DOI: /VETGL R UDK: :
|
|
- Lisa Pitts
- 6 years ago
- Views:
Transcription
1 ORIGINALNI RAD / ORIGINAL PAPER DOI: /VETGL R UDK: : METODE DETEKCIJE I TIPIZACIJE METICILIN-REZISTENTNIH STAPHYLOCOCCUS AUREUS IZOLOVANIH IZ ŽIVOTINJA* METHODS OF DETECTION AND TYPING OF METHICILLIN RESISTANT STAPHYLOCOCCUS AUREUS ISOLATED FROM ANIMALS Radosavljević V., Žutić Jadranka, Pavlović Ljiljana, Bošković Tamara, Radanović O., Žutić M.** U radu je izvršena evaluacija metoda detekcije meticilin rezistentnog Staphylococcus aureus (MRSA) upotrebom dva molekularna i tri fenotipska testa u postupku ispitivanja 70 sojeva S. aureus izolovanih iz životinja. Skorašnji nalaz novog meca homologa, meca LGA251, umanjuje značaj dokazivanja prisustva meca gena kao potvrdne metode u identifikaciji meticilin rezistentnog Staphylococcus aureus. Iz ovog razloga je, pored multipleks PCR seta prajmera (16S rdnk, nuc, meca) za detekciju meca gena, korišćen i multipleks PCR set prajmera (spa, meca, pvl, meca LGA251 ) za diferencijaciju meca LGA251 od meca, sa istovremenom detekcijom lukf-pv i spa genskih fragmenata. Kod svih 70 ispitivanih izolata detektovano je prisustvo specifičnog 16S rdnk fragmenta i nuc gena koji kodira termostabilnu nukleazu S. aureus, dok je kod 5 od 70 izolata S. aureus pomoću dva multipleks PCR testa dokazano prisustvo meca gena. U ispitivanim sojevima nije utvrđeno prisustvo mecc (meca LGA251 ) gena, niti Panton Valentin Leukocidin kodirajućeg gena. Primenom cefoksitin disk-difuzionog, lateks-aglutinacionog i dva multipleks PCR testa, dobijeni su identični rezultati u identifikaciji pet meticilin rezistentnih od 70 ukupno ispitanih sojeva S. aureus. U našem istraživanju utvrđena je potpuna korelacija između rezultata fenotipske i genotipske identifikacije meticilin rezistentnog S. aureus. Ključne reči: Staphylococcus aureus, MRSA, cefoksitin, multipleks PCR, meca LGA251 * Rad primljen za štampu godine. ** V. Radosavljević, Jadranka Žutić, Naučni Institut za veterinarstvo Srbije, Beograd; Ljiljana Pavlović, Institut za javno zdravlje Dr M. Jovanović Batut, Beograd; Tamara Bošković, Ministarstvo Poljoprivrede, šumarstva i vodoprivrede R. Srbije, Beograd; O. Radanović, M. Žutić, Naučni Institut za veterinarstvo Srbije, Beograd 89
2 Uvod / Introduction Rod Staphylococcus obuhvata čitav niz oportunističkih patogena različitog značaja u veterinarskoj medicini. Najznačajnijim se među njima smatra Staphylococcus (S.) aureus zbog njegove izražene adaptabilnosti i mogućnosti da uzrokuje različita patološka stanja, od blagih kožnih infekcija do smrtonosnih bakterijemija. Bitno svojstvo stafilokoka je njihova sposobnost da stvore rezistenciju prema antimikrobnim sredstvima. Otpornost prema meticilinu bazira se na prisustvu meca gena, koji kodira sintezu izmenjenog penicilin vezujućeg proteina (PBP2a), i njegovim niskim afinitetom prema beta-laktamskim antibioticima (Kwon i sar., 2005). MecA gen se nalazi na stafilokoknoj hromozomskoj kaseti mobilnom genetskom elementu na hromozomu (SCC staphylococcal chromosomal casette mec) (Chambers,1997). Pojava meticilin rezistentnih sojeva S. aureus (MRSA) je utvrđena nedugo nakon njegovog uvođenja u kliničku upotrebu. Prva pojava rezistencije na meticilin zabeležena je godine među bolničkim izolatima u Engleskoj (Jevons, 1961). Prve meticilin rezistentne stafilokoke poreklom od životinja izolovane su godine iz mleka krava sa mastitisom (Devriese i sar., 1972). Iako se meticilin