Giardia duodenalis in calves from an isolated farm from northwestern Romania

Giardia duodenalis in calves from an isolated farm from northwestern Romania Diana Onac 1, Adriana Jarca 2, Zsuzsa Kalmar 1, Vasile Cozma 1 1 University of Agricultural Sciences and Veterinary Medicine Cluj-Napoca, Faculty of Veterinary Medicine, Department of Parasitology and Parasitic Diseases, Cluj-Napoca 400372, Romania. 2 2nd Medical Department, University of Medicine and Pharmacy Iuliu Haţieganu, Victor Babeş Street no. 8, Cluj- Napoca, Romania. Correspondence: Tel. +40264-596384, Fax+40264-593792, E-mail dianaonac@yahoo.com Abstract. Giardia is considered one of the most prevalent zoonotic parasite in humans and animals worldwide. Based on high prevalence of Giardia duodenalis, cattle have been considered as potential sources for human infection. This study was conducted in order to identify Giardia assemblages in calves from one isolated farm from north-western Romania. For this purpose, 28 faecal samples from calves with diarrhea were collected. Samples were used for flotation exam and for DNA extraction. Positive samples in npcr reaction were sequenced, targeting β-giardin gene. 10.7% were positive in coproparasitological examination and 7.1% of the samples tested positive for n-pcr reaction. The sequence analysis of β-giardin locus was obtained for both samples which were identified as assemblage A, respectively one as subassemblage AII and one as subassemblage A3. The results of this study demonstrated the importance of cattle which can be considered as potential sources for human infection. Keywords: Calves; Giardia duodenalis; Assemblages; Romania. Received 10/08/2015. Accepted 13/09/2015. Introduction Giardia sp. is one of the most common intestinal parasites of humans; about 200 million people in Asia, Africa, and Latin America have symptomatic infections (Yason and Rivera, 2007). In children chronic giardiosis can result in long-term growth retardation (Fraser et al., 2000). Is a frequently diagnosed waterborne infection and a major concern to water utilities. Because of the impact on socio-economic development, especially in developing countries, Giardia is since 2004 included in the Neglected Disease Initiative of the World Health Organization (WHO) (Savioli et al., 2006). Giardia is also a very common enteric parasite of domestic animals, including livestock, dogs, and cats (Thompson, 2004; Thompson and Monis, 2004), and wildlife (Appelbee et al., 2005). To date eight major genetic groups 133

(assemblages) have been identified, two of which (A and B) are found in both humans and animals, whereas the other six (C to H) are host-specific and do not infect humans (Feng and Xiao, 2011). One species within this genus, Giardia duodenalis (syn. Giardia lamblia and Giardia intestinalis), causes giardiasis in humans and most mammals. Thus, giardiasis is considered a zoonotic disease (Feng and Xiao, 2011). In housed calves, Giardia is at present considered as important pathogens in the etiology of diarrhea. Based on high prevalence of Giardia duodenalis, cattle have been considered as potential sources for human infection, although in the last decade molecular tools have provided a more detailed map in the epidemiology of Giardia. Materials and methods Between June July 2014, 28 faecal samples were collected from calves originated from one farm from North-Western Romania. Faecal samples were collected from all the calves from the farm until 8 month old, animals which suffered of diarrhea. We registered for each calves the age and gender. For all 28 faecal samples it was performed the flotation method for identifying the Giardia cysts and then the samples were kept at -20 C until extraction of the DNA. Total DNA extraction was performed with a commercial kit (Isolate Fecal DNA Kit, Bioline, UK), according to manufacturer s indications using 25 mg of faeces/sample. Total DNA extracts were preserved at -20 C until amplification. The amplification of β-giardin gene was performed using