nov. SL013A34A2 (5CGMCC 22 29 1090 1.127585LMG 27740) Methyloglobulus Deutzmann et al. 2014, 168 gen. nov. Methyloglobulus morosus 1 3 Methyloglobulus morosus Deutzmann et al. sp. nov. KoM1 (5DSM 229805JCM 1 3 2014, 168 18850) Microbulbiferaceae Spring et al. 2015, 14# fam. nov. Microbulbifer 40 46 Micromonosporales Genilloud 2012, 1035 ord. nov. Micromonospora 6 8 Negadavirga Hu et al. 2015, 670"""" gen. nov. Negadavirga shengliensis#### 41 15 Negadavirga shengliensis Hu et al. 2015, sp. nov. SLG210-21 (5CGMCC 41 15 671#### 1.127685LMG 27737)***** Nocardia casuarinae Ghodhbane-Gtari et al. sp. nov. BMG51109a (5CECT 84695DSM 44 9 2014, 1104DDDDD 45978) Oricola Hameed et al. 2015, 767 gen. nov. Oricola cellulosilytica 3 14 2018 International Journal of Systematic and Evolutionary Microbiology 65

Oricola cellulosilytica Hameed et al. 2015, sp. nov. CC-AMH-0 (5BCRC 3 14 768 806945JCM 19534) Paraburkholderia Sawana et al. 2014, 19# gen. nov. Paraburkholderia graminis Paraburkholderia andropogonis (Gillis et al. 1995) Sawana et al. 2014, 14# comb. nov. (basonym: Burkholderia andropogonis Gillis et al. 1995) ATCC 23061 (5DSM 9511)ddddd Paraburkholderia bannensis (Aizawa et al. 2011) Sawana et al. 2014, 14# Paraburkholderia bryophila (Vandamme et al. 2007) Sawana et al. 2014, 14# Paraburkholderia caledonica (Coenye et al. 2001) Sawana et al. 2014, 14# Paraburkholderia caribensis (Achouak et al. 1999) Sawana et al. 2014, 14# Paraburkholderia caryophylli (Yabuuchi et al. 1993) Sawana et al. 2014, 14# Paraburkholderia diazotrophica (Sheu et al. 2013) Sawana et al. 2014, 15# Paraburkholderia endofungorum (Partida- Martinez et al. 2007) Sawana et al. 2014, 15# Paraburkholderia ferrariae (Valverde et al. 2006) Sawana et al. 2014, 15# Paraburkholderia fungorum (Coenye et al. 2001) Sawana et al. 2014, 15# Paraburkholderia ginsengisoli (Kim et al. 2006) Sawana et al. 2014, 15# Paraburkholderia glathei (Vandamme et al. 1997) Sawana et al. 2014, 15# Paraburkholderia graminis (Viallard et al. 1998) Sawana et al. 2014, 15# Paraburkholderia grimmiae (Tian et al. 2013) Sawana et al. 2014, 16# Paraburkholderia hospita (Goris et al. 2003) Sawana et al. 2014, 16# Paraburkholderia kururiensis (Zhang et al. 2000) Sawana et al. 2014, 16# Paraburkholderia megapolitana (Vandamme et al. 2007) Sawana et al. 2014, 16# Burkholderia bannensis Aizawa et al. 2011) Burkholderia bryophila Vandamme et al. 2007) Burkholderia caledonica Coenye et al. 2001) Burkholderia caribensis Achouak et al. 1999) Burkholderia caryophylli Yabuuchi et al. 1993) Burkholderia diazotrophica Sheu et al. 2013) Burkholderia endofungorum Partida-Martinez et al. 2007) Burkholderia ferrariae Valverde et al. 2006) Burkholderia fungorum Coenye et al. 2001) Burkholderia ginsengisoli Kim et al. 2006) Burkholderia glathei Vandamme et al. 1997) Burkholderia graminis Viallard et al. 1998) Burkholderia grimmiae Tian et al. 2013) Burkholderia hospita Goris et al. 2003) Burkholderia kururiensis Zhang et al. 2000) Burkholderia megapolitana Vandamme et al. 2007) E25 (5BCC 369985NBRC 103871) 1S18 (5CCUG 529935LMG 23644) W50D (5ATCC BAA-4625DSM 17062)ddddd MWAP64 (5CCUG 428475DSM 13236)ddddd ATCC 25418 (5DSM 50341)ddddd JPY461 (5KCTC 233085LMG 26031)ddddd HKI 456 (5CIP 1094545DSM 19003) FeGl01 (5DSM 182515LMG 23612)ddddd Croize P763-2 (5CCUG 319615DSM 17061)ddddd KMY03 (5CCUG 545715LMG 24044)ddddd ATCC 29195 (5DSM 500145LMG 14190)ddddd C4D1M (5CCUG 442315DSM 17151)ddddd R27 (5DSM 251605LMG 27580)ddddd LMG 20598 (5CCUG 436585DSM 17164) KP23 (5CCUG 436635DSM 13646)ddddd A3 (5CCUG 530065LMG 23650) http://ijs.sgmjournals.org 2019

