Journal of Integrative Agriculture 2018, 17(0): 60345-7 Available online at www.sciencedirect.com ScienceDirect Short Communication Prevalence and characteristics of extended spectrum β-lactamaseproducing Escherichia coli from bovine mastitis cases in China YANG Feng, ZHANG Shi-dong, SHANG Xiao-fei, WANG Xu-rong, WANG Ling, YAN Zuo-ting, LI Hongsheng Lanzhou Institute of Husbandry and Pharmaceutical Sciences, Chinese Academy of Agricultural Sciences, Lanzhou 730050, P.R.China Abstract The aim of the study was to investigate the prevalence and characterization of extended-spectrum β-lactamase (ESBL)- producing Escherichia coli isolated from bovine mastitis cases in China. ChromID ESBL agar was used to confirm ESBL-producing E. coli. PCR and DNA sequencing were employed to characterize the genotype of ESBL-producers. Antimicrobial susceptibility was measured by disc diffusion. Overall, 73 of 318 E. coli isolates (22.96%) were identified as ESBL-producers. Of these ESBL-producing E. coli, the prevalence of bla CTX-M and bla TEM-1 was 97.26 and 71.23%, respectively. The predominant CTX-M-type ESBL was CTX-M-15 (65.75%), followed by CTX-M-14 (10.96%), CTX-M-55 (9.59%), CTX-M-64 (5.48%), CTX-M-65 (4.11%) and CTX-M-3 (1.37%). This study is the first report of CTX-M-64 and CTX-M-65 in E. coli isolated from bovine mastitis. Furthermore, 72 ESBL-producing E. coli isolates (98.63%) were found to be multidrug-resistance. This study noted high prevalence and rates of antimicrobial resistance of ESBL-producing E. coli isolates from bovine mastitis cases in China. Keywords: extended spectrum β-lactamase, Escherichia coli, multidrug-resistance, bovine mastitis 1.Introduction Bovine mastitis is one of the most prevalent and costly diseases of dairy industry worldwide. Mastitis can be caused by 137 different microorganisms, but Escherichia Received 4 September, 2017 Accepted 20 November, 2017 Correspondence YANG Feng, Tel: +86-931-2115262, Fax: +86-931-2114180, E-mail: yangfeng@caas.cn; LI Hong-sheng, Tel: +86-931-2164183, Fax: +86-931-2114180, E-mail: lihsheng@ sina.com 2018 CAAS. Publishing services by Elsevier B.V. All rights reserved. doi: 10.1016/S2095-3119(17)61830-6 coli is one of the primary pathogens causing bovine mastitis (Kempf et al. 2016; Yang et al. 2016). Antibiotic therapy is the mainstay of treatment for this disease. However, the results of this therapy have been disappointing in large part due to the resistance to most of the antimicrobial agents, especially the β-lactams and their derivatives (Metzger and Hogan 2013). Resistance to β-lactams in E. coli is mainly based on β-lactamases-mediated antibiotics hydrolysis. Bacteria harboring extended-spectrum β-lactamase (ESBL)- encoding genes can hydrolyze virtually all penicillins and cephalosporins (Hijazi et al. 2016). ESBL producers are usually multidrug-resistant (MDR) against non-β-lactam antibiotics, including fluoroquinolones, aminoglycosides, tetracyclines, sulfamethoxazole and chloramphenicol, which make the treatment difficult (Ho et al. 2007). The great
*** et al. Journal of Integrative Agriculture 2018, 17(0): 60345-7 3 majority of ESBLs belong to three types, including TEM, CTX-M, and SHV types (Li et al. 2014). The predominant genotype varied across different geographic regions. CTX-M β-lactamases was the most prevalent ESBLs in China, especially CTX-M-14 and CTX-M-15 (Zhao and Hu 2013; Liu et al. 2015; Ali et al. 2016). Recently, lines of studies have reported that the prevalence of ESBL-producing E. coli was increasing in food producing animals from many parts of the world (Li et al. 2014; Rao et al. 2014; Liu et al. 2015; Xu et al. 2015). The increasing ESBL-producing E. coli isolated from animal sources may pose a potential risk for public health because the isolates and resistance genes can be transferred to humans through the food chain (Kilani et al. 2015). The aim of this study was to investigate the prevalence and characterization of ESBL-producing E. coli from bovine mastitis cases in China. To the best of our knowledge, this study reports the largest screening of ESBL-producing E. coli causing bovine mastitis so far in China. 