a nested-pcr protocol (Cacciò et al., 2002; Lalle et al., 2005). In the first PCR reaction it was obtained a 753bp fragment using the primers pair G7-G759. PCR mix consisted in 10µM of each primers, 12.5µl of MasterMix (Rovalab GMBH, Germany) and 4µl of DNA in a total volume of 25µl. PCR conditions were: initial denaturation for 5 min at 96 C, a set of 40 cycles of annealing (30 sec at 95 C, 30 sec at 50 C and 1 min at 72 C) followed by a final extension of 7 min at 72 C. In the second PCR reaction it was obtained a 511bp fragment using the primers pair GiarF- GiarR. The PCR mix consisted in 10µM of each primers, 25µl of MasterMix (Rovalab GMBH, Germany), 4µl of DNA in a total volume of 50µl. PCR conditions were: initial denaturation for 5 min at 96 C, a set of 35 cycles of annealing (45 sec at 95 C, 30 sec at 55 C and 45 sec at 72 C) followed by a final extension of 7 min at 72 C (table 1). PCR products were subsequently sequenced (MACROGEN, Amsterdam, Netherlands). Table 1. Primers used for the molecular characteristation of Giardia isolates Forward (5-3) Reverse (5-3) G7 - AAGCCCGACGACCTCACCCGCAGTGC GiarF - GAACGAACGAGATCGAGGTCCG G759 - GAGGCCGCCCTGGATCTTCGAGAC GAC GiarR - CTCGACGAGCTTCGTGTT Results In coproparasitological examination, 3 (10.7%) out of 28 samples were observed Giardia spp. cysts. The amplification of all 28 samples from calves yielded the expected 511bp fragment of β-giardin gene for 2 sample (7.1%). One of the samples was positive also in coproparasitological examination. The comparison with G. duodenalis sequences available in GenBankTM revealed that one sample was 100% identical with the isolate KT235953 which corresponds to the assemblage AII and the second one was 95% identical with the isolate FJ472821 correspondent to assemblage A3. Discussions High prevalence of Giardia have been reported in farm animals, such as cattle, sheep and goats (Xiao, 1994; Ryan et al., 2005; Bomfim et al., 2005). 134

For cattle, the infection rate of Giardia duodenalis varied markedly in different studies, being 17.4% to 31.3% in Belgium (Geurden et al., 2004, 2008), 43.6% in Denmark (Langkjaer et al., 2007; Maddox-Hyttel et al., 2006), up to 38.0% in Germany (Jager et al., 2005), 30.0% in Italy (Berrilli et al., 2004), 49.0% in Norway (Hamnes et al., 2006), 2.2 to 14.0% in Poland (Bajer, 2008), 9.0% in Portugal (Mendonca et al., 2007), 26.6 to 30.1% in Spain (Castro- Hermida et al., 2006, 2007), up to 57.0% in Canada (Coklin et al., 2007; Gow and Waldner, 2006), up to 52.0% in the United States (Hoar et al., 2009; Trout et al., 2004, 2005, 2006, 2007), 58.0% in Australia (O Handley et al., 2000), and up to 40.6% in New Zealand (Moriarty et al., 2008; Winkworth et al., 2008; Feng and Xiao, 2011). In cattle the livestock specific assemblage E is most prevalent, although up to 20% zoonotic assemblage A isolates have been reported, either in pre-weaned calves (O'Handley et al., 2000; Appelbee et al., 2003; Becher et al., 2004; Berrilli et al., 2004; Trout et al., 2004; Itagaki et al., 2005), postweaned calves (Trout et al., 2005), or adult cattle (Trout et al., 2006; Uehlinger et al., 2006). There are only a few studies of subtypes of G. duodenalis in cattle, and subassemblage AI was found to be the major subassemblage. In one study conducted in Europe, among 113 samples tested, 70 belonged to subassemblage AI, 39 belonged to subassemblage AII, and 4 belonged to subassemblage AIII (Feng and Xiao, 2011; Sprong et al., 2009). Similar to the present study, a wide distribution of assemblage A among farms was also reported in the United States (Trout et al., 2004). Contrary to previous reports (Lalle et al., 2005; Van Keulen et al., 2002), assemblage B was not found in the present study. Moreover, the occurrence of assemblage A infections in clinically affected calves seems to suggest that infections with assemblage A are not only transient infections (Caccio et al., 2005), but contribute to the development of clinical giardiasis in calves as in the present research