Paraburkholderia mimosarum (Chen et al. 2006) Sawana et al. 2014, 16# Paraburkholderia nodosa (Chen et al. 2007) Sawana et al. 2014, 16# Paraburkholderia oxyphila (Otsuka et al. 2011) Sawana et al. 2014, 16# Paraburkholderia phenazinium (Viallard et al. 1998) Sawana et al. 2014, 16# Paraburkholderia phenoliruptrix (Coeyne et al. 2005) Sawana et al. 2014, 17# Paraburkholderia phymatum (Vandamme et al. 2003) Sawana et al. 2014, 17# Paraburkholderia phytofirmans (Sessitsch et al. 2005) Sawana et al. 2014, 17# Paraburkholderia rhizoxinica (Partida- Martinez et al. 2007) Sawana et al. 2014, 17# Paraburkholderia sabiae (Chen et al. 2008) Sawana et al. 2014, 17# Paraburkholderia sacchari (Bräner et al. 2001) Sawana et al. 2014, 17# Paraburkholderia sartisoli (Vanlaere et al. 2008) Sawana et al. 2014, 17# Paraburkholderia silvatlantica (Perin et al. 2006) Sawana et al. 2014, 17# Paraburkholderia soli (Yoo et al. 2007) Sawana et al. 2014, 17# Paraburkholderia sordidicola (Lim et al. 2003) Sawana et al. 2014, 17 # Paraburkholderia symbiotica (Sheu et al. 2012) Sawana et al. 2014, 18# Paraburkholderia terrae (Yang et al. 2006) Sawana et al. 2014, 18# Paraburkholderia terricola (Goris et al. 2003) Sawana et al. 2014, 18# Paraburkholderia tropica (Reis et al. 2004) Sawana et al. 2014, 18# Paraburkholderia tuberum (Vandamme et al. 2003) Sawana et al. 2014, 18# Burkholderia mimosarum Chen et al. 2006) Burkholderia nodosa Chen et al. 2007) Burkholderia oxyphila Otsuka et al. 2011) Burkholderia phenazinium Viallard et al. 1998) Burkholderia phenoliruptrix Coeyne et al. 2005) Burkholderia phymatum Vandamme et al. 2003) Burkholderia phytofirmans Sessitsch et al. 2005) Burkholderia rhizoxinica Partida- Martinez et al. 2007) Burkholderia sabiae Chen et al. 2008) Burkholderia sacchari Brämer et al. 2001) Burkholderia sartisoli Vanlaere et al. 2008) Burkholderia silvatlantica Perin et al. 2006) Burkholderia soli Yoo et al. 2007) Burkholderia sordidicola Lim et al. 2003) Burkholderia symbiotica Sheu et al. 2012) Burkholderia terrae Yang et al. 2006) Burkholderia terricola Goris et al. 2003) Burkholderia tropica Reis et al. 2004) Burkholderia tuberum Vandamme et al. 2003) PAS44 (5CCUG 542965LMG 23256)ddddd Br3437 (5BCRC 175755LMG 23741) OX-01 (5LMG 263765NBRC 105797)ddddd ATCC 33666 (5BCRC 173985CCUG 46044)ddddd AC1100 (5DSM 177735LMG 22037)ddddd STM815 (5CCUG 471795DSM 17167)ddddd PsJN (5CCUG 490605DSM 17436)ddddd HKI 454 (5CIP 1094535DSM 19002) Br3407 (5BCRC 175875LMG 24235) CCT 6771 (5CCUG 460435DSM 17165)ddddd RP 007 (5CCUG 536045LMG 24000)ddddd SRMrh-20 (5CCUG 542975LMG 23149)ddddd GP25-8 (5DSM 182355LMG 24076)ddddd CCUG 49583 (5DSM 17212)ddddd JPY-345 (5BCRC 802585KCTC 23309)ddddd KMY02 (5DSM 178045NBRC 100964)ddddd CCUG 44527 (5DSM 17221)ddddd Ppe8 (5DSM 153595LMG 22274)ddddd STM678 (5CCUG 471785DSM 18489)ddddd 2020 International Journal of Systematic and Evolutionary Microbiology 65

Paraburkholderia unamae (Caballero- Mellado et al. 2004) Sawana et al. 2014, 18# Paraburkholderia xenovorans (Goris et al. 2004) Sawana et al. 2014, 18# Burkholderia unamae Caballero- Mellado et al. 2004) Burkholderia xenovorans Goris et al. 2004) MTI-641 (5DSM 171975LMG 22722) LB400 (5CCUG 469595DSM 17367)ddddd Paradevosia Geng et al. 2015, 115 gen. nov. Paradevosia shaoguanensis 5 7 Paradevosia shaoguanensis Geng et al. 2015, sp. nov. J5-3 (5CGMCC 1.124305LMG 5 7 115 27409) Pedobacter lotistagni Singh et al. 2015, 956 sp. nov. THG-DN6.8 (5JCM 21 45 303545KCTC 42229) Porphyromonas pogonae Kawamura et al. sp. nov. PAGU 1787 (5MI 10-15 18 2015, 108""""" 12885ATCC BAA-26435JCM 19732) Porticoccaceae Spring et al. 2015, 14# ##### fam. nov. Porticoccus 40 46 Propionibacteriales Patrick and McDowell ord. nov. Propionibacterium 6 34 2012, 1137 Pseudohongiella acticola Park et al. 2014, sp. nov. GBSW-5 (5CECT 86275KCTC 43 32 814****** 42131) Pseudomonas asuensis Reddy and Garcia- sp. nov. CP 155-2 (5LMG 286875KCTC 11 37 Pichel 2015, 11 32484)DDDDDD Pseudomonas donghuensis Gao et al. 2015, sp. nov. HYS (5CCTCC AB 13 6 91dddddd 20121415NRRL B-59108) Pseudonocardiales Labeda and Goodfellow ord. nov. Pseudonocardia 6 20 2012, 1301 Pseudooceanicola Lai et al. 2015, 1070 gen. nov. Pseudooceanicola atlanticus 32 22 Pseudooceanicola antarcticus (Huo et al. Oceanicola Ar-45 (5CGMCC 1.126625LMG 32 22 2014) Lai et al. 2015, 1073 antarcticus Huo et al. 2014) 27868) Pseudooceanicola atlanticus Lai et al. 2015, 1072 sp. nov. 22II-S11g (5KCTC 420045LMG 274245MCCC 1A09160) 32 22 Pseudooceanicola batsensis (Cho and Giovannoni 2004) Lai et al. 2015, 1073 Oceanicola batsensis Cho and Giovannoni 2004) Oceanicola marinus Lin et al. 2007) Oceanicola nanhaiensis Gu et al. 2007) Oceanicola nitratireducens Zheng et al. 2010) HTCC2597 (5ATCC BAA- 8635DSM 159845KCTC 12145) 32 22 Pseudooceanicola marinus (Lin et al. 2007) Lai et al. 2015, 1073 AZO-C (5BCRC 175915LMG 23705) 32 22 Pseudooceanicola nanhaiensis (Gu et al. SS011B1-20 (5CGMCC 1.6293) 32 22 2007) Lai et al. 2015, 1073 Pseudooceanicola nitratireducens (Zheng JLT1210 (5CGMCC 32 22 et al. 2010) Lai et al. 2015, 1073 1.72925LMG 24663) Rhizobium capsici Lin et al. 2015, 780 sp. nov. CC-SKC2 (5BCRC 806995JCM 4 26 19535) Rhodopirellula caenicola Yoon et al. 2015, sp. nov. YM26-125 (5KCTC 10 53 2# 329955NBRC 110016) Salisediminibacterium haloalkalitolerans sp. nov. 10nlg (5CGMCC 1.128185KCTC 45 47 Sultanpuram et al. 2015, 559 33414) Salisediminibacterium locisalis (Márquez comb. nov. (basonym Bacillus CG1 (5CCM 73705CECT 45 47 et al. 2011) Sultanpuram et al. 2015, 559 locisalis Márquez et al. 2011) 71525CGMCC 1.62865DSM 18085) Seohaeicola nanhaiensis Xie et al. 2014, 806 sp. nov. SS011A0-7#2-2 (5CGMCC 8 50 1.127595LMG 27733) Sphingobium endophyticum corrig. Zhu sp. nov. GZGR-4 (5CCTCC AB 18 54 et al. 2015, 1006 20133055KCTC 32447) Spirochaeta lutea Shivani et al. 2015, 113 sp. nov. JC230 (5DSM 290745KCTC 12 44 15387) Spongiibacteraceae Spring et al. 2015, 14# fam. nov. Spongiibacter 40 46 """""" http://ijs.sgmjournals.org 2021

Streptosporangiales Goodfellow 2012, ord. nov. Streptosporangium 6 10 1805###### Thioclava atlantica Lai et al. 2014, 923 sp. nov. 13D2W-2 (5LMG 271455MCCC 33 21 1A02612) Thioclava indica Liu et al. 2015, 302 sp. nov. DT23-4 (5KCTC 335335LMG 34 28 276985MCCC 1A00513) Tropicihabitans Hamada et al. 2015, 1302 gen. nov. Tropicihabitans flavus 39 13 Tropicihabitans flavus Hamada et al. 2015, sp. nov. PS-14-16 (5InaCC A 5165NBRC 39 13 1304 110109) Weissella bombi Praet et al. 2015, 1346 sp. nov. LMG 28290 (5DSM 29 36 28794)******* Wenyingzhuangia heitensis Yoon and Kasai sp. nov. H-MN17 (5KCTC 422455NBRC 9 52 2015, 658 110601) Xanthomonas maliensis Triplett et al. 2015, 879DDDDDDD sp. nov. M97 (5CFBP 79425LMG 27592) 37 49 For references to Validation Lists 1 71, see Int J Syst Bacteriol 49 (1999) 1325. Lists 72 163 were published in Int J Syst Evol Microbiol 50 (2000) 3, 423, 949, 1415, 1699, 1953; and 51 (2001) 1, 263, 793, 1229, 1619, 1945; and 52 (2002) 3, 685, 1075, 1437, 1915; and 53 (2003) 1, 373, 627, 935, 1219, 1701; and 54 (2004) 1, 307, 631, 1005, 1425, 1909; and 55 (2005) 1, 547, 983, 1395, 1743, 2235; and 56 (2006) 1, 499, 925, 1459, 2025, 2507; and 57 (2007) 1, 433, 893, 1371, 1933, 2449; and 58 (2008) 1, 529, 1057, 1511, 1993, 2471; and 59 (2009) 1, 451, 923, 1555, 2129, 2647; and 60 (2010) 1, 469, 1009, 1477, 1985, 2509; and 61 (2011) 1, 475,1011, 1499, 2025, 2563; and 62 (2012) 1, 473, 1017, 1443, 2045, 2549; and 63 (2013) 1, 797, 1577, 2365, 3131, 3931, and 64 (2014) 1, 693, 1455, 2184, 3603; and 65 (2015), 1, 741, 1105. *Abbreviations of culture collections cited in this list can be found at http://ijs.sgmjournals.org/site/misc/collections.xhtml. DPriority number assigned according to the date the documentation and request for validation are received. dthe preferred syllabification is Ac.ti.no.po.ly.spo.ra9les. The documents received as proof of deposition of the type strain in the DSMZ and the LMG culture collections mention strain number H23-83. This number does not feature in the article in which the species is described. The preferred syllabification is va.vi.lo9vi.ae. "The preferred syllabification is Ca.te.nu.li.spo.ra9les. #The online