Tatiana Baranovich Tatsuo YAMAMOTO Tomomi TAKANO Wataru HIGUCHI Akihito NISHIYAMA MRSA1961 MRSA hospital-acquired MRSA HA-MRSA 1980 1990 MRSA MRSA MRSA The prevalence of MRSA ranges from 0.6 in The Netherlands to 66.6 in JapanDeurenberg 2007 MRSA MRSA 1997 1999 MRSA 1 3 MRSA MRSA MRSA community-acquired MRSA CA -MRSA 2 MRSA ST CC spa agr SCC mec SE MIC ST multilocus sequence type 7 housekeeping MRSA website ST CC ST founder MRSA ST30 MRSA MRSA PFGE SCCmec meca DNA DNA methicillin-susceptible S. aureus MSSA SCCmec MRSA SCCmec I V I 39.3 kbii 58.2 kbiii 23.8-30.1 kb MSSA MRSA MRSA IV 21.8-31.3 kb V 28.6 kbmssa MRSA MRSA IV V MSSA SCCmec MRSA 0951-8510 1-757 Division of Bacteriology, Department of Infectious Disease Control and International Medicine, Niigata University Graduate School of Medical and Dental Sciences (1-757 Asahimachidori, Chuo-ku, Niigata-shi)
MSSA MRSA ST CC eburst MRSA 4 MRSA pandemic MRSA 7 New York Japan ST5 SCCmecII Pediatric ST5 SCCmecIVBerlin ST45 SCCmecIV Iberian ST247 SCCmecIABrazilian ST239 SCCmecIII EMRSA-15 ST22 SCCmecIV EMRSA-16 ST36 SCCmecII MRSA New York Japan ST5 SCCmecII TSST-1 SEC SEL SaPI1 SEG SEI SEM SEN SEO egc MRSA 48 MRSA 50 MRSA MRSA MRSA 1 MRSA 48 MRSA MSM MRSA 2 ST1 ST8 ST1 1997 1999 ST ST8 ST1 ST8 ST80 ST59 ST30 Panton-Valentine PVL
EMRSA-16 clone Berlin clone ST 36 sea +, tst +, egc + ST 45 sea -, tst -, egc + EMRSA-15 clone ST 22 sea -, tst -, egc + Pediatric clone ST 5 sea -, tst -, egc + Iberian clone ST 247 sea +, tst -, egc - Hungarian clone ST 239 sea +, tst -, egc - NY/ Japan clone ST 5 sea -/+, tst +, egc + NY/ Japan clone ST 5 sea -, tst -, egc + Brazilian clone S. aureus MSSA Insertion of SCCmec MRSA MRSA ST 239 sea -, tst -, egc - Europe Africa ST : 1, 5, 8, 22, 30, 36, 37, 59, 80, 377, 766 SCCmec : IV, V Europe Resistance : FA, KM, TC, EM or others Drug resistance : EM, CLDM Oceania ST : 30, 93 SCCmec : IVa Western Samoa New Zealand ST : 1, 8 Canada SCCmec : IV, IVa Russia Alaska Resistance : Norway EM, CLDM, MU or others Scotland Finland ST : 30 The Netherlands DenmarkLatvia ST : 30 North America United Kingdom SCCmec : IVc Canada France Belgium Germany Resistance : None Switzerland North Dakota Portugal Minnesota Italy Greece Vladivostok Russia Turkey Japan California USA Algeria ST : 80 China Japan USA Egypt Asia Texas ST : 30 ST : 1, 8, 30, 59, 72 Egypt ST : 30 Taiwan Taiwan SCCmec : IVa ST : 30 ST : 59 ST : 59 SCCmec : IV Resistance : SCCmec : V EM, CLDM, TC, MU, KM, SCCmec: IV, V T Resistance : None or GM Resistance : None LVFX or others Oceania Australia Queens land South America ST : 30 Brazil SCCmec : IV Brazil Resistance : None Resistance : None, TC or others Deaths due to necrotizing or fatal pneumonia Resistance to non-ß-lactam antimicrobial agents MU : mupirocin MRSA