where all the calves take in study were with diarrhea. The presence only of the zoonotic Giardia assemblage A in calves in an isolated farm in Romania might be due to the proximity of intensified livestock industry to human activity, facilitating interaction between the human and livestock transmission cycle. Acknowledgments This paper was financed under the frame of European Social Fund, Human Resources Development Operational Programme 2007-2013, project no. POSDRU/159/1.5/S/136893. References Appelbee A.J., Frederick L.M., Heitman T.L., Olson M.E. 2003. Prevalence and genotyping of Giardia duodenalis from beef calves in Alberta, Canada. Vet. Parasitol. 112:289-294. Appelbee A.J., Thompson R.C., Olson M.E. 2005. Giardia and Cryptosporidium in mammalian wildlife current status and future needs. Trends Parasitol. 21:370-376. Bajer A. 2008. Cryptosporidium and Giardia spp. infections in humans, animals and the environment in Poland. Parasitol. Res. 104:1-17. Becher K.A., Robertson I.D., Fraser D.M., Palmer D.G., Thompson R.C. 2004. Molecular epidemiology of Giardia and Cryptosporidium infections in dairy calves originating from three sources in Western Australia. Vet. Parasitol. 123:1-9. Berrilli F., Di Cave D., De Liberato C., Franco A., Scaramozzino P., Orecchia P. 2004. Genotype characterisation of Giardia duodenalis isolates from domestic and farm animals by SSU-rRNA gene sequencing. Vet. Parasitol. 122:193-199. Bomfim T.C., Huber F., Gomes R.S., Alves L.L. 2005. Natural infection by Giardia sp. and Cryptosporidium sp. in dairy goats, associated with possible risk factors of the studied properties. Vet. Parasitol. 134:9-13. Cacciò S.M., De Giacomo M., Pozio E. 2002. Sequence analysis of the β-giardin gene and development of a polymerase chain reaction restriction fragment length polymorphism assay to genotype Giardia duodenalis cysts from human faecal samples. Int. J. Parasitol. 32(8):1023-1030. Caccio S.M., Thompson R.C., McLauchlin J., Smith H.V. 2005. Unravelling Cryptosporidium and Giardia epidemiology. Trends Parasitol. 21:430-437. Castro-Hermida J.A., Carro-Corral C., Gonzalez- Warleta M., Mezo M. 2006. Prevalence and intensity of infection of Cryptosporidium spp. 135

and Giardia duodenalis in dairy cattle in Galicia (NW Spain). J. Vet. Med. B 53:244-246. Castro-Hermida J.A., Almeida A., Gonzalez-Warleta M., Correia da Costa J.M., Rumbo-Lorenzo C., Mezo M. 2007. Occurrence of Cryptosporidium parvum and Giardia duodenalis in healthy adult domestic ruminants. Parasitol. Res. 101:1443-1448. Coklin T., Farber J., Parrington L., Dixon B. 2007. Prevalence and molecular characterization of Giardia duodenalis and Cryptosporidium spp. in dairy cattle in Ontario, Canada. Vet. Parasitol. 150:297-305. Feng Y., Xiao L. 2011. Zoonotic potential and molecular epidemiology of Giardia species and giardiasis. Clin. Microbiol. Rev. 24(1):110-140. Fraser D., Bilenko N., Deckelbaum R.J., Dagan R., El- On J., Naggan L. 2000. Giardia lamblia carriage in Israeli Bedouin infants: risk factors and consequences. Clin. Infect. Dis. 30:419-424. Geurden T., Claerebout E., Vercruysse J., Berkvens D. 2004. Estimation of diagnostic test characteristics and prevalence of Giardia duodenalis in dairy calves in Belgium using a Bayesian approach. Int. J. Parasitol. 34:1121-1127. Geurden T., Geldhof P., Levecke B., Martens C., Berkvens D., Casaert S., Vercruysse J., Claerebout E. 2008. Mixed Giardia duodenalis assemblage A and E infections in calves. Int. J. Parasitol. 38:259-264. Gow S., Waldner C. 2006. An examination of the prevalence of and risk factors for shedding of Cryptosporidium spp. and Giardia spp. in cows and calves from western Canadian cow-calf herds. Vet. Parasitol. 137:50-61. Hamnes I.S., Gjerde B., Robertson L. 2006. Prevalence of Giardia and Cryptosporidium in dairy calves in three areas of Norway. Vet. Parasitol. 