2. Materials and methods 2.1. Sample collection and bacterial isolates Mastitic milk samples of cows (n=2 897) were collected from 98 commercial dairy herds located in 19 provinces of China during August 2013 to April 2017 (Fig. 1, Table 1). Mastitis cases were confirmed by the California mastitis test (CMT). Samples were collected aseptically for the further bacteriological assay as previously described (Pitkälä et al. 2004). Isolation and identification of E. coli were performed by morphological characterization and biochemical testing (Cressier and Bissonnette 2011). 2.2. ESBL-producing E. coli identification ESBL-producing E. coli isolates were identified by ChromID ESBL agar (biomerieux, France) according to the manufacturer s recommendation. Each E. coli isolate was aerobically incubated on ChromID ESBL agar at 37 C for 18 to 24 h. Bacterial colonies show pink to burgundy color on the agar were confirmed as ESBL-producing E. coli strains. 2.3. DNA amplification and sequencing Bacterial DNA was extracted by the Bacterial DNA Kit (Omega Bio-Tek, USA) according to the manufacturer s recommendation. ESBL-encoding genes bla TEM, bla SHV and bla CTX-M were detected by PCR with the gene-specific primers as listed in Table 2. All of the PCR products were confirmed by bi-directionally sequencing after purified through a QIAquick PCR Purification Kit (Qiagen, Hilden, Germany). The DNA sequence obtained was compared with those in GenBank using the BLAST program (https:// blast.ncbi.nlm.nih.gov/blast.cgi). 2.4. Antimicrobial susceptibility testing ESBL-producing E. coli isolates were subjected to susceptibility testing against 17 antimicrobial agents by disc diffusion method according to the recommendations of CLSI (2015). The antibiotics (Oxoid, United Kingdom) tested were: ampicillin (10 µg), amoxicillin-clavulanic acid (20/10 µg), cefotaxime (30 µg), cefuroxime (30 µg), ceftazidime (30 µg), cefaclor (30 µg), cefpodoxime (10 µg), aztreonam (30 µg), imipenem (10 µg), meropenem (10 µg), streptomycin (10 µg), gentamicin (10 µg), tetracycline (30 µg), ciprofloxacin (5 µg), nalidixic acid (30 µg), trimethoprimsulfamethoxazol (1.25/23.75 µg) and chloramphenicol (30 µg). E. coli ATCC 25922 was used as a quality control strain. Isolates resistant to three or more antimicrobial categories were classified as multidrug-resistant (MDR) (Magiorakos et al. 2012). 3. Results 3.1. Bacterial isolates In this study, a total of 318 E. coli isolates (10.98%) were recovered from 2 897 mastitic milk samples from 19 provinces in China. Out of these isolates, 73 isolates (22.96%) were confirmed as ESBL-positive based on ChromID ESBL agar in 8 provinces (Fig. 1). Gansu Province showed the highest prevalence of ESBL producers (27.85%), followed by Shaanxi Province (27.27%), and Ningxia Hui Autonomous Region (26.87%) (Table 1). 3.2. Characterization of ESBL-producing E. coli According to the PCR and sequencing results (Fig. 2 and Appendix A), 97.26% ESBL-producing E. coli isolates (71/73) were bla CTX-M positive, including bla CTX-M-15 (65.75%, 48/73), bla CTX-M-14 (10.96%, 8/73), bla CTX-M-55 (9.59%, 7/73), bla CTX-M-64 (5.48%, 4/73), bla CTX-M-65 (4.11%, 3/73), and bla CTX-M-3 (1.37%, 1/73). Fifty-two isolates (71.23%) were positive for bla TEM-1. Furthermore, the bla TEM-1 and bla CTX-M were observed together in 68.49% E. coli isolates (50/73). Gene bla SHV was not detected in any of the isolates. 