već duže vreme ne koristi u lečenju stafilokoknih infekcija, akronim MRSA se i dalje koristi kao oznaka rezistencije na beta-laktamske antibiotike. Meticilin rezistentni sojevi S. aureus izolovani su iz 30 odsto teladi u Holandiji (Graveland i sar., 2008), kao i iz 39-70% svinja na liniji klanja (de Neeling i sar., 2007; Tenhagen i sar., 2009). MRSA sojevi su takođe izolovani i iz konja i kućnih ljubimaca (Walther et al., 2006; Weese et al, 2006), brojlera (Persoons i sar., 2009) svinja (van Duijkeren i sar., 2007; Žutić i sar., 2012a) i krava sa subkliničkim mastitisom (Žutić i sar., 2012b). Poseban problem predstavlja mogućnost prenošenja sojeva MRSA sa životinja na ljude, pogotovo od kada je utvrđeno da je prisustvo MRSA tipa ST398 mnogo učestalije kod poljoprivrednika, veterinara i klaničnog osoblja u odnosu na opštu populaciju (Voss i sar., 2005; Wulf i sar., 2007). U više država su utvrđene kliničke infekcije ljudi izazvane ovim tipom S. aureus (van Loo i sar., 2007; Witte i sar, 2007). Iz učestale pojave meticilin-rezistentnih stafilokoka kod ljudi i životinja proizašla je potreba primene brzih i pouzdanih metoda detekcije antimikrobne rezistencije. Više autora upućuje na upotrebu cefoksitina kao markera rezistencije na meticilin (Felten i sar., 2002; Swenson i sar., 2005; Swenson i sar., 2007), a cefoksitin disk difuzioni metod je preporučeni metod za detekciju MRSA (CLSI, 2008). Međutim, pouzdanost detekcije rezistencije primenom fenotipskih testova nije uvek zadovoljavajuća, s obzirom na činjenicu da na ekspresiju gena značajno utiču uslovi spoljašnje sredine i faktori kultivacije (Martineau i sar., 2000). Za identifikaciju sojeva MRSA putem detekcije meca gena koristi se i lančana reakcija polimeraze (PCR). Skorašnji nalaz novog meca homologa, meca LGA251, sa svega 70% homologije sa poznatim meca genom, umanjio je značaj testiranja na prisustvo meca gena kao potvrdne metode za dokazivanje meticilin rezistentnog Staphylococcus aureus (MRSA). Stoga se preporučuje primena multipleks PCR za diferencijaciju meca LGA251 od meca, sa isto- 90
3 vremenom detekcijom lukf-pv i spa genskih fragmenata, što omogućava i direktno spa tipiziranje sekvenciranjem PCR amplikona (Stegger i sar., 2012). Cilj ovog rada je evaluacija mogućnosti detekcije meticilin rezistentnih sojeva S. aureus primenom fenotipskih i molekularnih metoda. Materijal i metode rada / Material and methods Za ispitivanje je korišćeno ukupno 70 sojeva S. aureus, izolovanih iz kliničkog materijala poreklom od domaćih životinja (goveda i svinje). Identifikacija sojeva S. aureus izvršena je standardnim bakteriološkim metodama uz primenu komercijalnih testova (Slidex Staph Plus, biomerieux ; BBL Crystal G/P ID kit, Becton Dickinson). Ispitujući sojevi S. aureus zasejani su na hromogenu podlogu (chromid MRSA, biomerieux) i inkubirani na temperaturi od 37 o C u aerobnim uslovima tokom 24 sata. Svi izolati su takođe ispitivani na prisustvo rezistencije disk difuzionom metodom na Mueller Hinton II agaru (biomerieux), primenom diska cefoksitina od 30 µg (Rosco, Danska) i interpretacijom rezultata prema preporuci CLSI (2008). Svih 70 sojeva S. aureus je ispitano na prisustvo produkta meca gena, penicillin vezujućeg proteina (PBP2a) pomoću lateks aglutinacionog testa (Slidex MRSA Detection, biomerieux). Test je izvršen prema uputstvu proizvođača. Za ekstrakciju DNK iz 24 časa starih kultura je korišćen QIAamp DNA mini kit (Qiagen), prema