Begleiders: Prof. dr. J.A. Mol en dr. N.J. Schoemaker

Drs. S.J. Meek September-december 2007 Onderzoeksstage diergeneeskunde Begleiders: Prof. dr. J.A. Mol en dr. N.J. Schoemaker

Contents CONTENTS 1 1. ABSTRACT 3 2. GENERAL INTRODUCTION 4 THE FERRET ADRENAL CORTEX 4 HYPERANDROGENISM / HYPERESTROGENISM 4 HYPERCORTISOLISM 4 THE FERRET WITH HYPERADRENOCORTICISM 5 CLINICAL SYMPTOMS 5 MACROSCOPICAL CHANGES 5 BLOOD TESTS 6 URINE TESTS 6 ARE THESE FERRETS SUFFERING FROM CUSHING S SYNDROME? 6 PREVALENCE 7 THE CAUSE OF THE NEOPLASTIC CHANGES 7 NEUTERING AS A CAUSE 7 ON CELL LEVEL 7 WHY LOOK AT THE LUTEINIZING HORMONE RECEPTOR? 8 EXPRESSION OF LH-R 9 WHAT ABOUT THIS SPLICE VARIANT? 10 3. THE LUTEINIZING HORMONE RECEPTOR 12 MOLECULAR BUILDING OF THE LH-R 12 VARIATIONS AND MUTATIONS IN THE LH-R SEQUENCE ON HUMANS, AND THE PHENOTYPIC CONSEQUENCES 12 SPLICE VARIANTS 12 HYPERACTIVE LH-R IN BOYS 13 A HOT SPOT OF MUTATIONS 13 INACTIVATING LH-R MUTATIONS 14 SINGLE NUCLEOTIDE POLYMORPHISMS 15 MUTATIONS IN THE LH-R ON FERRETS 16 MUTATIONS IN THE LH-R ON OTHER ANIMALS 16 4. AIM OF THIS RESEARCH 18 5. MATERIAL EN METHODS 19 RT-PCR, DNA PURIFICATION AND DNA SEQUENCE ANALYSIS 19 6. RESULTS 21 PCR PRODUCTS ON ELECTROPHORESIS 21 SEQUENCING RESULTS 21 1

7. DISCUSSION 24 A NEW SPLICE VARIANT? 25 8. CONCLUSION 26 WEBSITES AND LITERATURE 27 2

1. Abstract Approximately 0,6% of Dutch ferrets have a chance to get hyperadrenocorticism, with symptoms of symmetrical alopecia, pruritus, vulvar swelling in neutered jills, recurrent sexual behaviour in neutered hobs, and squamous metaplasia of prostatic ductular epithelium in hobs. The diagnose is based on high plasma androgen concentrations and one or two enlarged adrenal glands on ultrasonography. On pathology, these adrenal glands are typed as hyperplasias or tumours. Sometimes these enlarged glands also ACTH-independently produce cortisol. Neutering has a very high correllation with the onset of tumorigenesis, but the real cause is not clear. A hypothesis is that on reaction to the gonadectomy-induced high plasma LH concentration, the non-functional splice variant [LH-R Δ exon 9] in the adrenal glands are down-regulated. Instead, a functional LH-R arises, which activates the cells to produce androgens. The aim of the present study was to search for mutations on the LH-R sequences of ferrets suffering from hyperadrenocorticism. The results are that no mutations have been found on the LH-Rs of 14 hyper-/neoplastic adrenal gland tissues, on the second half of exon 11. on exon 6, a part of exon 7 and a part of exon 11. Between the last part of exon 7 and exon 10, there appears to be a point mutation in most of the tumorous tissues, on base 950 on exon 10, which will not have any phenotypic consequences. One carcinoma possibly expresses a new splice variant ([LH-R Δ exon 7] or [LH-R Δ exon 10]). Further research should be done. 3

2. General introduction The ferret adrenal cortex The adrenal cortex produces 19-carbon steroids, they function as weak steroids or steroid precursors. These steroids are divided in three groups of hormones: glucocorticoids, mineralocorticoids and androgen precursors (fig. 2.1). The ferret adrenal gland produces as a glucocorticoid mainly cortisol. 12 Furthermore, it produces limited amounts of the androgenic steroids dehydroepiandrosterone (DHEA), DHEA sulphate and androstenedione. 9,29 In the mouse, no androgenic steroids are produced in the adrenal gland. 4 Fig. 2.1: Steroidogenesis in the ferret adrenal gland. The solid line surrounds the normal pathway, the dashed line surrounds the pathway in neoplastic cells. Picture copied from the review on hyperadrenocorticism in ferrets by Bielinska et al. (2006). 4 In hyperadrenocorticism, one of the hormones is overproduced. Ferrets can suffer from such an overproduction and can develop clinical symptoms from it. The overproduction of cortisol and androgens will be explained in this writing, because these disorders are or are expected to be related to a syndrome of high incidence in ferrets. Hyperandrogenism / hyperestrogenism An adrenal tumour producing androgens is very rare in humans 6, dogs 41 and cats 7,33. The hormones that are elevated in the plasma are estradiol, progesterone, 17αhydroxyprogesterone, DHEA sulphate and / or androstenedione 41 Estradiol (17βestradiol) is called the female hormone but it is also present in males, it is the major estrogen in humans. It is formed out of testosterone or estrone (fig. 2.1). Progesterone can be converted to 17α-hydroxyprogesterone. Androstenedione is produced by the adrenal cortex, but also by the testes and ovaries. It is metabolically converted to testosterone, estrone and other androgens 23. Hypercortisolism Cortisol is in humans, dogs and cats the hormone most commonly overproduced by the adrenal cortex. 36 Adrenocorticotrophic hormone (ACTH) is formed in the pituitary gland and stimulates the adrenal gland to release cortisol. Most cases of hypercortisolism in cats and dogs are caused by a pituitary microadenoma (respectively 80% 25 and 85% 22 of cases) and are therefore cases of ACTH-dependent hypercortisolism, called Cushing s disease. ACTH-independent 4