open-access journal in which the name was effectively published does not have continuous page numbers for each volume. **The preferred syllabification is Cell.vi.bri.o.na.ce9ae. DDThe documents received as proof of deposition of the type strain in the DSMZ and the LMG culture collections mention strain number H79-80. This number does not feature in the article in which the species is described. ddthe preferred syllabification is Co.ry.ne.bac.te.ri.a9les. The etymology must be adjusted as follows: L. fem. gen. pl. anguillarum of eels. The effective publication states that the type strain was also deposited as CCTC AB2013118, but no documentation was supplied. ""The effective publication states that the type strain was also deposited as MCCC 1A06723, but no documentation was supplied. ##The effective publication erroneously states that the type species is Enterobacillus tribolii IG-V01. ***The preferred syllabification is Fran.ki.a9les. DDDThe preferred syllabification is Gly.co.my.ce.ta9les. dddthe preferred syllabification is Ha.li.e.a.ce9ae. The preferred syllabification is at.lan9ti.ca. (L. fem. adj....). The preferred syllabification is Ji.ang.el.la9les. """The type species is Keratinibaculum paraultunense and not K. parault-unense as given in the effective publication. ###The preferred syllabification is Ki.ne.o.spo.ra9les. ****The etymology must state N.L. masc. adj. instead of N.L. fem. adj. DDDDThe effective publication states that the type strain was also deposited as JCM 18802, but no documentation was supplied. ddddthe documents received as proof of deposition of the type strain in the DSMZ and the LMG culture collections mention strain number H70-3. This number does not feature in the article in which the species is described. The preferred syllabification is Mi.cro.bul.bi.fe.ra.ce9ae. The preferred syllabification is Mi.cro.mo.no.spo.ra9les. """"The syllabification and etymology must be corrected as follows: Ne.ga.da.vir9ga. L. fem. n. virga a rod; N.L. fem. n. Negadavirga arbitrary name for a rod negative for oxidase activity. ####The erratum has Shengliensis instead of shengliensis [Hu et al., Antonie van Leeuwenhoek 107 (2015), 1367]. *****The incorrect LMG culture collection accession number given in the original publication was corrected in an erratum [Hu et al., Antonie van Leeuwenhoek 107 (2015), 1367]. 2022 International Journal of Systematic and Evolutionary Microbiology 65

DDDDDThe etymology must state N.L. gen. n. instead of N.L. gen. N. dddddthe effective publication states that the type strains of the following species of the genus Paraburkholderia were deposited in additional culture collections, but no documentation was supplied: P. andropogonis: CCUG 32772, CFBP 2421, CIP 105771, ICMP 2807, JCM 10487, LMG 2129, NCPPB 934, NRRL B-14296; P. caledonica: CCUG 42236, CIP 107098, JCM 21561, LMG 19076, NBRC 102488; P. caribensis: CIP 106784, LMG 18531; P. caryophylli: CCUG 20834, CFBP 2429, CFBP 3818, CIP 105770, HAMBI 2159, ICMP 512; P. diazotrophica: NKMU-JPY461, BCRC 80259; P. ferrariae: CECT 7171; P. fungorum: CIP 107096, JCM 21562, LMG 16225, NBRC 102489; P. ginsengisoli: KCTC 12389, NBRC 100965; P. glathei: CFBP 4791, CIP 105421, JCM 10563; P. graminis: ATCC 700544, CIP 106649, LMG 18924; P. grimmiae: CGMCC 1.11013; P. kururiensis: ATCC 700977, CIP 106643, JCM 10599, LMG 19447; P. mimosarum: BCRC 17516; P. oxyphila: DSM 22550; P. phenazinium: CCUG 20836, CFBP 4793, CIP 106502, DSM 10684, JCM 10564, LMG 2247, NCIMB 11027; P. phenoliruptrix: CCUG 48558; P. phymatum: LMG 21445; P. phytofirmans: LMG 22146; P. sacchari: CCUG 46032, CIP 107211, IPT 101, LMG 19450; P. sartisoli: ICMP 13529; P. silvatlantica: ATCC BAA-1244; P. soli: KACC 11589; P. sordidicola: JCM 11778, KCTC 12081; P. symbiotica: NKMU-JPY-345, LMG 26032; P. terrae: KCTC 12388; P. terricola: LMG 20594; T. tropica: ATCC BAA-831; P. tuberum: LMG 21444; P. unamae: ATCC BAA-744, CIP 