uputstvu proizvođača. Tabela 1. Prajmeri korišćeni za detekciju MRSA Table 1. Primers used for MRSA detection Prajmer / Primer Sekvenca / Sequence Veličina produkta / Product size Multipleks / Multiplex PCR (16S, nuc, meca) 16S1 5 -GTG CCA GCA GCC GCG GTAA-3 16S2 5 -AGA CCC GGG AAC GTA TTC AC-3 mec1 5 -GGG ATC ATA GCG TCA TTA TTC-3 mec2 5 -AAC GAT TGT GAC ACG ATA GCC -3 nuc1 5 -TCA GCA AAT GCA TCA CAA ACAG-3 nuc2 5 -CGT AAA TGC ACT TGC TTC AGG-3 Multipleks / Multiplex PCR (spa, meca, pvl, meca LGA251 ) spa-1113f 5 TAAAGACGATCCTTCGGTGAGC 3 spa-1514r 5 CAGCAGTAGTGCCGTTTGCTT 3 meca P4 5 TCCAGATTACAACTTCACCAGG 3 meca P7 5 CCACTTCATATCTTGTAACG 3 pvl-f 5 GCTGGACAAAACTTCTTGGAATAT 3 pvl-r 5 GATAGGACACCAATAAATTCTGGATTG 3 meca LGA251 MultiFP 5 GAAAAAAAGGCTTAGAACGCCTC 3 meca LGA251 MultiRP 5 GAAGATCTTTTCCGTTTTCAGC bp 527 bp 255 bp bp 162 bp ~85 bp 138 bp 91
4 Za utvrđivanje meca statusa korišćena su dva multipleks PCR testa: 1. Multipleks PCR (16S, nuc, meca), pri čemu je istovremeno vršena amplifikacija Staphylococcus specifičnih regija 16S rdnk, meca gena i nuc gena (Poulsen i sar., 2003) (tabela 1). Prajmeri za rad su sintetisani u Metabion GmbH, Nemačka. Za pripremu PCR smeše korišćen je HotStarTaq Master Mix (Qiagen, Germany), prema uputstvu proizvođača. Umnožavanje DNK fragmenata je vršeno u PCR aparatu (Mastercycler, Eppendorf, Nemačka). Nakon inicijalne denaturacije DNK pri temperaturi od 94 C u trajanju od 5 minuta, reakcija (30 ciklusa) se odvijala u sledećim temperaturnim uslovima: 30 sekundi na 94 o C, 30 sekundi na 55 o C i 30 sekundi na 72 o C, sa završnom elongacijom na 72 o C u trajanju od dva minuta. PCR proizvodi su vizuelizovani na 2% agaroznom gelu (Bio-Rad) sa etidijum-bromidom na UV transiluminatoru. Na osnovu DNK markera (DNA Ladder, bp, Fermentas) određena je približna molekulska masa PCR produkata. Kao negativna kontrola korišćen je referentni soj S. aureus ATCC 29213, a kao pozitivna kontrola meticilin rezistentan S. aureus ATCC U slučajevima nuc i meca amplifikacije, u multipleks PCR reakciji su, osim 16S rdnk fragmenta veličine 886 bp, bili prisutni i meca fragment DNK veličine 527 bp i nuc fragment DNK veličine 225 bp. Pozitivna (MRSA ATCC 43300) i negativna (S. aureus ATCC 29213) kontrola su korišćene za svaku PCR reakciju. 2. Multipleks PCR (spa, meca, pvl, meca LGA251 ) za diferencijaciju meca LGA251 od meca, sa istovremenom detekcijom lukf-pv i spa genskih fragmenata. Za potvrdu rezistencije prema meticilinu detekcijom meca gena i istovremeno utvrđivanje prisustva mecc (meca LGA251 ) gena, spa gena i Panton Valentin Leukocidin (PVL ili lukf-pv) kodirajućih gena, korišćen je multipleks PCR prema Stegger i sar. (2012) (tabela 1). Prajmeri za rad su sintetisani u Metabion GmbH, Nemačka. Za pripremu PCR smeše korišćen je HotStarTaq Master Mix (Qiagen, Nemačka), prema uputstvu proizvođača. Umnožavanje DNK fragmenata je vršeno u PCR aparatu (Mastercycler, Eppendorf, Nemačka). Nakon inicijalne denaturacije DNK pri temperaturi od 94 o C u trajanju od 5 minuta, reakcija (30 ciklusa) se odvijala u sledećim temperaturnim uslovima: 30 sekundi na 94 o C, 60 sekundi na 59 o C i 60 sekundi na 72 o C, sa završnom elongacijom na 72 o C u trajanju od 10 minuta. PCR proizvodi su vizuelizovani na 2% agaroznom gelu (Bio-Rad) sa etidijum-bromidom na UV transiluminatoru. Na osnovu DNK markera (DNA Ladder, bp, Fermentas) određena je približna molekulska masa PCR produkata. Rezultati / Results Pri kultivaciji na hromogenoj podlozi, od 70 ispitujućih sojeva Staphylococcus aureus, njih je 5, nakon 24 h inkubacije na temperaturi od 37 o C raslo u vidu okruglih, konveksnih, zeleno do sivkasto obojenih kolonija sa zelenim rubovima, prečnika oko 1,5 mm (slika 1). Preostalih 65 sojeva nije pokazalo rast niti nakon 72 sata inkubacije. 92
