Epidemiological survey and pathological studies on Caprine arthritis-encephalitis (CAE) in Japan Misako KONISHI 1), Makoto HARITANI 2), Kumiko KIMURA 2), Takamitsu TSUBOI 3), Hiroshi SENTSUI 4) & Kenji MURAKAMI 1) Caprine arthritis-encephalitis, CAE CAECAEV 1 2 3 4 Corresponding author; Mailing address: Research Team for Viral Diseases, National Institute of Animal Health, 3-1-5 Kannonndai, Tsukuba, Ibaraki 305-0856 Japan Tel: +81-298-38-7841. Fax: +81-298-38-7844 E-mail: muraken@affrc.go.jp 1020 CAE 2002 CAEV CAE CAE CAE CAE 113, 23-30191
CAE 110 7 cell/ml Fetal lamb lung cellfll FLLEagle s MEM10FLL 3 1 1 1AGID OIE CAEVMaedi virusmvvisna virusvvfll AGID 2PCR DNA DNACAEVgag nested PCR 1-1, 2PCR CAEV FLLDNA 3IFA CAEFLL3 CAEV FITCIgG IFA first PCR Forward Reverse second PCR Forward Reverse 1-1PCR 5 3 CAAGACGCAGGAGGGAGAAGCTG TCCTACCCCCATAATTTGATCCAC GTTCCAGCAACTGCAAACAGTAGCAATG ACCTTTCTGCTTCTTCATTTAATTTCCC 953-975 1249-1226 997-1024 1181-1154 1-2PCR 94 94 55 72 72 5 30 30 90 5 1 34 1 Bull. Natl. Inst. Anim. Health No. 113. 23-30 (January 2007)
CAEVFLL 110 5 cell/ml3mlcaev 3 113157 1AGID PCR 2002820053 3,255 MVAGID 20028200411 720 DNAPCR 2FLL A BIFACAEV 1 CAE CAEV 23 2 CAE 28 11 1AGID FLL CAEV 2ACAEV 2B C 3 AGID 4 3CAEV FLL C Bar=100nm PS AG 13 4 AGID 2PCR DNAnested PCR first PCR296bpsecond PCR184bp5second PCR CAEVMV 95.183.6 DNAPCR 113, 23-30191
6A 6B 68.250.046.2 42.97 5PCR M 1,6WBC 2,7WBC FLL 3,8Maedi virusfll 4,9Visna virusfll 5,10FLL 3 CAEV3 7PCR17AGID 2CAEV 6CAE A B 4CAEV 3,255 71421.9PCR 72029841.4PCR 720AGIDPCR2 1 CAEV23 2 PCR 1) 90 3) 56 AGID 2) 208 366 1) PCRCAEV 2) 3) 7 2 28 11 CAE 80.8%8A CAE 17.98B3 1 CAEV 4 Bull. Natl. Inst. Anim. Health No. 113. 23-30 (January 2007)
CAECAE 2002 CAE CAEVOIE MVAGID AGIDMVVV MVVV CAE CAEV AGIDPCRIFA CAEAGID PCRnested CAE 113, 23-30191 8CAE A B 3 1) 2) / 2) 1 80.821/26 41.710/24 17.9 5/28 35.710/28 78.622/28 4 2) 1 No. No.1 No.2 No.3 No.4 No.5 No.6 No.7 No.8 No.9 No.10 No.11 1) 2)
4CAE CAEVFLL DNAPCR FLL CAEV FLL CAEV CAEV3 2CAE AGIDPCR ELISArealtime PCR in situ hybridization CAE CAE 23.8 80%CAEV CAEV CAE CAEV CAE CAEV CAEV in situ hybridization CAEVPCR CAE AGID PCRCAEV CAE 20028 Caprine arthritis-encephalitis, CAE OIE AGIDPCR CAE CAEV AGID 3,255 71421.9 CAEV CAE Bull. Natl. Inst. Anim. Health No. 113. 23-30 (January 2007)
Maedi virusvisna virus AGID Dr. D. P. Knowles, Jr. (Animal Disease Research Unit, USDA) 2. 2003. 135, p. 75. 3. 2003.136, p. 132. 4 Konishi et al. 2003.38th US-Japan Cooperative Program in Natural Resources Panel of Animal and Avian Health Meeting p. 13. 5Konishi et al. 2004. An epidemic of Caprine Arthritis Encephalitis in Japan: Isolation of the Virus. J. Vet. Med. Sci. 66(8): 911-917. 1. 2003. 135, p. 123. 113, 23-30191
Summary Epidemiological survey and pathological studies on Caprine arthritis-encephalitis (CAE) in Japan Caprine arthritis-encephalitis (CAE) is a disease of domestic goats caused by a lentivirus of the family Retroviridae. Since Japan has been assumed to be free from the disease, there has neither been information about it nor diagnostic methods for it so far. A disease characterized by arthritis of carpal joints and occasionally by pneumonia was seen among goats on a farm in Nagano prefecture of Japan in the summer of 2002. For the purpose of CAE detection, we developed an agar gel immunodiffusion (AGID) test using maedi-visna virus as the antigen according to the manual of standards for diagnostic tests and vaccines of the Office International de Epizootic (OIE). We also developed polymerase chain reaction (PCR) method, syncytium assay, and indirect immunofluorescence tests for CAEV. Serological investigation of CAEV was performed with 3,255 serum samples from goats in various parts of Japan. Seven hundred [and] fourteen goats were positive for the antibody to CAEV; the rate of positive reactors was 21.9%. Sixty-two Shiba goats, which were Japanese indigenous species and antibody positive to CAEV, were also investigated pathologically. The CAE specific findings in histopathology were observed in the carpal joint (68.2% of goats), tarsal joint (50.0% of goats) and metacarpopharangeal joint (50.0% of goats). Moreover, nonsuppurative mastitis (80.0% of goats) and interstitial pneumonia (17.9% of goats) were also observed. These results suggested that CAEV-infected goats have been prevalent in parts of Japan and also suggested that, in addition to a milk-borne infection, the droplet infection may be the important route for horizontal transmission of CAEV in Shiba goats. Bull. Natl. Inst. Anim. Health No. 113. 23-30 (January 2007)