107921; P. xenovorans: LMG 21463, NRRL B-18064. The etymology must twice state N.L. fem. adj. instead of N.L. masc. adj. The etymology must state N.L. fem. adj. instead of masc. n. """""The preferred syllabification is po.go9nae. #####The preferred syllabification is Por.ti.co.coc.ca.ce9ae. ******The etymology must state L. n. acta seaside, shore instead of L. n. acta i seaside, shore. DDDDDDThe effective publication states that the type strain was also deposited as ATCC BAA-1264 and JCM 13501, but no documentation was supplied. ddddddthe preferred syllabification is dong.hu.en9sis. The preferred syllabification is Pseu.do.no.car.di.a9les. The List Editors have corrected endophyticus N.L. masc. adj. to endophyticum N.L. neut. adj. """"""The preferred syllabification is Spon.gi.i.bac.te.ra.ce9ae. ######The preferred syllabification is Strep.to.spo.ran.gi.a9les. *******The documents received as proof of deposition of the type strain in the DSMZ and the LMG culture collections mention strain number H24-37. This number does not feature in the article in which the species is described. DDDDDDDThe preferred syllabification is ma.li.en9sis. References 1. Bangash, A., Ahmed, I., Abbas, S., Kudo, T., Shahzad, A., Fujiwara, T. & Ohkuma, M. (2015). Kushneria pakistanensis sp. nov. a novel moderately halophilic bacterium isolated from rhizosphere of a plant (Saccharum spontaneum) growing in salt mines of the Karak area in Pakistan. Antonie van Leeuwenhoek 107, 991 1000. 2. Ben Hania, W., Joseph, M., Fiebig, A., Bunk, B., Klenk, H.-P., Fardeau, M.-L. & Spring, S. (2015). Calidisalinibacter kiritimatiensis gen. nov., sp. nov., a moderately thermohalophilic thiosulfate-reducing bacterium from a hypersaline microbial mat. Geomicrobiol J 32, 347 354. 3. Deutzmann, J. S., Hoppert, M. & Schink, B. (2014). Characterization and phylogeny of a novel methanotroph, Methyloglobulus morosus gen. nov., spec. nov. Syst Appl Microbiol 37, 165 169. 4. Donadio, S., Cavaletti, L. & Monciardini, P. (2012). Order IV. Catenulisporales ord. nov. In Bergey s Manual of Systematic Bacteriology, p. 225. Edited by M. Goodfellow, P. Kämpfer, H.- J. Busse, M. E. Trujillo, K. Suzuki, W. Ludwig & W. B. Whitman. vol. 5, 2nd edn., New York: Springer. 5. Du, J., Lai, Q., Liu, Y., Du, Y., Liu, X., Sun, F. & Shao, Z. (2015). Idiomarina atlantica sp. nov., a marine bacterium isolated from the deep sea sediment of the North Atlantic Ocean. Antonie van Leeuwenhoek 107, 393 401. 6. Gao, J., Xie, G., Peng, F. & Xie, Z. (2015). Pseudomonas donghuensis sp. nov., exhibiting high-yields of siderophore. Antonie van Leeuwenhoek 107, 83 94. 7. Geng, S., Pan, X.-C., Mei, R., Wang, Y.-N., Sun, J.-Q., Liu, X.-Y., Tang, Y.-Q. & Wu, X.-L. (2015). Paradevosia shaoguanensis gen. nov., sp. nov., isolated from a coking wastewater. Curr Microbiol 70, 110 118. 8. Genilloud, O. (2012). Order XI Micromonosporales ord. nov. In Bergey s Manual of Systematic Bacteriology, p. 1035. Edited by M. Goodfellow, P. Kämpfer, H.-J. Busse, M. E. Trujillo, K. Suzuki, W. Ludwig & W. B. Whitman. vol. 5, 2nd edn. New York: Springer. 9. Ghodhbane-Gtari, F., Nouioui, I., Salem, K., Ktari, A., Montero- Calasanz, M., del, C., Tisa, L. S., Klenk, H.-P. & Gtari, M. (2014). Nocardia casuarinae sp. nov., an actinobacterial endophyte isolated from root nodules of Casuarina glauca. Antonie van Leeuwenhoek 105, 1099 1106. 10. Goodfellow, M. (2012). Order XV. Streptosporangiales ord. nov. In Bergey s Manual of Systematic Bacteriology, p. 1805. Edited by by M. Goodfellow, P. Kämpfer, H.-J. Busse, M. E. Trujillo, K. Suzuki, W. Ludwig & W. B. Whitman. 2nd edn. New York: Springer. 11. Goodfellow, M. & Jones, A. L. (2012). Order V. Corynebacteriales ord. nov. In Bergey s Manual of Systematic Bacteriology, p. 235 243. Edited by M. Goodfellow, P. Kämpfer, H.-J. Busse, M. E. Trujillo, K. Suzuki, W. Ludwig & W. B. Whitman. vol. 5, 2nd edn., New York: Springer. 12. Goodfellow, M. & Trujillo, M. E. (2012). Order II. Actinopolysporales ord. nov. In Bergey s Manual of Systematic Bacteriology, p. 162. Edited by M. Goodfellow, P. Kämpfer, H.- J. Busse, M. E. Trujillo, K. Suzuki, W. Ludwig & W. B. Whitman. vol. 5, 2nd edn., New York: Springer. http://ijs.sgmjournals.org 2023