5 Slika 1. Kolonije MRSA na hromogenoj podlozi / Figure 1. Colonies of MRSA at chromogen medium Ispitivanjem osetljivosti svih 70 sojeva, istih je 5 sojeva, koji su rasli na hromogenoj podlozi, pokazalo rezistenciju na cefoksitin, pri čemu se zona inhibicije kretala od mm. Takođe je, primenom lateks aglutinacionog testa ovih 5 sojeva dalo pozitivnu reakciju, odnosno kod njih je dokazano prisustvo penicilin vezujućeg proteina (PBP2a). Amplifikacijom Staphylococcus-specifičnih regija 16S rdnk u ispitivanim izolatima potvrđena je pripadnost svih ispitivanih izolata rodu Staphylococcus. Kod svih 70 ispitivanih izolata detektovano je prisustvo nuc gena, koji kodira termostabilnu nukleazu specifičnu za S. aureus. Kod 5 od 70 izolata amplifikovan fragment meca gena, veličine 527 bp (slika 2 i 3). Zone inhibicije utvrđene disk difuzionom metodom sa cefoksitinom su date u tabeli 2. Tabela 2. Veličina zona inhibicije oko diskova cefoksitina u disk difuzionoj metodi i rezultat PCR detekcije meca gena Table 2. Size of inhibition zones around cefoxitin disks in disk diffusion method and the result of meca gene PCR detection meca rezultat / meca result Pozitivno / Positive Negativno / Negative Broj / Result Ukupno / Total 70 Prečnik zone inhibicije (mm) / Inhibition zone diameter (mm) Nasuprot tome, nijedan od izolata koji su pokazali osetljivost na cefoksitin i odsustvo PBP2a nije pokazao traku za meca gen u multipleks PCR testovima. 93
6 Dakle, i cefoksitin-rezistentni i osetljivi sojevi su pokazali potpunu saglasnost rezultata dobijenih pomoću multipleks PCR i primenom fenotipskih metoda. Kod svih ispitivanih izolata je utvrđeno prisustvo spa gena, čime je omogućena dalja karakterizacija i tipizacija izolovanih sojeva. U ispitivanim izolatima S. aureus nije detektovano prisustvo meca LGA251, niti Panton-Valentin leukocidin (PVL) kodirajućeg gena. M Slika 2. Multipleks PCR (16S, nuc, meca). M molekularni marker bp (Fermenas), 1-5 MRSA izolati, 6 Pozitivna kontrola (MRSA ATCC 43300), 7 Negativna kontrola (S. aureus ATCC 29213) Figure 2. Multiplex PCR (165, nuc, meca). M molecular marker bp (Fermentas), 1-5 MRSA isolates, 6 Positive control (MRSA ATCC 43300), 7 Negative control (S. aureus ATCC 29213) M Slika 3. Multipleks PCR (spa, meca, pvl, meca LGA251 ). M molekularni marker bp, 1-5 MRSA izolati, 6 Pozitivna kontrola (MRSA ATCC 43300), 7 Pozitivna kontrola (PVL pozitivan S.aureus), 8 Pozitivna kontrola (S. aureus meca LGA251 ), 9 Negativna kontrola (S. aureus ATCC 29213). Figure 3. Multiplex PCR (spa, meca, pvl, meca LGA251 ). M molecular marker bp, 1-5 MRSA isolates, 6 Positive control (MRSA ATCC 43300), 7 Positive control (PVL pozitivan S.aureus), 8 Positive control (S. aureus meca LGA251 ), 9 Negative control (S. aureus ATCC 29213) 94