3.3. Antimicrobial susceptibility The β-lactam susceptibility profiles and the associated antimicrobial resistance of the ESBL-producing isolates were summarized in Table 3 and Appendix A. Overall, 72
4 *** et al. Journal of Integrative Agriculture 2018, 17(0): 60345-7 Fig. 1 Sampling regions (cities, provinces, and autonomous regions) in China involved in this study. Table 1 Prevalence of extended spectrum β-lactamase (ESBL)- producing Escherichia coli isolated from 19 regions (cities, provinces, and autonomous regions) in China Sampling region No. of milk samples No. of E. coli No. of ESBL producers Xinjiang 127 18 3 Gansu 636 79 22 Inner Mongolia 278 31 10 Ningxia 804 67 18 Heilongjiang 8 1 0 Liaoning 33 7 0 Henan 160 16 2 Hubei 15 3 0 Jiangxi 10 0 0 Guangdong 66 3 0 Sichuan 137 8 1 Chongqing 10 0 0 Shaanxi 276 44 12 Shanxi 30 6 0 Hebei 67 9 0 Yunnan 4 0 0 Beijing 42 3 0 Shandong 96 4 0 Qinghai 98 19 5 Total 2 897 318 (10.98%) 73 (22.96%) ESBL-producing E. coli isolates (98.63%) were found to be MDR. All isolates were resistant to ampicillin. The majority of isolates were resistant to cefotaxime (98.63%), cefaclor (98.63%), cefpodoxime (97.26%), cefuroxime (95.89%), amoxicillin-clavulanic (79.45), aztreonam (63.01%) and ceftazidime (52.05%). None of the tested isolates was resistant to carbapenems. Notably, 35 isolates (47.95%) were resistant to all tested penicillins, cephalosporins and monobactams. Besides the β-lactam resistance, the isolates were also tested for resistance to other antimicrobial categories. Resistance was most frequently observed against tetracycline (94.52%), followed by streptomycin (86.30%), nalidixic acid (83.56%), chloramphenicol (79.45%), trimethoprim-sulfamethoxazole (76.71%), gentamicin (75.34%), and ciprofloxacin (67.12%). 4. Discussion The prevalence of ESBL-producing E. coli among clinical isolates has increased dramatically in the past several years (Chandramohan and Revell 2012). In this study, 318 E. coli isolates were collected from bovine mastitis cases
*** et al. Journal of Integrative Agriculture 2018, 17(0): 60345-7 5 Table 2 Primers used in this study Genes Sequence (5 3 ) Annealing temp ( C) Size (bp) Reference bla TEM TTTCGTGTCGCCCTTATTCC 58 692 Bailey et al. (2011) CCGGCTCCAGATTTATCAGC bla SHV GGGTTATTCTTATTTGTCGC 58 567 Chang et al. (2001) TTA GCG TTG CCA GTG CTC bla CTX M ATGTGCAGYACCAGTAA 51 536 Amel et al. (2016) ACCGCRATATCRTTGGT Fig. 2 Distribution of extended-spectrum β-lactamases (ESBLs)-encoding genes and CTX-M subtypes from ESBLproducing Escherichia coli isolates (73) from bovine mastitis. in China during August 2013 to April 2017, the detection rate of ESBL producer was 22.96%, which was similar to previously study of bovine mastitis E. coli in China (Ali et al. 2016), but much higher than the data from other countries (Geser et al. 2012; Dahmen et al. 2013; Ohnishi et al. 2013; Freitag et al. 2016). Interestingly, the majority of ESBL producers were distributed in underdeveloped provinces in northern China. In these regions, antibiotics abuse may be unavoidable under the situation of high mastitis incidences due to poorly planned dairy infrastructures, sub-optimal housing hygiene and lacking knowledge and skills among the producers (Kivaria et al. 2007). Besides, the use of extended-spectrum cephalosporins in animals should be the primary driving force for the spread of ESBLs (Kilani et al. 2015). Therefore, we should pay great