hypercortisolism, also called Cushing s syndrome, is caused by a cortisol-producing adrenal tumour, which has a diminished or absent sensitivity to the negative feedback from the low plasma ACTH concentration. The ferret with hyperadrenocorticism Clinical Symptoms Ferrets which suffer from hyperadrenocorticism develop the following symptoms: symmetrical alopecia (fig.2.2 ), pruritus, vulvar swelling in neutered jills, recurrent sexual behaviour in neutered hobs (male ferrets) 17,31,46 and squamous metaplasia of prostatic ductular epithelium in hobs 4. The alopecia first starts at spring and disappears at the end of the breeding season, the next year it starts again at spring but doesn t resolve. 31 8% in a group of 50 ferrets suffering from hyperadrenocorticism, also got polydipsia and polyuria along with the other symptoms. 31 In a retrospective study on 94 ferrets, which were diagnosed with hyperadrenocorticism histologically, common concurrent diseases included splenomegaly (87%), islet-cell tumour (27%), and cardiomyopathy (10%). 46 Fig. 2.2: A ferret with alopecia. Copied from the essay on hyperadrenocorticism in ferrets by Schoemaker (2003). 36 Macroscopical changes Ultrasonography of the adrenals of these ferrets reveals unilateral (ca. 85%) or bilateral (ca. 15%) enlargement of the adrenal glands. 31 The pituitary gland has never been found to be macroscopically changed. 26 In a research, 3 ferrets out of 46, suffering from hyperadrenocorticism, had metastases 36. 5

Blood tests Testing of the patients blood reveals high plasma concentrations of androstenedione, 17α-hydroxyprogesterone, DHEA sulphate, and estradiol. 30 Blood collection is done with or without anaesthesia, but in both situations the animal will be having stress. Stress induces ACTH release, plasma cortisol concentration will rise in response within minutes. Schoemaker found that collecting blood for measuring hormones of the pituitary-adrenocortical axis, is best done under anaesthesia, and thereby medetomidine is preferred to isoflurane, because this has the least effect on these hormones. 36 Urine tests Urinary cortisol/creatinine ratios 13 can be high in the ferret suffering from hyperadrenocorticism. Are these ferrets suffering from Cushing s syndrome? Some findings in ferrets suffering from hyperadrenocorticism are the same in dogs suffering from hypercortisolism. Analogues are for example alopecia and a high urinary cortisol/creatinine ratio, and sometimes the patients also have a thin skin, muscular atrophy, and pot-bellied appearance. 12 In the ferrets with hyperadrenocorticism, the pituitary gland has never been found to be macroscopically changed, but the adrenal gland(s) is (are) enlarged. Some of the ferrets with (an) enlarged adrenal gland(s) and high plasma androgen concentrations, also suffer from ACTH-independent hypercortisolism (Cushing s syndrome): A normal urine cortisol/creatinine ratio rules out hypercortisolism, but a high ratio cannot serve as the only basis of diagnosing Cushing s syndrome, because dogs with a nonadrenal disease or stress can also have this high ratio. 23 In one study, the specificity of testing the urine ratio was only 20%, 23 but when the patient also has clinical symptoms of hypercortisolism, the specificity rises to an acceptable percentage. Schoemaker found that plasma concentrations of ACTH and α-msh of ferrets with hyperadrenocorticism are not abnormally elevated or lowered. 36 But this does not rule out a concurrent ACTH-independent hypercortisolism in these ferrets, since in many dogs with hypercortisolism caused by adrenocortical neoplasia, the plasma ACTH concentration is in the normal range. 23 In ferrets with hyperadrenocorticism which are suspected of concurrent hypercortisolism, a dexamethasone suppression test can be done, in order to differentiate stress-induced and non-adrenal disease-induced ACTH production from ACTH-independent hypercortisolism. In some cases, the high urinary cortisol/creatinine ratio is resistant to suppression by dexamethasone. 40 Bielinska et al. (2006) state that this finding is consistent with ACTH-independent cortisol production by the neoplastic adrenal gland, 4 assuming that dexamethasone also suppresses stress-induced and non-adrenal disease-induced ACTH production. The conclusion is, that at least in some cases, the hyper-/neoplastic adrenal tissue in ferrets can not only produce androgens, but also ACTH-independently produce cortisol. 6

Prevalence Weiss and Scott 46 reported that, referred to their clinic, 20 to 25% of examined ferrets had hyperadrenocorticism, this is in a selected population of ferrets. Schoemaker estimated that in a Dutch ferret population, prevalence was 0.55% (95% CI, 0.2 to 1.1%). There is no gender predisposition. 36 Endocrine tumours are the most common neoplasms reported in ferrets, most of them comprise adrenocortical tumours and pancreatic islet cell tumors. 11 The cause of the neoplastic changes Neutering as a cause Hyperadrenocorticism has been reported only in 7 sexually intact ferrets. 30,31,46 Mainly neutered ferrets suffer from hyperadrenocorticism. This can be explained in the following ways. 1) Most pet ferrets are neutered. Fertile hobs have a strong smell and they can disturb other animals with their hyperactive biting behaviour of sexual nature. Jills (female ferrets) are induced ovulators and will be constantly in heat during spring and summer, until they ovulate through mating. The constantly high plasma oestrogen concentration suppresses bone marrow and causes fatal nonregenerative anemia. Neutering normally solves all of these problems. 2) Since sexual behaviour and vulvar swelling are main symptoms of the disease, owners will not find the signs noteworthy in a fertile ferret and don t visit a veterinarian. 36 The phenomenon of gonadectomy-induced adrenocortical neoplasia also has been observed in mice, rats, guinea pigs, and hamsters. 34 In the Netherlands ferrets are neutered at an age of 0,98 +/- 0,65 years. 36 In the U.S.A., ferrets are commonly neutered at an age of 4-6 weeks. 30 Schoemaker postulated that neutering did play a role in the development of this disease when he found a linear correlation between age at neutering and age at time of diagnosis of hyperadrenocorticism, 36 but in comparison studies with Dutch and U.S.A. numbers, he found that ferrets do not have to be neutered at an early age to develop hyperadrenocorticism. Other factors hypothesized to predispose ferrets to neoplasia include inbreeding at commercial facilities, unnatural photoperiodic stimulation, and diet. 12,28 On cell level The neoplastic cells that accumulate in the ferret adrenal gland with hyperadrenocorticism functionally resemble gonadal steroidogenic cells. 4 But the real origin remains elusive: There is evidence 19 that it might be a gonadal progenitor, that has ectopically nested in the adrenal gland. But it could also be a multipotent progenitor, that can differentiate into either adrenocortical or gonadal-like steroidogenic cells, depending on the hormonal milieu and other environmental factors. 5 Furthermore, the neoplastic cells may have entered the adrenal gland via the bloodstream. 10 The differentiation, growth and survival of the cells of the adrenal gland are postembryonically controlled by hormones such as ACTH, angiotensin-ii, endothelin-1, vasopressin, and insulin-like growth factors, 14,32,45 but sometimes also by luteinizing hormone (LH), inhibins, and activins, factors that are originally aimed for the gonadal cells. 2 7