13. Hamada, M., Shibata, C., Nurkanto, A., Ratnakomala, S., Lisdiyanti, P., Tamura, T. & Suzuki, K. (2015). Tropicihabitans flavus gen. nov., sp. nov., a new member of the family Cellulomonadaceae. Antonie van Leeuwenhoek 107, 1299 1306. 14. Hameed, A., Shahina, M., Lai, W.-A., Lin, S.-Y., Young, L.-S., Liu, Y.-C., Hsu, Y.-H. & Young, C.-C. (2015). Oricola cellulosilytica gen. nov., sp. nov., a cellulose-degrading bacterium of the family Phyllobacteriaceae isolated from surface seashore water, and emended descriptions of Mesorhizobium loti and Phyllobacterium myrsinacearum. Antonie van Leeuwenhoek 107, 759 771. 15. Hu, B., Yang, Q., Cai, M., Tang, Y.-Q., Zhao, G.-F. & Wu, X.-L. (2015). Negadavirga shengliensis gen. nov., sp. nov., a novel member of the family Cyclobacteriaceae isolated from oil-contaminated saline soil. Antonie van Leeuwenhoek 107, 663 673. 16. Huang, Y., Sun, Y., Ma, S., Chen, L., Zhang, H. & Deng, Y. (2013). Isolation and characterization of Keratinibaculum paraultunense gen. nov., sp. nov., a novel thermophilic, anaerobic bacterium with keratinolytic activity. FEMS Microbiol Lett 345, 56 63. 17. Kämpfer, P. (2012). Order IX. Kineosporiales ord. nov. In Bergey s Manual of Systematic Bacteriology, p. 561. Edited by M. Goodfellow, P. Kämpfer, H.-J. Busse, M. E. Trujillo, K. Suzuki, W. Ludwig & W. B. Whitman. vol. 5, 2nd edn. New York: Springer. 18. Kawamura, Y., Kuwabara, S., Kania, S. A., Kato, H., Hamagishi, M., Fujiwara, N., Sato, T., Tomida, J., Tanaka, K. & Bemis, D. A. (2015). Porphyromonas pogonae sp. nov., an anaerobic but low concentration oxygen adapted coccobacillus isolated from lizards (Pogona vitticeps) or human clinical specimens, and emended description of the genus Porphyromonas Shah and Collins 1988. Syst Appl Microbiol 38, 104 109. 19. Labeda, D. P. (2012). Order VII. Glycomycetales ord. nov. In Bergey s Manual of Systematic Bacteriology, p. 546. Edited by M. Goodfellow, P. Kämpfer, H.-J. Busse, M. E. Trujillo, K. Suzuki, W. Ludwig & W. B. Whitman. vol. 5, 2nd edn., New York: Springer. 20. Labeda, D. P. & Goodfellow, M. (2012). Order XIII. Pseudonocardiales ord. nov. In Bergey s Manual of Systematic Bacteriology, p. 1301. Edited by M. Goodfellow, P. Kämpfer, H.-J. Busse, M. E. Trujillo, K. Suzuki, W. Ludwig & W. B. Whitman. vol. 5, 2nd edn., New York: Springer. 21. Lai, Q., Li, S., Xu, H., Jiang, L., Zhang, R. & Shao, Z. (2014). Thioclava atlantica sp. nov., isolated from deep sea sediment of the Atlantic Ocean. Antonie van Leeuwenhoek 106, 919 925. 22. Lai, Q., Li, G., Liu, X., Du, Y., Sun, F. & Shao, Z. (2015). Pseudooceanicola atlanticus gen. nov. sp. nov., isolated from surface seawater of the Atlantic Ocean and reclassification of Oceanicola batsensis, Oceanicola marinus, Oceanicola nitratireducens, Oceanicola nanhaiensis, Oceanicola antarcticus and Oceanicola flagellatus, as Pseudooceanicola batsensis comb. nov., Pseudooceanicola marinus comb. nov., Pseudooceanicola nitratireducens comb. nov., Pseudooceanicola nanhaiensis comb. nov., Pseudooceanicola antarcticus comb. nov., and Pseudooceanicola flagellatus comb. nov. Antonie van Leeuwenhoek 107, 1065 1074. 23. Levican, A., Rubio-Arcos, S., Martinez-Murcia, A., Collado, L. & Figueras, M. J. (2015). Arcobacter ebronensis sp. nov. and Arcobacter aquimarinus sp. nov., two new species isolated from marine environment. Syst Appl Microbiol 38, 30 35. 24. Li, G., Lai, Q., Sun, F., Du, Y., Liu, X., Li, G., Xie, Y. & Shao, Z. (2014). Actibacterium atlanticum sp. nov., isolated from surface seawater of the Atlantic Ocean. Antonie van Leeuwenhoek 106, 325 330. 