140:204-216. Hoar B.R., Paul R.R., Siembieda J., Pereira M.G., Atwill E.R. 2009. Giardia duodenalis in feedlot cattle from the central and western United States. BMC Vet. Res. 5:37. Itagaki T., Kinoshita S., Aoki M., Itoh N., Saeki H., Sato N., Uetsuki J., Izumiyama S., Yagita K., Endo T. 2005. Genotyping of Giardia intestinalis from domestic and wild animals in Japan using glutamete dehydrogenase gene sequencing. Vet. Parasitol. 133:283-287. Jager M., Gauly M., Bauer C., Failing K., Erhardt G., Zahner H. 2005. Endoparasites in calves of beef cattle herds: management systems dependent and genetic influences. Vet. Parasitol. 131:173-191. Lalle M., Pozio E., Capelli G., Bruschi F., Crotti D., Caccio S.M. 2005. Genetic heterogeneity at the beta-giardin locus among human and animal isolates of Giardia duodenalis and identification of potentially zoonotic subgenotypes. Int. J. Parasitol. 35:207-213. Langkjaer R.B., Vigre H., Enemark H.L., Maddox- Hyttel C. 2007. Molecular and phylogenetic characterization of Cryptosporidium and Giardia from pigs and cattle in Denmark. Parasitology 134:339-350. Maddox-Hyttel C., Langkjaer R.B., Enemark H.L., Vigre H. 2006. Cryptosporidium and Giardia in different age groups of Danish cattle and pigs occurrence and management associated risk factors. Vet. Parasitol. 141:48-59. Mendonca C., Almeida A., Castro A., de Lurdes Delgado M., Soares S., da Costa J.M., Canada N. 2007. Molecular characterization of Cryptosporidium and Giardia isolates from cattle from Portugal. Vet. Parasitol. 147:47-50. Moriarty E.M., Sinton L.W., Mackenzie M.L., Karki N., Wood D.R. 2008. A survey of enteric bacteria and protozoans in fresh bovine faeces on New Zealand dairy farms. J. Appl. Microbiol. 105:2015-2025. O Handley R.M., Olson M.E., Fraser D., Adams P., Thompson R.C. 2000. Prevalence and genotypic characterisation of Giardia in dairy calves from Western Australia and Western Canada. Vet. Parasitol. 90:193-200. Ryan U.M., Bath C., Robertson I., Read C., Elliot A., McInnes L., Traub R., Besier B. 2005. Sheep may not be an important zoonotic reservoir for Cryptosporidium and Giardia parasites. Appl. Environ. Microbiol. 71:4992-4997. Savioli L., Smith H., Thompson A. 2006. Giardia and Cryptosporidium join the 'Neglected Diseases Initiative'. Trends Parasitol. 22:203-208. Sprong H., Caccio S.M., van der Giessen J.W. 2009. Identification of zoonotic genotypes of Giardia duodenalis. PLoS Negl. Trop. Dis. 3:e558. Thompson R.C. 2004. The zoonotic significance and molecular epidemiology of Giardia and giardiasis. Vet. Parasitol. 126:15-35. Thompson R.C., Monis P.T. 2004. Variation in Giardia: implications for taxonomy and epidemiology. Adv. Parasitol. 58:69-137. Trout J.M., Santin M., Greiner E.C., Fayer R. 2004. Prevalence of Giardia duodenalis genotypes in pre-weaned dairy calves. Vet. Parasitol. 124:179-186. 273. Trout J.M., Santin M., Greiner E.C., Fayer R. 2005. Prevalence and genotypes of Giardia duodenalis in post-weaned dairy calves. Vet. Parasitol. 130:177-183. 272. Trout J.M., Santin M., Greiner E.C., Fayer R. 2006. Prevalence and genotypes of Giardia duodenalis in 1-2 year old dairy cattle. Vet. Parasitol. 140:217-222. Trout J.M., Santin M., Fayer R. 2007. Prevalence of Giardia duodenalis genotypes in adult dairy cows. Vet. Parasitol. 147:205-209. 271. 136

Uehlinger F.D., Barkema H.W., Dixon B.R., Coklin T., O'Handley R.M. 2006. Giardia duodenalis and Cryptosporidium spp. in a veterinary college bovine teaching herd. Vet. Parasitol. 142:213-237. Van Keulen H., Macechko P.T., Wade S., Schaaf S., Wallis P.M., Erlandsen S.L. 2002. Presence of human Giardia in domestic, farm and wild animals, and environmental samples suggests a zoonotic potential for giardiosis. Vet. Parasitol. 108:97-107. Winkworth C.L., Matthaei C.D, Townsend C.R. 2008. Prevalence of Giardia and Cryptosporidium spp. in calves from a region in New Zealand experiencing intensification of dairying. N. Z. Vet. J. 56:15-20. Xiao L. 1994. Giardia infection in farm animals. Parasitol. Today 10:436-438. Yason J.A., Rivera W.L. 2007. Genotyping of Giardia duodenalis isolates among residents of slum area in Manila, Philippines. Parasitol. Res. 101:681-687. 137