The factors, thought to influence the tumorigenesis, are the same as the factors that influence reproduction 4 (table 2.1). Talbe 2.1: Signaling molecules and cell cycle regulatory proteins implicated in gonadectomy-induced adrenocortical neoplasia. Table copied from the review on hyperadrenocorticism in ferrets by Bielinska et al. (2006). 4 Why look at the luteinizing hormone receptor? LH activates the luteinizing hormone receptor (LH-R). This has effects on cell growth, differentiation, and steroid production. 24 Normally, in response on gonadotrophic releasing hormone (GnRH), the pituitary gland produces LH and follicle stimulating hormone (FSH). These responses have also been found in neutered ferrets with hyperadrenocorticism. 36 Studies on inbred mouse strains, susceptible to gonadectomy-induced adrenocortical neoplasia, suggest that they can get the neoplasia in the absence of gonadectomy, but only when plasma LH concentrations are chronically kept high. 3 There are several lines of evidence that suggest that like in these mice, in neutered ferrets LH also has an effect on adrenocortical tumorigenesis. 1) Schoemaker administrated GnRH to 12 ferrets with hyperadrenocorticism. In 10 ferrets, plasma concentrations of 17α-hydroxyprogesterone and androstenedione increased, in 11 ferrets, plasma LH concentrations increased, and in 8 ferrets, plasma FSH concentrations increased. 36 2) In some ferrets, the symptoms only appear during the breeding season (March-August). 12 It is known, that prolonged daylight augments LH secretion by the pituitary. 15,27,39 3) After administration of GnRH in the ferret with hyperadrenocorticism, plasma androgen concentrations increase. Leuprolide acetate, a GnRH agonist which eventually suppresses the production of LH and FSH by desensitisation at the pituitary level, temporarily stops the clinical signs of hyperadrenocorticism. 43,44 4) Schoemaker demonstrated that in healthy ferrets, as well as in two ferrets with hyperadrenocorticism, the plasma concentrations of 17α- 8

hydroxyprogesterone, cortisol and androstenedione did not elevate after FSH administration. 36 So in the research after the cause of hyperadrenocorticism in ferrets, it would be interesting to investigate the role of the LH-R. Fig. 2.3: Schematic view of the hormone actions in a fertile (left) and a neutered (right) ferret. is a stimulation,---- is a negative feedback. LH and FSH are produced by the pituitary gland, in order to stimulate the testes / ovaries (gonads) to produce respectively testosterone or estrogen. These androgens have a negative feedback on the production of GnRH. In a neutered ferret, this negative feedback doesn t happen, and LH and FSH will keep on rising. Normally, the adrenal glands have non-functional splice variant LH-Rs, but in some neutered ferrets the (likely to be) full length LH-R is expressed, which is functional. This functional LH-R responds to the high plasma LH level, stimulating the adrenal gland to overproduce adrenal hormones like estradiol. This functional LH-R is likely to be the wildtype, but it could be another splice variant or mutated form of ferret LH-R. Picture copied from the review on hyperadrenocorticism in ferrets by Bielinska et al. (2006). 4 The hypothesis is that in neutered ferrets, hypothalamic GnRH is constantly elevated because of the lack of negative feedback of gonadal hormones (gonadotropins or androgens). 17 GnRH stimulates the pituitary in making LH and FSH. Normal adrenal tissue does not respond to LH nor FSH, but neoplastic adrenal tissue does respond to LH, by making androgens. For a summary, understand fig. 2.3. Expression of LH-R Schoemaker found LH-Rs in hyperplastic and neoplastic adrenal glands by immonohistochemical methods. LH-R staining was also found in the adrenal glands of healthy, fertile ferrets, but these LH-receptors were not or hardly functional. 36 The question is whether the functionality of the LH-R is the cause or the result of the adrenal hyperplastic or neoplastic degradation. 36 It appears to be the cause, 36 since there is a positive correlation between age of neutering and age of diagnosing the disease. 38 When studying the ferret LH-R mrna, Dijkshoorn identified a splice variant in which exon 9 (62 amino acids) is left out. 8 In this report, this splice variant will be called [LH-R Δ exon 9]. 9

Figure 2.4. The amount of mrna expression in tumor tissue (H, A, C) compared to normal adrenal tissue (N). The white beams comprise the LH-R with exclusion of [LH-R Δ exon 9], the green (or gray) beams comprise both [LH-R Δ exon 9] and the full length LH-R. N = Normal adrenal; H = Hyperplasia; A = Adenoma; C = Carcinoma; I = Implant: adrenals of ferrets treated for hyperadrenocorticism with a slow-releasing leuprolide acetate injection, which eventually suppresses LH production for a few months. * = significant (P<0,05). The hyperplasic and adenoma tissues have significantly more LH-R with exclusion of [LH-R Δ exon 9], compared to normal tissue. The adenoma tissue also has significantly more LH-R with exclusion of [LH-R Δ exon 9], than the hyperplasic tissue. Copied and adjusted from the unpublished report of Anne Dijkshoorn on the ferret luteinizing hormone receptor (2007). 8 Dijkshoorn did qpcrs to reveal the amount of LH-R expression in the various tissues (fig. 2.4). 8 The hyperplasic and adenoma tissues have significantly more LH-R with exclusion of [LH-R Δ exon 9], compared to normal tissue. The adenoma tissue also has significantly more LH-R with exclusion of [LH-R Δ exon 9], than the hyperplasic tissue. Some ferrets have been treated for their hyperadrenocorticism with a leuprolide acetate implant, this is a slow-releasing leuprolide acetate injection, which eventually suppresses LH production for a few months. When further research can demonstrate that their adrenal tissue contains primarily [LH-R Δ exon 9] again, then it is proven that the functional adrenal LH-R arises in response to a high plasma LH (or GnRH or FSH) concentration. With a Western blot, Dijkshoorn demonstrated that the amount of total LH-R protein is the same for normal and neoplastic adrenal tissue. Normal adrenal tissue only has the less active splice variant [LH-R Δ exon 9] and the more neoplastic the tissue is dedifferentiated, the more functional full length LH-R it contains. 8 What about this splice variant? One hypothesis, expressed by Dijkshoorn, is that the healthy adrenal gland has mostly [LH-R Δ exon 9], and the diseased adrenal gland mostly full length LH-R. 8 This hypothesis can be supported by the fact that when doing a PCR on adrenal tumour tissue, with a forward primer annealing on exon ( LHR frw 2 8 ) and a reverse primer annealing on exon ( LHR rev 2 8 ) on electrophoresis it yields only one product, while on healthy adrenal tissue it yields 2 products. In humans, the same [LH-R Δ exon 9] has been found. 8 This splice variant is formed together with the full length LH-R in the cell, but unexpectedly, they stick together are broken down as a complex. Dijkshoorn predicts that the same thing happens in the healthy ferret adrenal gland. 10