7 Diskusija / Discussion Dokazivanje meca gena ili njegovog proizvoda, penicilin vezujućeg proteina (PBP2a), smatra se zlatnim standardom za potvrdu MRSA (Skov i sar., 2006). Skorašnje studije su pokazale da je test disk difuzije sa cefoksitinom značajno pouzdaniji u odnosu na većinu trenutno korišćenih fenotipskih metoda, poput testova sa oksacilinom (Swenson i sar. 2007). U našem istraživanju je utvrđena potpuna korelacija između rezultata fenotipske i genotipske identifikacije S. aureus i detekcije rezistencije na cefoksitin. Pérez-Roth i sar. (2002) su takođe utvrdili potpunu konzistentnost rezultata fenotipskih testova i multipleks PCR u identifikaciji i detekciji rezistencije na oksacilin i mupirocinu. Genotipska detekcija meca se koristi kao referentni standard za identifikaciju MRSA, kao primarni ili potvrdni test (Chambers, 1997). PCR je od velike koristi u dokazivanju bakterijskih infekcija izazvanih rezistentnim sojevima S. aureus, s obzirom na to da detektuje gen rezistencije, dok se fenotipskim tehnikama dokazuju rezultati ekspresije gena. Na ekspresiju gena mogu uticati uslovi spoljašnje sredine i uslovi kultivacije bakterija, što može izazvati sumnju u rezultate i ispravno tumačenje podataka dobijenih primenom fenotipskih metoda. Nedavno je otkriven novi meca homolog (meca LGA251 ), čije je prisustvo utvrđeno u sojevima S. aureus koji pripadaju klonalnim kompleksima (CC) 130, CC1943 i ST 425, poreklom od krava (García-Álvarez i sar, 2011). Kod meca LGA251 gena je utvrđeno svega 70% homologije nukleotida sa meca, a gen se nalazi u novootkrivenom SCC elementu označenom kao SCCmec tip XI. Do sada je utvrđeno da su izolati koji sadrže meca LGA251 rezistentni prema β-laktamskim antibioticima, ali njihovo prisustvo nije moguće dokazati standardnim PCR metodom za detekciju meca gena, zahvaljujući različitom sadržaju nukleotida (García-Álvarez i sar, 2011; Shore i sar., 2011). Fenotipski rezistentni (cefoksitin/oksacillin) izolati, kod kojih pomoću PCR nije moguće utvrditi prisustvo meca gena se nazivaju BORSA (Borderline oxacillin-resistant S. aureus). Otkrićem meca LGA251 dobijena je genetska potvrda BORSA MRSA fenotipa. Zaključak / Conclusion Primenom hromogene podloge, cefoksitin disk-difuzionog, lateks-aglutinacionog testa i multipleks PCR testa sa dva seta prajmera dobijeni su identični rezultati u identifikaciji 5 meticilin rezistentnih od 70 ukupno ispitanih sojeva Staphylococcus aureus. U našim je ispitivanjima kultivacija na hromogenoj podlozi pokazala visoku selektivnost, što upućuje na mogućnost korišćenja ovih vrsta podloga za kultivaciju, posebno pri ispitivanjima većeg broja uzoraka. Cefoksitin disk difuzioni test je, kao preliminarni metod, prikladan za izvođenje u laboratorijama. U istraživanju je korišćena multipleks PCR metoda metoda koja omogućava brzu i istovremenu detekciju i diferencijaciju obe meca varijante i njhovog Panton-Val- 95
8 entine leukocidin (PVL) lokusa, koja daje osnovu za tipizaciju, genetsku analizu i grupisanje izolata daljim spa sekvenciranjem. Multipleks PCR metodom je dokazano da sojevi kod kojih je detektovana rezistencija na meticilin nisu BORSA već MRSA. Povećanje incidencije meticilin rezistentnih sojeva stafilokoka postaje sve značajniji problem u humanoj i veterinarskoj medicini. Stoga je pouzdano i rano otkrivanje ove vrste rezistencije od prioritetnog značaja. Pri tome je neophodno kontinuirano praćenje ovog problema, kako bi se na osnovu relevantnih podataka donosile preporuke i programi sa ciljem sprečavanja širenja rezistencije i smanjili njeni postojeći nivoi. NAPOMENA / ACKNOWLEDGMENT: Rad je finansiran od strane Ministarstva prosvete, nauke i tehnološkog razvoja, R. Srbije, prema Projektu TR The work is financed by the Ministry of Education, Science and