ST1 20ST8 33 PVL SSTI 70 80 10UTI 2 7 Waterhouse- Friderichsen PVL 75 MRSA 1997 1999 CDC 4 2006 12 2007 1 2 10 community-acquired pneumonia CAP 6 MRSA CAP 2003 2004 15 CDC MRSA CAP IDSA ATS 2007 SARS H5N1 MRSA moderate recommendation level III evidence 5 PVL MRSA 1997 1998 1999 1999 1999 1999 2003 2003 2003 2004 2004 2004 2005 2006 2007 2006 2007 2007 7 16 13 12 17 67 59 15 52 21 2 81014 448 17.56 16 50 37 USA400 USA400 USA400 ST80 ST80 ST377 ST30 ST59 : SCCmecIV MRSA USA400 MW2 : ST1 : spa227 SCCmecIVa USA300T8 : SCCmecIV USA300 ST8 : spa008 SCCmecIVa USA300 ST8 : SCCmecIVa ST30 : agr3 SCCmecV USA300 ST8 : spa8 SCCmecIVa CDC 1999 CDC 1999 CDC 1999 CDC 1999 Dufour2002 Dufour2002 Garnier2006 Wannet2005 Francis2005 Peleg2004 Gilbert2006 Tseng2005 CDC 2007 Martin2006 Enany2007 Sifiri2007
PVL S 32 kda F 34 kda 2 6 8 S F PVL 5 nm Bcl-2 c caspase-9 caspase-3 6 200 nm PVL PVL -S PVL 2 1 Labandeira-Rey 2007 PVL PVL protein A Spa Spa PVL Spa TNF PVL IL -8 B 4 Voyich 8 PVL MRSA 2000 2002 2002 2003 2004 2006 2006 2007 61 27 11 17 18 1 21 ST765, spa43, SCCmecIVx ST30, spa19, SCCmecIVc SCCmecIV ST30, spa19, SCCmecIVc ST30, spa19, SCCmecIVc ST30 ST30, spa19, SCCmecIVa ST30 GM GM GM Yamamoto2006 Yamamoto2006 Hisata2005 Takizawa2004 Takizawa2004 Okubo2007 6, 7 PVL
2006 PVL MRSA PVL PVL Voyich PVL MRSA ST8 USA300 9 SCCmecIVa-ACME ACME arca δ-hemolysin hld ΦSA3usa Fibrin-specific blood-colt dissolving enzyme sak Chemotaxis inhibitory Protein chs Truncated β-hemolysin hlb mec orfx 2.16 Mbp Leukocidin ED luke-lukd γ-hemolysin hlga,c,b SCCmec a 24 kb A (S) Agr regulon agrb, D, C, A SCCmec IVa ACME SCCmec IVa MecA (PBP2 ) meca 2.9/0 Mbp ACME type I B (F) C (S) aroe arcc Arginine deiminase arca ΦSA2usa CA-MRSA USA300 (ST8) 2,872,769bp S F Protein A spa Coagulase (III) coa ACME31kb α-hemolysin hla mec complex ccr complex arc cluster opp-3 cluster glpf gmk yqil Oligopeptide permease operon opp-3 1.44 Mbp Panton-Valentine leukocidin (PVL) luks-pv-lukf-pv pta tpi Arginine deiminase pathway (arc cluster) Oligopeptide permease system (opp-3 cluster) SET set7 0.72 Mbp Staphylococcal accessory regulator A sara Clumping factor clfa SEK sek SEQ seq SAPI5 IS431 meca mecr1 IS1272 ccrb2 ccra2 arcc arcb arcd arca arcr arca : arginin deiminase opp-3a opp-3b opp-3c opp-3d opp-3f DR SCCmec DR ACME DR ACME AGAAGCTTATCATAAATGATGCGGTTTTT AAAAACCGCATCATTAACTGATAAGCAGAAGCGTATCACAA AAAAACCGCATCATTAACCGATACGCAGAGGCGTATCATAA IR SCCmec IR SCCmec IR ACME MRSA ST8 USA300 9 SCCmecIVa ACME DNA GenBank accession no. CP000255
Opp-3 MRSA SCCmecIVa SCCmecIVa SCCmecIVa-ACME S. pyogenes streptococcal acid glycoprotein ph ph4.2-5.9 L- L- ACME L- ATP ATP arc ACME USA300 Opp-3 opp-1 opp-2 MRSA PVL MRSA PVL MRSA, MRSA bica-mrsa ST89 ST91 MRSA ST8 bica-mrsa MRSA 88 MRSA SSTI hemodynamic instability 5cm SSTI