Another possibility is that, instead of the full length LH-R, the adrenal neoplastic tissue has a mutated form of (hyper)functional LH-R. This mutated LH-R could be having just (a) small mutation(s), so the product on electrophoresis will reveal the same length as the full length LH-R and both LH-R variants will fall in the same electrophoresis band. The full length LH-R could even be down-regulated in this tumorous tissue, this stays unremarked when running such an electrophoresis. Dijkshoorn discusses the existence of another splice variant, with a change in exon 10 and/or 11, which could be expressed mainly in adrenal tumors. 8 However, this splice variant won t have the same length as the full length LH-R, so the product on electrophoresis will not reveal the same length as the full length LH-R and two bands will appear in the electrophoresis, this did not happen (see paragraph LH-R expression ). 11

3. The luteinizing hormone receptor Molecular building of the LH-R The LH-R is a GTP-binding protein coupled receptor (GPCR). 18,20,21 The LH-R has a transmembrane domain, that consists of 7 transmembrane helices. Loops pop out intracellularly and extracellularly (fig. 3.2). Introns account for more than 95% of the LH receptor gene (fig. 3.1). 4 Figure 3.1. The sequence of the rat LH-R schematically. Picture copied from the NCBI website. The LH-R mrna sequence is known of a few species. Dijkshoorn revealed the sequence, from a few basepairs upstream the startcodon, until a few basepairs downstream the stopcodon 8. This sequence is shown on appendix 6.1. Especially the regions in the extracellular domain of the LH-R are well conserved between mammals. In appendix 3.1, a comparison is made on the ferret LH-R mrna sequence with that of different species, using the BLAST program of the NCBI website. When the nucleotide sequence of the ferret is translated to a protein, a high homology to the human and rat sequences reveals. 8 Variations and mutations in the LH-R sequence on humans, and the phenotypic consequences Gonadotropin receptors are prone to mutate. Most mutations are found at the sixth transmembrane helix and third intracellular loop: this domain is very important in its actions of interacting and activating the GTP-binding protein. 24 (fig. 3.2). Only exon 11 has activating mutations. This exon encodes the transmembrane domain, which transduces signals. 24 Splice variants At least three alternatively spliced variants of the human LH-R (deletion of exon 8, 9 or 10) are reported (Atlas of Genetics and Cytogenetics in Oncology and Haematology) (figure 3.3). Splice variant minus exon 10 will be discussed in paragraph Inactivating LH-R mutations. 12

Figure 3.2. The LH-R protein. Activating amino acid changes: (green) circles, inactivating amino acid changes: (red) squares. Asterisk: this mutation has become a polymorphism (see text). The information has been taken from the published literature. Most references can be found in the review of Piersma et al. (2007) 24 Hyperactive LH-R in boys One relatively well-known mutation on the LH-R, results in early puberty in males. These boys of under 4 years old, have a high plasma testosterone concentration and a low serum LH. Why women are not phenotypically effected, is not totally understood, but hypotheses are given in a review on the LH-R, by Piersma et al. (2005). The disorder is an inherited missense amino acid change on exon 11, through which the LH-R is activated without the need of hormones. Officially it is called familial male-limited precocious puberty (FMPP). 24 A hot spot of mutations Aspartate, (D578, the 578 th amino acid of the protein) is a hot spot of mutations 24 : 13

to glycine (G), this leads to FMPP. to tyrosine (Y) this leads to FMPP. to glutamate (E), this also leads to FMPP. to histidine (H), only as a somatic mutation. These patients also suffer from precocious puberty, but then as a result of Leydig cell adenoma. This mutation activates the LH-R in a very strong way, and the LH-R becomes unresponsive to LH or hcg. Figure 3.3. Schematic representation of human LH-R variants. Copied from the Atlas of Genetics and Cytogenetics in Oncology and Haematology website. Inactivating LH-R mutations Inactivating LH receptor mutations occur much more rarely in humans. 24 When parts of a gene are deleted, which can occur on every place in the gene, non-sense mutations or amino acid changes take place. An example are 46XY pseudo hermaphrodites suffering from Leydig cell hypoplasia (LCH). Sisters of these patients are infertile and have low estrogen production with consequently a small uterus and diminished bone mass. 24 In two independent patients, an insertion of 33 base pairs, has been found on exon 1. This location is on position 18 and is prone to mutate, as is shown further on. The insertion is called Ins(LLKLLLLLQ) ( fig. 3.2). The LH-R probably becomes inactive. In vitro, this mutant LH-R does not respond to LH or hcg at all. 24 Another example, is the deletion of the whole exon 10 in males. They have a normal male sex differentiation, but no signs of puberty. This feature is explained as follows: the del(exon10) LH-R did not respond to LH, but was supposed to be still sensitive to hcg, so that the male sex differentiation could take place anyway. The del(exon10) LH-R in vitro responses to hcg whereas the response to LH is very low. 24 14