attention to the problem and try to make appropriate prevention and treatment strategies. Recently, studies have reported that CTX-M-type ESBLs replaced TEM- and SHV-type ESBLs in Asia, Europe, and Canada as the most frequent ESBL type among Enterobacteriaceae (Chandramohan and Revell 2012). Our results also confirmed that the bla CTX-M was the predominant ESBL gene, followed by bla TEM. This is consistent with other reports from China and other countries that revealed CTX-M was the most prevalent ESBL in E. coli from bovine mastitis (Freitag et al. 2016; Pehlivanoglu et al. 2016). Besides, our results are in accord with previous studies and confirm that CTX-M-15 is the most common CTX-M subtype among bovine mastitis E. coli in China (Yu et al. 2015; Ali et al. 2016). The same situation is also observed in Japan (Ohnishi et al. 2013) and Korea (Tark et al. 2017). These results illustrating the large spread of CTX-M-15-producing E. coli from bovine mastitis in the east Asia countries. Table 3 Resistance patterns of extended spectrum β-lactamase (ESBL)-producing Escherichia coli isolates (73) from bovine mastitis Antibiotics Susceptible (number/%) Intermediate (number/%) Resistance (number/%) Ampicillin 0/0 0/0 100/100 Amoxicillin-clavulanic acid 12/16.44 3/4.11 58/79.45 Cefotaxime 0/0 1/1.37 72/98.63 Cefuroxime 1/1.37 2/2.74 70/95.29 Ceftazidime 24/32.88 11/15.07 38/52.05 Cefaclor 0/0 1/1.37 72/98.63 Cefpodoxime 2/2.74 0/0 71/97.26 Aztreonam 11/15.07 16/21.92 46/63.01 Imipenem 100/100 0/0.00 0/0 Meropenem 100/100 0/0.00 0/0 Gentamicin 16/21.92 2/2.74 55/75.34 Streptomycin 8/10.96 2/2.74 63/86.30 Tetracycline 4/5.48 0/0 69/94.52 Ciprofloxacin 24/32.88 0/0 49/67.12 Nalidixic acid 11/15.07 1/1.37 61/83.56 Trimethoprim-sulfamethoxazole 14/19.18 3/4.11 56/76.71 Chloramphenicol 16/21.92 0/0 58/79.45
6 *** et al. Journal of Integrative Agriculture 2018, 17(0): 60345-7 Moreover, the CTX-M-64 and CTX-M-65 producers also detected in our study, which had never been reported to date among E. coli isolates from bovine mastitis. Although antibiotics like imipenem, meropenem, ciprofloxacin, and chloramphenicol are banned to use in food animals, some farmers are still use these antibiotics to treat or prevent infection, especially to promote animal growth in practice. It is necessary to test their antimicrobial susceptibility which can provide scientific data for the government and guide the veterinarian to select the most appropriate antimicrobial agent (Hilary et al. 2016). Nowadays, resistance to β-lactam among Gram-negative bacteria from food producing animals is increasing at an alarming rate (Geser et al. 2012). The susceptibility test data in our study showed that 98.63% of ESBL-producing E. coli isolates were MDR. ESBL producers which were resistant to most β-lactams were high frequently resistant to the non-β-lactam antibiotics such as aminoglycosides and tetracycline. This is consistent with other reports from China that most ESBLs producers from food animals were MDR (Li et al. 2014; Yu et al. 2015; Ali et al. 2016). MDR is on the rise and pose a serious threat to society because these isolates might enter the food chain. Therefore, we should avoid antibiotics abuse and misuse in clinical treatment, reducing opportunities for emergence of ESBLs. 