Cairo University Faculty of Veterinary Medicine Department of Microbiology Studies on diversity of Streptococcus pyogenes isolated from different sources Thesis presented by Fatma Fathy Mohamed B. V. Sc., Faculty of Veterinary Medicine Cairo university (2003) For The Degree of Master of Veterinary Medical Sciences, Microbiology (Bacteriology Immunology Mycology) 2013
Under the supervision of Prof.Dr. Heidy Mohamed Shawky Head Professor of Microbiology, Faculty of Veterinary Medicine Cairo University Prof. Dr. Mohamed Kamal Refai Prof. of Microbiology, Faculty of Veterinary Medicine, Cairo University
The aim of the present study was to study the incidence of streptococcus specie in causing mastitis with special reference to enterococci and this will be achieved through : 1. isolation and identification of streptococcus species and streptococcal like bacteria causing mastitis. 2. studying the antibiotic sensitivity against different types of antimicrobial agents. 3. Identification and differentiation of enterococcus species using PCR 4. Detection of virulence gene in Enterococcus species.
Material and Methods. 1. Material : 1.1. Samples: Milk Samples were collected from mastitic, apparently healthy lactating animals from different farms in Egypt. The samples from cattle, buoffloes were collected from El Giza, ElMenofia, Alexandria, Elsharkia IsmailiaI and Bany Souif Governorats while from Sheep and goats were collected from ElMansoura and farm of Faculty of Agr. cairo University. 1.2. Media used for primary isolation and identification of Streptococcus species:
1.3. Reagents and chemicals were used for identification of streptococci: Lancifield grouping: ( slidex strepto plus)(biomérieux) 1.4. API 20strep (Biome rieux SA): 1.5. Antimicrobial sensitivity disks: (Oxoid). 1.6. Buffers and solutions used for molecular identification : 1.7. Standard and reference strains of enterococci : The standard strain, E.faecalis ( ATCC 29212 isolate) and E. faecium (ATCC 19434) were obtained from the American Type Culture Collection.
Table (1 )Antimicrobial agents used for Antibiotic sensitivity test : Antimicrobial agents Disc code conc Zone diameter(mm) Amoxicilllin Ampicillin Cefatriaxon Ciprofloxacin Clindamycin AML AMP CRO CF CD 25 10 30 10 2 R 11 1 15 24 15 14 I 12132 15 1520 S 14 15 24 21 21 Gentamycin Erythromycin Ofloxacin Vancomycin Chloramphenicol Tetracyclin Rifampin Bacitracin Optochin Azithromycin CN E ON VN C TE RD B P AZ 12 15 20 300 30 30 30 0.04 4 5 6 13 12 14 21 18 16 14 11 79 1422 1315 1516 1317 1922 1718 15 1216 10 23 16 17 18 23 14 >1.5 16 17
Table ( 2 ) Primer sequences used in this study for verification of Enterococcus species and virulence determinants: primer Enterococcus specific Ent1 Ent2 Oligonucleotide Sequence (5'3') 59TACTGACAAACCATTCATGATG3 59 AACTTCGTCACCAACGCGAAC39 Product Size 112bp Danbing KE et al.1999 Reference s ddl E. faecalis ddl E faecium. ddle1 ATCAAGTACAGTTAGTCTTTATTAG ddle2 ACGATTCAAAGCTAACTGAATCAGT ddlf1 TTGAGGCAGACCAGATTGACG ddlf2 TATGACAGCGACTCCGATTCC 941 bp 658 bp Aylin et al.2010 Aylin et al.2010 CylA virulence gene CYT I ACTCGGGGATTGATAGGC CYT II b GCTGCTAAAGCTGCGCTT 688 bp Aylin et al.2010
