The Altai saker origins and reintroduction - preliminary results and perspectives L. Zinevich, E. Nikolenko, D. Rozhkova, E. Shnayder, E. Sarytchev, I. Karyakin
About the RRRCN A non-governmental association of ornithologists, birdwatchers, ornithological and environmental organizations, which in cooperation seek to learn the birds of prey and owls that live in the vast territory of Russia and neighboring countries and promote their conservation. Web-GIS database (included to GBIF)
The saker falcon in the Altai-Sayans The saker has dramatically decreased in numbers from the beginning of the XX century (A) to the 2010 ths (B). Our database contains more than 600 occupied breeding territories and more than 1600 birds description. A B Karyakin, 2011
The saker falcon in the Altai-Sayans The Western (Falco cherrug cherrug) and Eastern (F. ch. milvipes) sakers the genetically confirmed subspecies. The Eastern sakers and the gyrfalcons have the same mitochondrial D-loop haplogroup (A). The Western sakers differ (B). Karyakin, 2011 Morphological traits define more variants: 1 F. cherrug cherrug (Western); 2 F. ch. milvipes + karelini + coatsi (Eastern); 3 F. ch. progressus + hendersoni (Eastern). Contemporary areas of the Western (1) and Eastern (2&3) sakers. Nittinger et al., 2007
The saker falcon in the Altai-Sayans DNA extraction: Horvath et al., 2005 77 independent samples: 5 Crymea; 2 Dauria: 70 Altai-Sayan region Specific PCR primers For 5-3 : ACTAAACCCATGCCCTGTAT, GCCCTTCTCCGAGCCATCTG, CGGTTTGCGTATTTGGAGTCA; Rev 5-3 : GAACCAACCGCCCCAAAAAG, GGGTAGGGGGTTTTAAGTTTTTGT, TCGGGCGGTTTAGGTTTATTGG. D-loop ALT polymorphic region: 419-1089 bp (671 bp); 757-1171 bp (415 bp) Nittinger et al. 2007 D-loop ALT region. Molecular Phylogenetic analysis by Maximum Likelihood method (Hasegawa- Kishino-Yano model, Gammadistributed (5 categories (+G, parameter = 0.0500)). Bootstrap 1000. MEGA 7.0. 10 parsimonially significant sites π = 0.00656828
The saker falcon in the Altai-Sayans D-loop ALT fragment TCS network. FP Falco peregrinus, FC-ALT haplotypes. Altai-Sayan sakers genetic diversity A B The saker falcon evolution in unclear. The genetic distance between two mitochondrial haplogroups can be even bigger, than it was shown previously.
The Altai saker project The Altai saker: unique for the Altai-Sayan region: clearly defined; almost disappeared. P. Sushkin, 1938: the altaic phenotype (A) is inherited, but not stable in descendants (B-F). The Altai saker taxonomy: from the separate species (1891-1965) to the gyrfalcon (1950-1960s) and saker (1990-2010s) morphs.
The Altai saker project The aim of the project is to restore the Altai saker population in the Altai-Sayan region. The method of the reintroduction is transferring the 20-27 days old altaic nestlings from hatcheries to the natural nests of other saker morphs in the Altai-Sayan region. The pilot study: 10 nestlings from Moscow falcon hatchery Vitasphera were brought to the Altai-Sayan region and released to natural nests in 2017. 7 chicks were released in Tuva at our saker test area with nesting platforms.
The Altai saker project All the nestlings were ringed with color rings. 3 birds (2 natural and 1 released) were tagged with the GPS/GSM tags. 24-hour videomonitoring (1 nest) + first day video registration (all others) + monitoring till the fledglings fly. The samples for the DNA analysis were collected from all birds, as from natural, so from released ones. The altaic nestling with the tag (A) and the adult female F. ch. saceroides (B) with some altaic traits. A B
The Altai saker project All the altaic nestlings were fed and nursed by the natural stepparents normally from the first hour after their transferring and behaved like natural nestlings. One altaic nestling was predated by the eagle owl. All other reintroduced nestlings fledged successfully. 25 from 29 natural nestlings fledged successfully. 2 were predated, one died of unknown reason, 1 fell down from the nest and starved. 36 minutes after the chicks transferring. The female feeds the brood with our hamsters.
The Altai saker project The GPS/GSM tag on the altaic nestling went out of order. No data about the reintroduced birds migration was available. One GPS-tagged natural nestling was predated by the Eagle owl. The natural female Uchsyn was killed at the dangerous powerline. Natural female migration in 2017.
The Altai saker project A-group B-group Total Natural nestlings of the Altai-Sayan sakers Reintroduced altaic nestlings 4 broods 5 broods + 1 adult wounded female 10 nests 2 broods 2 broods 4 broods We are clearly reintroducing the original genotypes, but
What the Altai saker is? Clearly it is not a gyrfalcon population living in the Altai-Sayan The Altai-Sayan region is a zone of the subspecies intergradation. The mt-dna analysis showed that the Altai saker is the result of the line crossbreeding. Presumably the high heterozygosity in raptors leads to better adaptiveness. Long-distance crossbreeding leads to ancestral traits segregation. The Altai saker in the Altai-Sayan region represents a good model for the raptors species evolution and genotype to phenotype implementation studies.
Results and perspectives Releasing chicks to natural nests showed its possibilities in the Altai-Sayan saker population numbers and diversity restoration; In case of the food lack it is necessary to feed not only sakers, but other raptors at the territory the Eagle owl first of all; We need more released birds and more GPS-tags to obtain data about the migration of the released birds and their breeding success to come to conclusion about the reintroduction success; The detailed genetic and phenotypic analysis is necessary to study the saker falcon evolution. The Eagle owl (Bubo bubo) at the saker s territory. I. Usanov s TV report. The project will be continued The Peregrine falcon nuclear genome phylogeny: good conformity with the ecological and morphological data. Johnsson et al. 2017
Thank you for your attention!
II International Scientific and Practical Conference "Eagles of Palearctic: Study and Conservation" http://rrrcn.ru/en/conference-2018 7 10 September 2018 Russian Raptor Research and Conservation Network (RRRCN), MME/Birdlife Hungary. Koltzov Institute of Developmental Biology of Russian Academy of Sciences, Elabuga Institute of Kazan Federal University Shukshin Altai State Humanitarian- Pedagogical University, Darwin State Nature Reserve, Russian Bird Conservation Union with the support of Trust for Mutual Understanding, The Altai Project, European Union s LIFE Nature Fund (Pannoneagle LIFE Project LIFE15NAT/HU/000902) and Sibecocenter LLC
В популяциях балобанов Алтае-Саянского региона происходит замена фенотипа за счёт целенаправленного изъятия самок западного балобана, которые являются наиболее коммерчески интересными, нежели восточные балобаны с полосатой спиной То что браконьеры предпочитают изымать самок именно западных балобанов с однотонной окраской спины мы знаем из анализа фенотипов арестованных балобанов
Анализ размеров птенцов в выводках, а также определение пола молекулярно-генетическими методами показывает, что в регионах интенсивного лова, где в успешных парах размножаются преимущественно молодые самки, а большая часть участков абонируются одинокими самцами, птенцы в выводках в основном самки. В Западной же Монголии, где нет такого интенсивного пресса на соколов и практически на всех соседних участках размножаются старые птицы, а пустующих участков единицы, нет искажения полового состава выводков в сторону увеличения самок