Single nucleotide polymorphisms A single nucleotide polymorphism (SNPs) is a different sequence of the gene DNA that can exist in the normal population at a frequency of 1% or more. 24 In the human LH-R there have been found around 282 of these single nucleotide replacements. At the website of the CHIP Bioinformatics Tools, one can retrieve known SNPs by position or by association with a gene and explore known genes using names or chromosome positions. Most SNPs are located at the introns of the LH-R. 24 Some frequently occurring human LH-R polymorphisms are discussed here and are pointed out by asterisks (fig. 3.2). inslq stands for an insertion of 2 amino acids, L and Q, at position 18 in exon 1, with an allele frequency of 29%. Estrogens, deriving through an activation of the LH-R, have an effect on breast cancer. Women with breast cancer, who were homozygous or heterozygous for the inslq allele, had a significantly shorter overall survival, compared with those who did not have that allele. Furthermore, these homozygous and heterozygous women also seemed to have more lymph node involvement or larger breast tumour size. More research will be done on this SNP, for example to see if the insertion alters the activity of the LH-R. 24 The S allele has a frequency of 10%. It is the insertion of 2 variable amino acids at position 291 in exon 1. 24 The N allele has a frequency of 45%. This is the insertion of 2 variable amino acids at position 312, also on exon 1. 24 A 124RQ has been described as a SNP with low frequency (<2%) 24 All discovered human LH-R mutations Polymorphism: in exon 1, 8, 10 and 11. Nucleotides insertion/deletion, single nucleotide mutation: in exon 1, 5, 7, 8, 10 and 11. Deletions: exon 8 or 9 or 10 (splice variants). Polymorphism: N291S, N312S. Deletion: of L204, D355. Insertion at aa 18 - IQ Activating mutation: A373V, M398T, L457R, I542L, D564G, A568V, M571I, A572V, I575L, T577I, D578G/Y/H/E, C581R Inhibiting mutation: C131R, F194V, C343S, E354K, W491X, C543R, C545X, R554X, A593P, S616Y and I625K. Deletion: - L608, V609, aa 203-227 (exon 8), aa 228-289 (exon 9), and aa 290-316 (exon 10). Insertion: aa18 - LLKLLLLLQLQ. Table copied from the review of Piersma et al. (2007) 24 15

Mutations in the LH-R on ferrets On the LH-R mrna sequence, Dijkshoorn identified a splice variant in which exon 9 (62 amino acids) is left out. 8 The insert spans 847 bases, starting at the 32 nd base of exon 3 and ending at the 164 th base of exon 11. During her research on the ferret LH-R, Dijkshoorn found a sequence which based on homology did not agree with exon 1 of the mammal LH-R. 8 This first exon is based on homology expected to comprise 81% CG s, which means that, in a PCR, exon 1 will less easily be denaturated and primers will less easily anneal than normally. When Dijkshoorn used a CG-melt protocol, which facilitates this denaturing and annealing actions during the PCR, she revealed an acceptable exon 1 sequence. Dijkshoorn thinks that the first found sequence is an alternative exon, substituting in little amounts. This hypothetical splice variant reacts in a PCR without CG-melt, because it will have less CG %. Mutations in the LH-R on other animals On the website of the National Center for Biotechnology Information (NCBI), SNPs are found on the LH-R of rats and mice, 1 (fig. 3.4 and 3.5). The (partial) sequences of LH-R in other animals (pig, sheep, dog, zebra fish, opossum, grass carp, cattle) are also submitted on the website, but no SNPs or mutations are communicated yet. On mice and rats, no other (non-snp) mutations could be found that were not applied by humans. Furthermore, no phenotypic consequences are mentioned on the mouse and rat SNPs. Figure 3.4a. Mutations in the rat LH-R. Copied from the NCBI website. Figure 3.4b: Scheme of the sequence of the rat LH-R, with the SNPs on exon 6. Picture copied from the NCBI website. 16

Figure 3.5: mutations on mouse LH-R. Copied from the NCBI website. 17

4. Aim of this research The aim of this research is to see if the ferret LH-R of adrenal tumours and hyperplasias contains mutations. 18

5. Material en methods RT-PCR, DNA purification and DNA sequence analysis A RT-PCR is done on 2 µl cdna of carcinoma, adenoma and hyperplastic adrenal tissue (table 5.1). The cdna (40 ng/µl) is available from previous research. The primer combinations used are LHR-B with LHR-UTR and Jan frw with Jan rev (table 5.2). Name owner Adrenal tissue typing Left or right adrenal gland Veenendaal Adenoma Left 1 Van Zeijl Adenoma Left 2 Zwart Hyperplasia Left 4 Baas Hyperplasia Left 5 Den Dulk Adenoma Left 6 Mijnheer Adenoma Left 7 Kilian Hyperplasia Left 8 Kilian Adenoma Right 9 Vreden Carcinoma Right 10 Van de Harst Carcinoma Left 11 Staalman Carcinoma Left 13 Graafeiland Carcinoma Left 30 Pols Carcinoma Right 43 Vlaming Carcinoma Right 51 Table 5.1. The cdna derived from ferret tissues used in our RT-PCR. Archive number Fw / rev Name Sequence Annealing place Also called fw Jan fw TCATGCCTTCAACGGGACGAC Exon 7 LHR frw 3 rev Jan rev CTCAGCAAAGACGGCAGAAGAAAG Exon 10-11 LHR rev 3 fw LHR-B GGAGAATTCATTTGCCTCCCCATGGATGTGGAA Exon 11 Nerts-LHR-B Rev LHR-UTR GTGGTTACTGATAAAACAGTTAACA 3 UTR Nerts-LHR-UTR Table 5.2. Primers that are used. Data copied (and adjusted) from the report of Dijkshoorn. 8 Ingredients to PCR : 5 µl 10x AmpliTaq Gold buffer (Applied Biosystems, Nieuwerkerk a/d IJssel, The Netherlands) 4 µl 25 mm MgCl 2 4 µl dntp s (10 mm each) 0,25 µl AmpliTaq Gold (Applied Biosystems, Nieuwerkerk a/d IJssel, The Netherlands) primers (10 µm) 35.75 µl milliq 19