5. Conclusion This study revealed high prevalence and multidrug-resistant rate of ESBL-producing E. coli isolates from bovine mastitis cases in China. CTX-M type β-lactamases were the predominant ESBLs produced by E. coli, particularly CTX-M-15. To the best of our knowledge, this is the first report of CTX-M-64 and CTX-M-65 ESBLs in E. coli causing bovine mastitis. Acknowledgements This work was funded by the National Key R&D Program of China (2017YFD0502200) and the Central Public-Interest Scientific Institution Basal Research Fund (1610322017013). Appendix associated with this paper can be available on http://www.chinaagrisci.com/v2/en/appendix.htm References Ali T, Ur R S, Zhang L, Shahid M, Zhang S, Liu G, Gao J, Han B. 2016. ESBL-producing Escherichia coli from cows suffering mastitis in China contain clinical class 1 integrons with CTX-M linked to ISCR1. Frontiers in Microbiology, 7, doi: 10.3389/fmicb.2016.01931 Amel A, Mourad D, Claire D C, Chloé D, Alain H, Sébastien S, Eliane S, Lucie A, Catherine N. 2016. Occurence of arma and rmtb aminoglycoside resistance 16S rrna methylases in extended-spectrum β-lactamases producing Escherichia coli in Algerian hospitals. Frontiers in Microbiology, 7, doi: 10.3389/fmicb.2016.01409 Bailey J K, Pinyon J L, Anantham S, Hall R M. 2011. Distribution of the blatem gene and blatem-containing transposons in commensal Escherichia coli. Journal of Antimicrobial Chemotherapy, 66, 745 751. Chandramohan L, Revell P A. 2012. Prevalence and molecular characterization of extended-spectrum-β-lactamaseproducing Enterobacteriaceae in a pediatric patient population. Antimicrobial Agents & Chemotherapy, 56, 4765 4770. Chang F Y, Siu L K, Fung C P, Huang M H, Ho M. 2001. Diversity of SHV and TEM beta-lactamases in Klebsiella pneumoniae: Gene evolution in Northern Taiwan and two novel beta-lactamases, SHV-25 and SHV-26. Antimicrobial Agents & Chemotherapy, 45, 2407 2413. CLSL (Clinical and Laboratory Standards Institute). 2015. Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Fifth Informational Supplement. M100 S25. CLSI, Wayne, PA. Cressier B, Bissonnette N. 2011. Assessment of an extraction protocol to detect the major mastitis-causing pathogens in bovine milk. Journal of Dairy Science, 94, 2171 2184. Dahmen S, Métayer V, Gay E, Madec J Y, Haenni M. 2013. Characterization of extended-spectrum beta-lactamase (ESBL)-carrying plasmids and clones of Enterobacteriaceae causing cattle mastitis in France. Veterinary Microbiology, 162, 793 799. Freitag C, Michael G B, Kadlec K, Hassel M, Schwarz S. 2016. Detection of plasmid-borne extended-spectrum β-lactamase (ESBL) genes in Escherichia coli isolates from bovine mastitis. Veterinary Microbiology, 200, 151 156. Geser N, Stephan R, Hächler H. 2012. Occurrence and characteristics of extended-spectrum β-lactamase (ESBL) producing Enterobacteriaceae in food producing animals, minced meat and raw milk. BMC Veterinary Research, 8, 21. Hijazi S M, Fawzi M A, Ali F M, Abd El Galil K H. 2016. Prevalence and characterization of extended-spectrum beta-lactamases producing Enterobacteriaceae in healthy children and associated risk factors. Annals of Clinical Microbiology & Antimicrobials, 15, doi: 10.1186/s12941-016-0121-9 Hilary D, Dennis M, Jane M, Tara N, Anthony S. 2016. Special communication: Antimicrobial resistance. Journal of the American Medical Association, 316, 1193 1204. Ho P L, Poon W W, Loke S L, Leung M S, Chow K H, Wong R C, Yip K S, Lai E L, Tsang K W. 2007. Community emergence of CTX-M type extended-spectrum beta-lactamases among urinary Escherichia coli from women. Journal of Antimicrobial Chemotherapy, 60, 140 144. Kempf F, Slugocki C, Blum S E, Leitner G, Germon P. 2016. Genomic comparative study of bovine mastitis Escherichia