25. Li, X., Wang, L., Huang, H., Lai, Q. & Shao, Z. (2014). Aquimarina penaei sp. nov., isolated from intestinal tract contents of Pacific white shrimp, Penaeus vannamei. Antonie van Leeuwenhoek 106, 1223 1229. 26. Lin, S.-Y., Hung, M.-H., Hameed, A., Liu, Y.-C., Hsu, Y.-H., Wen, C.-Z., Arun, A. B., Busse, H.-J., Glaeser, S. P. & other authors (2015). Rhizobium capsici sp. nov., isolated from root tumor of a green bell pepper (Capsicum annuum var. grossum) plant. Antonie van Leeuwenhoek 107, 773 784. 27. Liu, X., Li, G., Lai, Q., Sun, F., Du, Y. & Shao, Z. (2015). Emcibacter nanhaiensis gen. nov. sp. nov., isolated from sediment of the South China Sea. Antonie van Leeuwenhoek 107, 893 900. 28. Liu, Y., Lai, Q., Du, J., Xu, H., Jiang, L. & Shao, Z. (2015). Thioclava indica sp. nov., isolated from surface seawater of the Indian Ocean. Antonie van Leeuwenhoek 107, 297 304. 29. Luo, Y.-J., Xie, B.-S., Lv, X.-L., Cai, M., Wang, Y.-N., Cui, H.-L., Cai, H. & Wu, X.-L. (2015). Marinobacter shengliensis sp. nov., a moderately halophilic bacterium isolated from oil-contaminated saline soil. Antonie van Leeuwenhoek 107, 1085 1094. 30. Lv, X.-L., Xie, B.-S., Cai, M., Tang, Y.-Q., Wang, Y.-N., Cui, H.-L., Liu, X.-Y., Tan, Y. & Wu, X.-L. (2015). Halodurantibacterium flavum gen. nov., sp. nov., a non-phototrophic bacterium isolated from an oil production mixture. Curr Microbiol 70, 141 148. 31. Menezes, C. B. A., Tonin, M. F., Corrêa, D. B. A., Parma, M., de Melo, I. S., Zucchi, T. D., Destéfano, S. A. L. & Fantinatti- Garboggini, F. (2015). Chromobacterium amazonense sp. nov. isolated from water samples from the Rio Negro, Amazon, Brazil. Antonie van Leeuwenhoek 107, 1057 1063. 32. Park, S., Jung, Y.-T., Park, J.-M. & Yoon, J.-H. (2014). Pseudohongiella acticola sp. nov., a novel gammaproteobacterium isolated from seawater, and emended description of the genus Pseudohongiella. Antonie van Leeuwenhoek 106, 809 815. 33. Patil, V. S., Salunkhe, R. C., Patil, R. H., Husseneder, C., Shouche, Y. S. & Venkata Ramana, V. (2015). Enterobacillus tribolii gen. nov., sp. nov., a novel member of the family Enterobacteriaceae, isolated from the gut of a red flour beetle, Tribolium castaneum. Antonie van Leeuwenhoek 107, 1207 1216. 34. Patrick, S. & McDowell, A. (2012). Order XII. Propionibacteriales ord. nov. In Bergey s Manual of Systematic Bacteriology, p. 1137. Edited by M. Goodfellow, P. Kämpfer, H.-J. Busse, M. E. Trujillo, K. Suzuki, W. Ludwig & W. B. Whitman. vol. 5, 2nd edn., New York: Springer. 35. Praet, J., Meeus, I., Cnockaert, M., Aerts, M., Smagghe, G. & Vandamme, P. (2015). Bifidobacterium commune sp. nov. isolated from the bumble bee gut. Antonie van Leeuwenhoek 107, 1307 1313. 36. Praet, J., Meeus, I., Cnockaert, M., Houf, K., Smagghe, G. & Vandamme, P. (2015). Novel lactic acid bacteria isolated from the bumble bee gut: Convivina intestini gen. nov., sp. nov., Lactobacillus bombicola sp. nov., and Weissella bombi sp. nov. Antonie van Leeuwenhoek 107, 1337 1349. 37. Reddy, G. S. & Garcia-Pichel, F. (2015). Description of Pseudomonas asuensis sp. nov. from biological soil crusts in the Colorado plateau, United States of America. J Microbiol 53, 6 13. 2024 International Journal of Systematic and Evolutionary Microbiology 65

38. Sachse, K., Laroucau, K., Riege, K., Wehner, S., Dilcher, M., Creasy, H. H., Weidmann, M., Myers, G., Vorimore, F. & other authors (2014). Evidence for the existence of two new members of the family Chlamydiaceae and proposal of Chlamydia avium sp. nov. and Chlamydia gallinacea sp. nov. Syst Appl Microbiol 37, 79 88. 39. Sachse, K., Bavoil, P. M., Kaltenboeck, B., Stephens, R. S., Kuo, C.-C., Rosselló-Móra, R. & Horn, M. (2015). Emendation of the family Chlamydiaceae: proposal of a single genus, Chlamydia, to include all currently recognized species. Syst Appl Microbiol 38, 99 103. 