2.Methods 2.1. Collection of sample 2.2. California Mastitis test (CMT ) 2.3. Bacteriological examination 2.4. Identification of the isolates Biochemical identification of streptococcal species and Enterococcus species Rapid Biochemical method For identification of streptococcus species and Enterococcus species.. Serological identification: Lancifield grouping 2.5. Antibiotic sensitivity test 2.6. Polymerase Chain Reaction (PCR)
Table (3): Identification of Streptococci and streptococcus like bacteria on blood agar Beta haemolysis S. agalactiae S. equi subsp zooepidmicus Alpha haemolysis S.pneumoniae Aero coccus viridance Gamma haemolysis Enterococci S.dysagalactiae S.uberis Lacto lactis
Table (4) : Biochemical identification of streptococcus species : Biochemical test S.equi subspp S. agalactia S.uberis S.dysagalactia S.pneumoniae.zooepdimic us Catalase CAMP oxidase optochin Haemolysis B B Y Y α Bile esculin Sod hippurate hydrolysis Gelatin liquification Trehalose Lactose Sorbitol Manitol Inulin Salicin )(
Table( 5): Biochemical identification of enterococci specific tests: Biochemical test Catalase Growth in bile esculin agar PYR Hemolysis on blood agar Result ve ve ve Gamma hemolysis
Lact lactis Aero virdan1 E.faecium E.faecalis S.zooepidemic us S.dysagalactiae S.uberis S.agalactiae Test Vp ± ± ± Hip Esc ± ± PYRA ± ± αgal ± BGUR ± ± BGAL PAL LAP ADH RIB ± ARA ± MAN ± SOR ± LAC TRE ± INU ± RAF ± AMD ± ± GLYG ± BHEM Table (6 ) Biochemical details of streptococci, enterococci and streptococcus like bacteria obtained by API
E.faecium E.faecalis AMY APPA LeuA AlaA drib NOVO draf OPTO PIPLC CDEX ProA TyrA ILATK NC6.5 0129R dxyl ASPA BGURr dsor LAC dman SAL ADH1 BGAR AGAL URE NAG dmne SAC BGAL AMAN PyrA POLYB dmal Table (7 ) Biochemical details of enterocci obtained by vitke system
Table ( 8) :Serological identification ( Lancifield grouping): A B C D Result Enterococcus species D S. equi sub.zooepidemicus C S. agalactiae B S. uberis S.dysaglactiae non groupable
The following program of denaturing annealing synthesizing cycle was installed and applied: Initial heating for denaturation at First cycle denaturation at Annealing at Extension at Repeat for another 35 cycles. Final extension at 94 C for 2min. 94 C for 1 min. 55 C for 1 min. 72 C for 2 min. 72 C for10 min 5 μl of the PCR products were examined in a 1% agarose gel at 100 V
Table (9 ): Prevalence of Gram positive cocci isolated from mastitic milk samples collected from different animal species. Source of isolates No.of the examined samples No of positive samples No % Cattle 280 83 29.64% Buffaloes 60 11 18.33% Sheep 30 5 16.66% Goat 30 6 20% Total 400 105 26.25%
Figure ( 1 ):Prevalence of gram positive cocci isolated from mastitic milk samples collected from different animal species
Table (12): Frequency of isolation of Enterococcus species among examined mastitic milk samples collected from different animal species: Source of isolates No.of the examined samples No of positive samples No % Cattle 280 48 17.14 % Buffaloes 60 11 18.33 % Sheep 30 5 16.66 % Goat 30 6 20 % Total 400 70 17.5 %
Figure (4) : Frequency of isolation of Enterococcus species among examined mastitic milk samples collected from different animal species.
Table (13): Results of streptococcal like bacteria in mastitic cattle. species Lact. lactis subsp lactis Aerococcus viridans1 Aerococcus viridans2 Total No 12 4 2 18 % 3.75 1.25 0.63 5.63
Figure (5) :Results of streptococcal like bacteria in mastitic cattle.