The PCR program consists of: activation 5 min at 95 C 35 cycles of 95 C for 30 sec 50-60 C for 30 sec 72 C for 1 min final extension at 72 C for 10 min 5 µl of each PCR product is visualized on ethidium-bromide containing 1% agarose gels in 0,5 TBE. A ladder of 100 bp is used (fig. 5.1). The remaining volumes of PCR products are used in the TER-cycle reaction: BigDye Terminator Cycle Sequencing Ready Mix (Applied Biosystems, Nieuwerkerk a/d IJssel, The Netherlands) according to the standard protocol. The TER-cycle reaction program consists of: 25 cycles of 96 C for 30 sec 55 C for 15 sec 60 C for 2 min The TER-cycle product is purified on a multiscreen 96-well filtration plate (Millipore, Amsterdam, The Netherlands). The products are analyzed on an ABI3130 Genetic Analyzer (Applied Biosystems, Nieuwerkerk a/d IJssel, The Netherlands). The DNA sequences are aligned with Seqman Software (DNASTAR Inc., Madison, WI, USA) and MegAlign software (DNASTAR Inc., Madison, WI, USA). This sequences will be compared with the one of the ferret LH-R in testicular tissue, found by Dijkshoorn. 8 Figure 5.1. the used 100 bp DNA Ladder, Promega, Madison, U.S.A. 20

6. Results See also appendix 6.1. PCR products on electrophoresis The primer combination LHR-B with LHR-UTR, on the carcinoma, adenoma and hyperplasic adrenal tissue gave PCR products, visualized in fig. 6.1 and 6.2. The primer combination Jan frw with Jan rev, on the carcinoma, adenoma and hyperplasic adrenal tissue gave PCR products, visualized in fig. 6.3 and 6.4. Carcinoma 51 gave no PCR product. Figure 6.1. Separation on 1% agarose 0.5xTBE agarose gel of products yielded from an RT-PCR with primer LHR-B and LHR-UTR applied to ferret adrenal hyperplasic and adenoma cdna. The numbers refer to the archive number (table 5.1). Sequencing results Sequencing the PCR products of primer combination LHR-B with LHR-UTR on the carcinoma, adenoma and hyperplasic tissue, gave exactly the same sequence as the sequence of the ferret LH-R. Sequencing the PCR products of primer combination Jan frw with Jan rev on the carcinoma, adenoma and hyperplasic tissue, gave the same sequence as the sequence of the ferret LH-R, except for one base on place 950 on exon 10 (fig. 6.5). A normal T is found in none of the examined adrenal tumours, on place 950 on exon 10. Instead, an A or sometimes a C or M is found, M stands for either A or C. Carcinoma 51 did not reveal a sequence. 21

Figure 6.3. Separation on 1% agarose 0.5xTBE agarose gel of products yielded from an RT-PCR with primer Jan frw and Jan rev applied to ferret Figure 6.2. Separation on 1% agarose 0.5xTBE agarose gel of products yielded from an RT-PCR with primer adrenal LHR-B carcinoma and cdna. LHR-UTR applied to ferret adrenal carcinoma cdna. First a ladder is shown. The numbers refer to the First archive a number ladder is shown. (table 5.1). The numbers refer to the archive number (table 5.1). Carcinoma 51 has no PCR product. MQ is a negative control. Figure 6.4. Separation on 1% agarose 0.5xTBE agarose gel of products yielded from an RT-PCR with primer Jan frw and Jan rev applied to ferret adrenal hyperplasia, adenoma and one carcinoma (10) cdna. First and last ladders are shown. The numbers refer to the archive number (table 5.1). 22

Figure 6.5. The sequence results on the hyperplasia and adenoma tissue, shown on the SeqMan Software (DNASTAR Inc., Madison, WI, USA). R is sequenced using reverse primer Jan rev. F is sequenced using forward primer Jan frw. The number behind the R or F, stands for the archive number of the tissue (see table 5.1). LHR fret stands for the total LH-R sequence of healthy ferret testes. The arrow marks the different nucleotide. When the computer program is not sure of the liability of the results because the summits of the lines are not clear, the area is coded yellow (gray). The T is the T nucleotide that probably has mutated in the tumors. The M stands for a C or A nucleotide. Unfortunately, not all specimens gave usable sequences, for example there is no usable ab1 file of tissue number 3 with the Jan frw primer, and some tissues gave no usable sequences with both primers. 23

7. Discussion In previous studies, only exon 11 of the LH-R has been found to have activating mutations, 24 but in this study no mutations have been found at least on the second half of exon 11 (base 1578 up to and including base 2112) of the LR-R of the studied carcinoma, adenoma and hyperplasic tissue. One point mutation appears to have been found in between base 611 (last part of exon 7) and base 962 on exon 10 (fig. 6.3): Base 950 on exon 10 has a T nucleotide on testis tissue, but this T has not been found in any of the examined adrenal tumours, on place 950 on exon 10. Instead, an A or sometimes a C or M is found, M stands for either A or C. Unfortunately, not all specimens gave usable sequences, and some tissues gave no usable sequences with both primers. Furthermore, the found sequences are not always reliable. But obviously base 950 is curious in the LH-R of ferret adrenal tumours. One possibility is that the ferret LH-R sequence of healthy testis tissue, found by Dijkshoorn, has for example an A instead of a T on base 950. It can also be a point mutation. The T is the third nucleotide in the codon (CCT), coding for proline (fig. 7.1). The amino acid will not be changed when this T changes into any other base. So the genotype may be different, but there are no phenotypic consequences. Figure 7.1. When the codon starts with double C, proline (Pro) will be built into the protein. Copied from the Access Excellence website. 24

Figure 7.2. Alignment of ferret LH-R of healthy tissue (upper strand) with LH-R of humans, rats, dogs and mice (lower strand). Base 950 is marked yellow (gray). A new splice variant? Carcinoma 51 gave no PCR product with the Jan primers. It could be a mistake, made for example during filling the electrophoresis gel. Another possibility is, that one or both of the primers might not be able to anneal because a part of the sequence is missing. Carcinoma 51 tissue possibly expresses a new splice variant, like [LH-R Δ exon 7] or [LH-R Δ exon 10]. In humans, [LHR Δ exon 10] is known. 25