PVL MRSA pusa02 pusa03 PVL MRSA ST30 ST59 ST8 USA300 ST80 B inducible tetk aph3 -IIIa aade ermb cat blaz gyra tetk erm iles iles iles iles msra, ermc tetk mupa ermc tetk aph3 -III far1 75 92 92 92 75 96 97 55 55 55 100 40 82 100 87 Takizawa2005 Takano2008 Diep2006 Tenover2006 Han2007 Tristan2007 MRSA - ST empiric therapy MRSA MRSA D-zone test MRSA 20 FDA MRSA SSTI ST MRSA Cruciani 1996 1 12
Conte, 2002 ; Wunderink, 2003 MRSA Wunderink, 2003 ; Kollef, 2004 in vitro PVL PVL Dumitrescu, 2007 MRSA MRSA MRSA Daum, 2007 MRSA MRSA 1 Centers for Disease Control and Prevention.: Four pediatric deaths from community-acquired meticillin-resistant Staphylococcus aureus-minnesota and North Dakota, 1997-1999, Morb. Mortal. Wkly. Rep. : 707-710, 1999. 2 Vandenesch, F., Naimi, T., Enright, M. C., Lina, G., Nimmo, G. R., Heffernan, H., Liassine, N., Bes, M., Greenland, T., Reverdy, M. E., and Etienne, J.: Community-acquired methicillin-resistant Staphylococcus aureus carrying Panton-Valentine leukocidin genes : worldwide emergence, Emerg. Infect. Dis. : 978-984, 2003. 3 Zetola, N., Francis, J. S., Nuermberger, E. L., and Bishai, W. R.: Community-acquired meticillin-resistant Staphylococcus aureus : an emerging threat, Lancet Infect. Dis. : 275-286, 2005. 4 Brumfitt, W. and Hamilton-Miller, J.: Methicillin-resistant Staphylococcus aureus. N. Engl. J. Med. : 1188-1196, 2007. 5 Daum, R. S.: Clinical practice. Skin and soft-tissue infections caused by methicillin-resistant Staphylococcus aureus. N. Engl. J. Med. : 380-390, 2007. 6 Genestier, A. L., Michallet, M. C., Préost, G., Bellot, G., Chalabreysse, L., Peyrol, S., Thivolet, F., Etienne, J., Lina, G., Vallette, F. M., Vandenesch, F., and Genestier, L.: Staphylococcus aureus Panton-Valentine leukocidin directly targets mitochondria and induces Bax-independent apoptosis of human neutrophils. J. Clin. Invest. : 3117-3127, 2005. 7 Labandeira-Rey, M., Couzon, F., Boisset, S., Brown, E. L., Bes, M., Benito, Y., Barbu, E. M., Vazquez, V., Höök, M., Etienne, J., Vandenesch, F., and Bowden, M. G.: Staphylococcus aureus Panton-Valentine leukocidin causes necrotizing pneumonia. Science. : 1130-1133, 2007. 8 Voyich, J. M., Otto, M., Mathema, B., Braughton, K. R., Whitney, A. R., Welty, D., Long, R. D., Dorward, D. W., Gardner, D. J., Lina, G., Kreiswirth, B. N., and DeLeo, F. R.: Is Panton-Valentine leukocidin the major virulence determinant in community-associated methicillin-resistant Staphylococcus aureus disease? J. Infect. Dis. : 1761-1770, 2006. 9 Diep, B. A., Gill, S. R., Chang, R. F., Phan, T. H., Chen, J. H., Davidson, M. G., Lin, F., Lin, J., Carleton, H. A., Mongodin, E. F., Sensabaugh, G. F., and Perdreau-Remington, F.: Complete genome sequence of USA300, an epidemic clone of community-acquired meticillin-resistant Staphylococcus aureus. Lancet. : 731-739, 2006.