40. Safronova, V. I., Kuznetsova, I. G., Sazanova, A. L., Kimeklis, A. K., Belimov, A. A., Andronov, E. E., Pinaev, A. G., Chizhevskaya, E. P., Pukhaev, A. R. & other authors (2015). Bosea vaviloviae sp. nov., a new species of slow-growing rhizobia isolated from nodules of the relict species Vavilovia formosa (Stev.) Fed. Antonie van Leeuwenhoek 107, 911 920. 41. Sawana, A., Adeolu, M. & Gupta, R. S. (2014). Molecular signatures and phylogenomic analysis of the genus Burkholderia: proposal for division of this genus into the emended genus Burkholderia containing pathogenic organisms and a new genus Paraburkholderia gen. nov. harboring environmental species. Front Genet 5, 429. 42. Shao, S., Lai, Q., Liu, Q., Wu, H., Xiao, J., Shao, Z., Wang, Q. & Zhang, Y. (2015). Phylogenomics characterization of a highly virulent Edwardsiella strain ET080813 T encoding two distinct T3SS and three T6SS gene clusters: propose a novel species as Edwardsiella anguillarum sp. nov. Syst Appl Microbiol 38, 36 47. 43. Shin, S.-K., Goo, H., Cho, Y.-J., Kwon, S., Yong, D. & Yi, H. (2014). Non-contiguous finished genome sequence and description of the gliding bacterium Flavobacterium seoulense sp. nov. Stand Genomic Sci 9, 34. 44. Shivani, Y., Subhash, Y., Tushar, L., Sasikala, Ch. & Ramana, Ch. V (2015). Spirochaeta lutea sp. nov., isolated from marine habitats and emended description of the genus Spirochaeta. Syst Appl Microbiol 38, 110 114. 45. Singh, H., Du, J., Ngo, H. T. T., Kim, K.-Y. & Yi, T.-H. (2015). Pedobacter lotistagni sp. nov. isolated from lotus pond water. Antonie van Leeuwenhoek 107, 951 959. 46. Spring, S., Scheuner, C., Göker, M. & Klenk, H.-P. (2015). A taxonomic framework for emerging groups of ecologically important marine gammaproteobacteria based on the reconstruction of evolutionary relationships using genome-scale data. Front Microbiol 6, 281. 47. Sultanpuram, V. R., Mothe, T. & Mohammed, F. (2015). Salisediminibacterium haloalkalitolerans sp. nov., isolated from Lonar soda lake, India, and a proposal for reclassification of Bacillus locisalis as Salisediminibacterium locisalis comb. nov., and the emended description of the genus Salisediminibacterium and of the species Salisediminibacterium halotolerans. Arch Microbiol 197, 553 560. 48. Tang, S. K., Zhi, X.-Y. & Li, W.-J. (2012). Order VIII. Jiangellales ord. nov. In Bergey s Manual of Systematic Bacteriology, p. 555. Edited by M. Goodfellow, P. Kämpfer, H.-J. Busse, M. E. Trujillo, K. Suzuki, W. Ludwig & W. B. Whitman. vol. 5, 2nd edn., New York: Springer. 49. Triplett, L. R., Verdier, V., Campillo, T.,., Van Malderghem, C., Cleenwerck, I., Maes, M., Deblais, L., Corral, R., Koita, O. & other authors (2015). Characterization of a novel clade of Xanthomonas isolated from rice leaves in Mali and proposal of Xanthomonas maliensis sp. nov. Antonie van Leeuwenhoek 107, 869 881. 50. Xie, B.-S., Lv, X.-L., Cai, M., Tang, Y.-Q., Wang, Y.-N., Cui, H.-L., Liu, X.-Y., Tan, Y. & Wu, X.-L. (2014). Seohaeicola nanhaiensis sp. nov., a moderately halophilic bacterium isolated from the benthic sediment of South China Sea. Curr Microbiol 69, 802 808. 51. Xu, L., Huo, Y.-Y., Li, Z.-Y., Wang, C.-S., Oren, A. & Xu, X.-W. (2015). Chryseobacterium profundimaris sp. nov., a new member of the family Flavobacteriaceae isolated from deep-sea sediment. Antonie van Leeuwenhoek 107, 979 989. 52. Yoon, J. & Kasai, H. (2015). Wenyingzhuangia heitensis sp. nov., a new species of the family Flavobacteriaceae within the phylum Bacteroidetes isolated from seawater. Antonie van Leeuwenhoek 107, 655 661. 53. Yoon, J., Matsuo, Y., Kasai, H. & Lee, M.-K. (2015). Phylogenetic and taxonomic analyses of Rhodopirellula caenicola sp. nov., a new marine Planctomycetes species isolated from iron sand. J Phylogenetics Evol Biol 3, 1000143. 54. Zhu, L., Xin, K., Chen, C., Li, C., Si, M., Zhao, L., Shi, X., Zhang, L. & Shen, X. (2015). Sphingobium endophyticus sp. nov., isolated from the root of Hylomecon japonica. Antonie van Leeuwenhoek 107, 1001 1008. http://ijs.sgmjournals.org 2025