Table (14): Streptococcus species on sheep blood agar. Beta haemolysis α heamolysis Y heamolysis Total Number 7 1 9 17 percentage 41% 5.88% 52.94% 100%
Figure ( 6 ): Streptococcus species on sheep blood agar
Photo (1) S. equi subsp zooepidimicus on blood agar Photo (2) S.agalactiae on blood agar
Table (15):Enterococcus species on sheep blood agar: Sheep Blood agar Total Beta haemolytic Y haemolytic Enterococcus species 20 50 70 Percent 28.57% 71.42% 100%
Figure (7):Enterococcus species on sheep blood agar
Photo ( 3 ) :Enterococcus species on sheep blood agar
Photo ( 4 ) S.agalactiae Photo (5 ) S.equi subsp zooepdemicus Photo ( 6 )S.pneumoniae Photo (7 ):Enterococci Microscopical appearance of streptococcus species and enterococcus species
Table ( 16 ) :Results biochemical identification test of streptococcus species Enterococcus species and streptococcal like bacteria: strains Total No Catalase Bile esculin PYR CAMP Positive % Positive % Positive % Positiv e % Streptococcus species Enterococcus Species Lactococcus species Aerococcus species 17 17 100% 6 35.29% 0 4 23.52% 70 70 100% 70 100% 70 100% 12 12 100% 12 100% 0 6 6 100% 6 100% 0 total 105 105 100% 94 89.52% 70 66.66% 4 3.8%
Figure ( 8 ): Results biochemical identification test of streptococcus species Enterococcus species and streptococcal like bacteria:
A: bile esculin B: PYR ve: black color ve: red color Photo ( 8 ): Results of biochemical identification test of streptococcus species and streptoccus like bacteria
Table( 17 ) :Biochemical identification of streptococcus species and streptococcus like bacteria among mastitic cattle examined by API: species Total % S.agalactiae 4 11.42% S.zooepidmicus 4 11.42% S.dysagalactiae 3 8.57% S.uberis 3 8.57% S.porcinus 1 2.85% S.mitis 1 2.85% S.pneumoniae 1 2.85% Lact lactis subsp lactis 12 34.28% Aero viridance 1 4 11.42% Aero viridance2 2 5.71%
Figure ( 9 ): Biochemical identification of streptococcus species and streptococcus like bacteria among mastitic cattle examined by API:
A: S.uberis B: S.equi subsp equi Photo (9):API 20 strep of streptococcus species C: Aero virdance 1 D: lacto lactis subsp lactis Photo ( 10 ):API 20 strep of streptococcus like bacteria.
Table (18) : Biochemical identification of Enterococcus species among different mastitic Animal examined by API 20 strep: species E.faecalis E.faecium E.durans No % No % No % Cattle 13 30.23 % 16 37.20% 3 6.97% Buffaloes 7 16.27 % 4 9.30 % Sheep 2 4.65 % 3 6.97 % Goat 3 6.97 % 3 6.97 % Total 25 58.13 % 26 60.46% 3 6.97%
Figure ( 10 ): Biochemical identification of Enterococcus species among different mastitic Animal examined by API20 strep:
API of E.faecalis B API of E.faecium Photo ( 11 ):API 20 strep of Enterococcus species.
Table (19): Results of Lancifield classification of streptococci (slidex strepto plus BioMérieux) Group B Group C Group D Result 4 3 70 Total 77 strains
Figure (11) Results of Lancifield classification of streptococci ( slidex strepto plus BioMérieux)
Photo (12): Results of Lancifield classification of streptococci ( slidex strepto plus BioMérieux).
Table ( 20 ) Results of Antibiotic sensitivity test of streptococcus species and Enterococcus species: Chemotheraputi c agent Streptococcus species % of susptable % of resistan t Enterococcus species % of susptable % of resistant Penicllin 100% 0 % 100% 0 % Vancomycin 100% 0 % Cefotaxime 95% 5 % 90% 10 % Erythromycin 50% 50 % 27.3% 72.7 % Rifampicin 60% 40 % 45.5% 54.5 % Gentamicin 55% 45 % 36.4% 63.6 % Ciprofloxacin 58 % 42 % 54.4% 45.5 % Ofloxacin 44.7% 55.3 % 63.7% 36.3 % Cholarmphenico 65% 36 % 72.8% 27.2 % l tetracycline 70% 30 % 63.4% 36.6 %
Figure ( 12 ) :Results of Antibiotic sensitivity test of Streptococcus species and Enterococcus species.