8. Conclusion From the sequencing results on carcinoma adrenal tissue of 6, on adenoma adrenal tissue of 5, and on hyperplasic adrenal tissue of 3 pet ferrets, no mutations have been found on the second half of exon 11 (base 1578 up to and including base 2112). Between base 611 (last part of exon 7) and base 962 (exon 10), there appears to be a point mutation in most of the tumorous tissues, on base 950 on exon 10. Further research has to be done to confirm this, but base 950 is on the 3 rd place in the codon so it will not have phenotypic consequences anyway. One carcinoma possibly expresses a new splice variant ([LH-R Δ exon 7] or [LH-R Δ exon 10]). Further research should be done. 26

Websites and literature www.ncbi.nlm.nih.gov atlasgeneticsoncology.org snpper.chip.org www.accessexcellence.org 1. Baum MJ 1998 Use of the Ferret in Reproductive Endocrinology. In: Biology and Diseases of the Ferret, ed. Fox JG, 2nd ed., pp. 521 535. Lea & Febiger, Philadelphia, PA 2. Beuschlein F, Looyenga BD, Reincke M, Hammer GD 2004 Role of the inhibin/activin system and luteinizing hormone in adrenocortical tumorigenesis. Horm Metab Res 36:392 396 3. Bielinska M, Genova E, Boime I, Parviainen H, Kiiveri S, Rahman N, Leppa luoto J, HeikinheimoM, Wilson DB Nude mice as a model for gonadotropin-induced adrenocortical neoplasia. Endocrinology 146:3975 3984 4. Bielinska M, Kiiveri S, Parviainen H, Mannisto S, Heikinheimo M, Wilson DB 2006 Gonadectomy-induced Adrenocortical Neoplasia in the Domestic Ferret (Mustela putorius furo) and Laboratory Mouse. Vet Pathol 43:97 117 5. Bielinska M, Genova E, Boime I, Parviainen H, Kiiveri S, Rahman N, Leppa luoto J, Heikinheimo M, Wilson DB Nude mice as a model for gonadotropin-induced adrenocortical neoplasia. Endocrinology 146:3975 3984 6. Blichert-Toft M, Vejlsted H, Hehlet H, Albrechtsen R 1975 Virilizing adrenocortical adenoma responsive to gonadotrophin. Acta Endocrinol (Copenh) 78:77-85 7. Boord M, Griffin C 1999 Progesterone secreting adrenal mass in a cat with clinical signs of hyperadrenocorticism. J Am Vet Med Assoc 214:666-669 8. Dijkshoorn A 2007 Luteinizing hormone receptor: investigation into the sequence and expression in ferrets, with emphasis on healthy adrenal glands and those with adrenocortical neoplasia. Unpublished 9. Donovan BT, Matson C, Kilpatrick MJ 1983 Effect of exposure to long days on the secretion of oestradiol, oestrone, progesterone, testosterone, androstenedione, cortisol and follicle-stimulating hormone in intact and spayed ferrets. J Endocrinol 99:361 368 10. Douma S, Van Laar T, Zevenhoven J, Meuwissen R, Van Garderen E, Peeper DS Suppression of anoikis and induction of metastasis by theneurotrophic receptor TrkB. Nature 430:1034 1039, 11. Fox JG, Dangler CA, Snyder SB, Richard MJ, Thilsted JP 2000 C-Cell Carcinoma (Medullary Thyroid Carcinoma) Associated with Multiple Endocrine Neoplasms in a Ferret (Mustela putorius). Vet Pathol 37:278 282 12. Fox JG, Marini RP 1998 Diseases of the endocrine system. In: Biology and Diseases of the Ferret, ed. Fox JG, 2nd ed., pp. 291 305. Lea & Febiger, Philadelphia, PA 13. Gould WJ, Reimers TJ, Bell JA, Lawrence HJ, Randolph JF, Rowland PH, Scarlett JM 1995 Evaluation of urinary cortisol:creatinine ratios for the 27

diagnosis of hyperadrenocorticism associated with adrenal gland tumours in ferrets. J Am Vet Med Assoc 206:42-46 14. Grazzini E, Boccara G, Joubert D, Trueba M, Durroux T, Guillon G, Gallo- Payet N, Chouinard L, Payet MD, Serradeil LG 1998 Vasopressin regulates adrenal functions by acting through different vasopressin receptor subtypes. Adv Exp Med Biol 449:325 334, 1998 15. Jallageas M, Boissin J, Mas N 1994 Differential photoperiodic control of seasonal variations in pulsatile luteinizing hormone release in long-day (ferret) and short-day (mink) mammals. J Biol Rhythms 9:217 231 16. Leinonen P, Ranta T, Siegberg R, Pelkonen R, Heikkila P, Kahri A 1991 Testosteronesecreting virilizing adrenal adenoma with human chorionic gonadotrophin receptors and 21-hydroxylase deficiency. Clin Endocrinol (Oxf) 34:31-35 17. Lipman NS, Marini RP, Murphy JC, Zhibo Z, Fox JG 1993 Estradiol-17- secreting adrenocortical tumour in a ferret. J Am Vet Med Assoc 203:1552-1555 18. Loosfelt H, Misrahi M, Atger M, Salesse R, Vu Hai-Luu Thi MT, Jolivet A, Guiochon-Mantel A, Sar S, Jallal B, Garnier J, et al. 1989 Cloning and sequencing of porcine LH-hCG receptor cdna: variants lacking transmembrane domain. Science 245, 525 528. 19. Magalhaes MC 1972 A new crystal-containing cell in human adrenal cortex. J Cell Biol 55:126 133 20. McFarland KC, Sprengel R, Phillips HS, Kohler M, Rosemblit N, Nikolics K, Segaloff DL, Seeburg PH 1989 Lutropinchoriogonadotropin receptor: an unusual member of the G protein-coupled receptor family. Science 245, 494 499. 21. Minegishi T, Nakamura K, Takakura Y, Miyamoto K, Hasegawa Y, Ibuki Y, Igarashi M 1990 Cloning and sequencing of human LH/hCG receptor cdna. Biochem. Biophys. Res. Commun. 172, 1049 1054. 22. Myers NC III, Bruyette DS 1994 Feline adrenocortical diseases: Part I Hyperadrenocorticism. Semin Vet Med Surg (Small Anim) 9:137-143 23. Nelson RW, Couto CG 2003 Small Animal Internal Medicine. 3rd Edition, Mosby Title. 24. Piersma D, Verhoef-Post M, Berns EMJJ, Themmen APN 2007 LH receptor gene mutations and polymorphisms: An overview. Molecular and Cellular Endocrinology 260 262, 282 286 25. Rijnberk A 1996 Adrenals. In: Rijnberk A, ed. Clinical endocrinology of dogs and cats; an illustrated text. Dordrecht: Kluwer Academic Publishers; 61-94 26. Rosenthal KL 1997 Adrenal gland disease in ferrets. In: Kintzer PP, ed. Veterinary Clinics of North America, Small Animal Practice. Philadelphia: WB Saunders Co.; 401-418 27. 97 Rosenthal KL 1997 Adrenal gland disease in ferrets. Vet Clin North Am Small Anim Pract 27:401 418 28. Rosenthal KL 1997 Endocrine diseases part II. In: Ferrets, Rabbits, and Rodents: Clinical Medicine and Surgery, ed. Hillyer EV and Quesenberry KE, pp. 91 98. W.B. Saunders Company, Philadephia, PA 29. 99 Rosenthal KL, Peterson ME 1996 Evaluation of plasma androgen and estrogen concentrations in ferrets with hyperadrenocorticism. J Am Vet Med Assoc 209:1097 1102 28