*** et al. Journal of Integrative Agriculture 2018, 17(0): 60345-7 7 coli. PLoS ONE, 11, e0147954. Kilani H, Abbassi M S, Ferjani S, Mansouri R, Sghaier S, Ben S R, Jaouani I, Douja G, Brahim S, Hammami S, Ben Chehida N, Boubaker I B. 2015. Occurrence of bla CTX-M-1, qnrb1 and virulence genes in avian ESBL-producing Escherichia coli isolates from Tunisia. Frontiers in Cellular & Infection Microbiology, 5, doi: 10.3389/fcimb.2015.00038 Kivaria F M, Noordhuizen J P, Msami H M. 2007. Risk factors associated with the incidence rate of clinical mastitis in smallholder dairy cows in the Dar es Salaam region of Tanzania. Veterinary Journal, 173, 623 629. Li L, Wang B, Feng S, Li J, Wu C, Wang Y, Ruan X, Zeng M. 2014. Prevalence and characteristics of extended-spectrum β-lactamase and plasmid-mediated fluoroquinolone resistance genes in Escherichia coli isolated from chickens in Anhui province, China. PLoS ONE, 9, e104356. Liu H, Wang Y, Wang G, Xing Q, Shao L, Dong X, Sai L, Liu Y, Ma L. 2015. The prevalence of Escherichia coli strains with extended spectrum beta-lactamases isolated in China. Frontiers in Microbiology, 6, doi: 10.3389/fmicb.2015.00335 Magiorakos A P, Srinivasan A, Carey R B, Carmeli Y, Falagas M E, Giske C G, Harbarth S, Hindler J F, Kahlmeter G, Olsson-Liljequist B, Paterson D L, Rice L B, Stelling J, Struelens M J, Vatopoulos A, Weber J T, Monnet D L. 2012. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clinical Microbiology & Infection, 18, 268 281. Metzger S A, Hogan J S. 2013. Short communication: Antimicrobial susceptibility and frequency of resistance genes in Escherichia coli isolated from bovine mastitis. Journal of Dairy Science, 96, 3044 3049. Ohnishi M, Okatani A T, Harada K, Sawada T, Marumo K, Murakami M, Sato R, Esaki H, Shimura K, Kato H, Uchida N, Takahashi T. 2013. Genetic characteristics of CTX-Mtype extended-spectrum-β-lactamase (ESBL)-producing Enterobacteriaceae involved in mastitis cases on Japanese dairy farms, 2007 to 2011. Journal of Clinical Microbiology, 51, 3117 3122. Pehlivanoglu F, Turutoglu H, Ozturk D. 2016. CTX-M-15-type extended-spectrum beta-lactamase-producing Escherichia coli as causative agent of bovine mastitis. Foodborne Pathogens & Disease, 13, 477 482. Pitkälä A, Haveri M, Pyörälä S, Myllys V, Honkanen-Buzalski T. 2004. Bovine mastitis in Finland 2001-prevalence, distribution of bacteria, and antimicrobial resistance. Journal of Dairy Science, 87, 2433 2441. Rao L, Lv L, Zeng Z, Chen S, He D, Chen X, Wu C, Wang Y, Yang T, Wu P, Liu Y, Liu J H. 2014. Increasing prevalence of extended-spectrum cephalosporin-resistant Escherichia coli in food animals and the diversity of CTX-M genotypes during 2003 2012. Veterinary Microbiology, 172, 534 541. Tark D S, Moon D C, Kang H Y, Kim S R, Nam H M, Lee H S, Jung S C, Lim S K. 2017. Antimicrobial susceptibility and characterization of extended-spectrum β-lactamases in Escherichia coli isolated from bovine mastitic milk in South Korea from 2012 to 2015. Journal of Dairy Science, 100, 3463 3469. Xu G, An W, Wang H, Zhang X. 2015. Prevalence and characteristics of extended-spectrum β-lactamase genes in Escherichia coli isolated from piglets with post-weaning diarrhea in Heilongjiang province, China. Frontiers in Microbiology, 6, doi: 10.3389/fmicb.2015.01103 Yang F, Liu L H, Li X P, Luo J Y, Zhang Z, Yan Z T, Li H S. 2016. Short communication: N-acetylcysteine-mediated modulation of antibiotic susceptibility of bovine mastitis pathogens. Journal of Dairy Science, 99, 4300 4302. Yu T, He T, Yao H, Zhang J B, Li X N, Zhang R M, Wang G Q. 2015. Prevalence of 16S rrna methylase gene rmtb among Escherichia coli isolated from bovine mastitis in Ningxia, China. Foodborne Pathogens & Disease, 12, 770 777. Zhao W H, Hu Z Q. 2013. Epidemiology and genetics of CTX-M extended-spectrum β-lactamases in Gram-negative bacteria. Critical Reviews in Microbiology, 39, 79 101. Section editor CHEN Hua-lan Managing editor ZHANG Juan