Photo: ( 13 )Antibiotic sensitivity test of Photo ( 14): E test MIC S. agalactiae for pencillin
Table (22) Incidence of bacitracin susceptibility in examined sample: S. agalactiae S.zooepdemicus S R S R bacitracin 2 2 3 0 % 50% 50% 100% 0%
Table (23 ) Results of antibiotic resistance of E. faecium and E. faecalis: % resistance for E.faecium % resistance for E.faecalis Penicllin 0 % 0 % Vancomycin 0 % 0 % Erythromycin 72% 93.3% Rifampicin 44% 86.6% Gentamicin 60% 66.7 % Ciprofloxacin 28% 73 % Ofloxacin 28% 36 % Cholarmphenicol 28% 33.3 % Tetracycline 24% 66.6 % Azithromycin 15% 20 %
Fig. (13):Results of antibiotic resistance of E. faecium and E. faecalis:
Photo ( 15 ) E. faecium Photo (16) E. faecalis Antibiotic sensitivity test of Enterococcus species.
Table ( 23 ) :Results of Enterococci positive PCR products amplified by using the Ent1 and Ent2 specific primers : Source Lane 1 ve control Lane 2 Lan 3 Lane 4 Lane 5 Lane 6 Lane 7 Lane 8 Lane 9 cattle 112 112 112 Baffaloes 112 112 112 sheep 112 112 112 goat 112 112 112
Photo ( 17 ): Electrophoretic profile of PCR products of Enterococcus isolates amplified by using specific primer(ent1, Ent2). (1 ) Marker 1000bp. ( 2) ve control reference strain.. (3,4,5,6,7,8,9,10) Enterococcus species.
Table (25) Results of E. faecium positive PCR products amplified by using ddlefaecium primers: Source ve control Lane2 Lan3 Lane4 Lane5 Lane6 Lane7 Lane8 Lane9 cattle 658 658 658 Baffaloes 658 658 ve sheep 658 658 658 goat 658 658 658
Photo ( 18 ): Electrophoretic profile of PCR products of E faecium isolates amplified by using specific primer (ddle faecium) (1 ) Marker 100bp. ( 2) ve control reference strain (ATCC 19434) (3,4,5,6,7,8,9) E.faecium.
Table (26) Results of E. faecalis positive PCR products amplified by using ddlefaecalis primers: Source ve control Lane2 Lan3 Lane4 Lane5 Lane6 Lane7 Lane8 Lane9 cattle 941 941 941 Baffaloes 941 ve 941 sheep 941 941 941 goat 941 941 941
Photo (19 ): Electrophoretic profile of PCR products of E.faecalis isolates amplified by using specific primer (ddle faecalis) (1 ) Marker 100bp. ( 2) ve control reference strain (ATCC 29212) (3,4,5,,8,9,10) E.f aecalis.
Table (27): Result of Incidence of virulence gene cyla among Enterococci spp: species Number of examined samples Positive cyla virulence gene E.faecalis E.faecium No % No % cattle 5 3 100% 2 100% goat 2 1 100% 1 100% Buffalo 2 1 100% zero 0 % Sheep 3 2 100% 1 100% Total 12 7 58.33% 4 33.33%
Figure (14 ) :Incidence of virulence gene CylA among Enterococcus species.
Photo (20 ): Electrophoretic profile of PCR products of virulence CylA gene incidence i in E.faecium and E.faecalis isolates amplified by using specific virulence primer CylA gene (1 ) Marker 100bp. (2,3,4,5,6,8,9) Positive virulence gene of E.faecium and E.faecalis.