30. Rosenthal KL, Peterson ME 1996 Evaluation of plasma androgen and estrogen concentrations in ferrets with hyperadrenocorticism. J Am Vet Med Assoc 209:1097-1102 31. Rosenthal KL, Peterson ME, Quesenberry KE, Hillyer, EV, Beeber NL, Moroff SD, Lothrop CD Jr 1993 Hyperadrenocorticism associated with adrenocortical tumour or nodular hyperplasia of the adrenal gland in ferrets: 50 cases (1987-1991). J Am Vet Med Assoc 203:271-275 32. Rossi GP, Sacchetto A, Cesari M, Pessina AC 1999 Interactions between endothelin-1 and the reninangiotensin- aldosterone system. Cardiovasc Res 43:300 307 33. Rossmeisl JH Jr, Scott-Moncrieff JC, Siems J, Snyder PW, Wells A, Anothayanontha L, Oliver JW 2000 Hyperadrenocorticism and hyperprogesteronemia in a cat with an adrenocortical adenocarcinoma. J Am Anim Hosp Assoc 36:512-517 34. Russfield AB 1975 Experimental endocrinopathies. Methods Achiev Exp Pathol 7:132 148, 1975 35. Rutteman GR, Misdorp W, Blankenstein MA, van den Brom WE 1988 Oestrogen (ER) and progestin receptors (PR) in mammary tissue of the female dog: different receptor profile in nonmalignant and malignant states. Br J Cancer 58:594-599 36. Schoemaker NJ 2003 Hyperadrenocorticism in ferrets. Proefschrift Universiteit Utrecht 37. Schoemaker NJ, van der Hage MH, Flik G, Lumeij JT, Rijnberk A 2004 Morphology of the pituitary gland in ferrets (Mustela putorius furo) with hyperadrenocorticism. J Comp Pathol 130:255 265, 2004 38. Schoemaker NJ, Schuurmans M, Moorman H, Lumeij JT 2000 Correlation between age at neutering and age at onset of hyperadrenocorticism in ferrets. J Am Vet Med Assoc 216:195-197 39. Schoemaker NJ, Teerds KJ, Mol JA, Lumeij JT, Thijssen JH, Rijnberk A 2002 The role of luteinizing hormone in the pathogenesis of hyperadrenocorticism in neutered ferrets. Mol Cell Endocrinol 197:117 125 40. Schoemaker NJ, Wolfswinkel J, Mol JA, Voorhout G, Kik MJ, Lumeij JT, Rijnberk A 2004 Urinary glucocorticoid excretion in the diagnosis of hyperadrenocorticism in ferrets. Domest Anim Endocrinol 27:13 24 41. Syme HM, Scott-Moncrieff JC, Treadwell NG, Thompson MF, Snyder PW, White MR, Oliver JW 2001 Hyperadrenocorticism associated with excessive sex hormone production by an adrenocortical tumour in two dogs. J Am Vet Med Assoc 219:1725-1728 42. Thijssen JHH, van den Berg JHM, Adlercreutz H, Gijzen AHJ, de Jong FH, Meijer JC, Moolernaar AJ 1980 The determination of cortisol in human plasma: evaluation and comparison of seven assays. Clin Chim Acta 100:39-46 43. Wagner RA, Bailey EM, Schneider JF, Oliver JW 2001 Leuprolide acetate treatment of adrenocortical disease in ferrets. J Am Vet Med Assoc 218: 1272 1274 44. Wagner RA, Piche CA, Jochle W, Oliver JW 2005 Clinical and endocrine responses to treatment with deslorelin acetate implants in ferrets with adrenocortical disease. Am J Vet Res 66:910 914 45. Weber MM, Fottner C, Wolf E 2000 The role of the insulin-like growth factor system in adrenocortical tumourigenesis. Eur J Clin Invest 30(Suppl 3): 69 75 29

46. Weiss CA, Scott MV 1997 Clinical aspects and surgical treatment of hyperadrenocorticism in the domestic ferret: 94 cases (1994-1996). J Am Anim Hosp Assoc 33:487-493 30

Lower strand: human LH-R (2902 bp) Lower strand: rat LH-R (2902 bp) Lower strand: dog LH-R (2272 bp) Lower strand: mouse LH-R (2553 bp) Appendix 3.1: Result of blasting 2 sequences (cdna) on the NCBI website. The upper strand is the ferret LH-R sequence (2112 basepairs (bp)). The lower strand is variable. Bitscore and expect value are calculated based on the size of the nr database. The blue lines are the almost similar sequences, with an identity score of for example 85% (ferret to human).

Appendix 6.1. The sequence of the ferret luteinizing hormone receptor mrna Appendix 6.1. The full length sequence of the ferret LH-R mrna. The first row are the nucleotides of the coding strand. The second row are the amino acids in the right reading frame.