Technological Development of the Repulic of Serbia, according tothe Project TR Literatura / References 1. Chambers HF. Methicillin resistance in staphylococci: molecular and biochemical basis and clinical implications. Clin Microbiol Rev 1997; 10: Clinical and Laboratory Standards Institute / NCCLS Performance Standards for Antimicrobial Susceptibility Testing, 15th informational supplement, M100-S15. Wayne Pa: Clinical and Laboratory Standards Institute; de Neeling A, van den Broek M, Spalburg E, van Santen-Verheuvel M, Dam-Deisz W, Boshuizen H, van de Giessen A, van Duijkeren E, Huijsdens X. High prevalence of methicillin resistant Staphylococcus aureus in pigs. Vet Microbiol 2007; 122: Devriese LA, Van Damme LR, Fameree L. Methicillin (cloxacillin)-resistant Staphylococcus aureus strains isolated from bovine mastitis cases. Zentralbl Veterinarmed B 1972; 19: Felten A, Grandy B, Lagrange PH, Casin I. Evaluation of three techniques for detection of low le vel methicillin-resistant Staphylococcus aureus(mrsa): A disk diffusion method with cefoxitin and moxalactam, the Vitek 2 system, and the MRSA-screen latex agglutination test. J Clin Microbiol 2002; 40: García-Álvarez L, Holden MT, Lindsay H, Webb CR, Brown DF, Curran MD, Walpole E, Brooks K, Pickard DJ, Teale C, Parkhill J, Bentley SD, Edwards GF, Girvan EK, Kearns AM, Pichon B, Hill RL, Larsen AR, Skov RL, Peacock SJ, Maskell DJ, Holmes MA. Meticillin-resistant Staphylococcus aureus with a novel meca homologue in human and bovine populations in the UK and Denmark: a descriptive study. Lancet Infect Dis 2011; 11: Graveland H, Wagenaar JA, Broekhuizen-Stins MJ, Oosting-Schothorst I, Schoormans AH, van Duijkeren E, Huijsdens X, Mevius D, Heederik D. Methicillin-resistant Staphylococcus aureus (MRSA) in veal calf farmers and veal calves in the Netherlands. American Society for Microbiology Conference on Antimicrobial Resistance in Zoonotic Bacteria and Foodborne Pathogens, Copenhagen. 2008: Jevons MP. Celbenin-resistant staphylococci. Br Med J 1961; 1: Kwon NH, Park KT, Moon JS, Jung WK, Kim SH, Kim JM, Hong SK, Koo HC, Joo YS, Park YH. Staphylococcal cassette chromosome mec (SCCmec) characterization and molecular analysis for methicillin-resistant Staphylococcus aureus and novel SCCmec subtype IVg isolated from bovine milk in Korea. J Antimicrob Chemother 2005; 56: Martineau F, Picard FJ, Lansac N, Ménard C, Roy PH, Ouellette M, Bergeron MG. Correlation between the resistance genotype determined by multiplex PCR assays and the antibiotic 96
9 susceptibility patterns of Staphylococcus aureus and Staphylococcus epidermidis. Antimicrob Agents Chemother 2000; 44: Persoons D, Van Hoorebeke S, Hermans K, Butaye P, de Kruif A, Haesebrouck F, Dewulf J. Methicillin-resistant Staphylococcus aureus in poultry. Emerging Infect Dis 2009; 15: Pérez-Roth E, Claverie-Martín F, Batista N, Moreno A, Méndez-Álvares S. Mupirocin resistance in methicillin-resistant Staphylococcus aureus clinical isolates in a Spanish hospital. Co-application of multiplex PCR assay and conventional microbiology methods. Diag Microbiol Infect Dis 2002; 43: Poulsen A, Skov R, Pallesen L. Detection of methicillin resistance in coagulase-negative staphylococci and in staphylococci directly from simulated blood cultures using the EVIGENE MRSA Detection Kit. J Antimicrob Chemotherapy 2003; 51: Shore AC, Deasy EC, Slickers P, Brennan G, O Connell B, Monecke S. Detection of staphylococcal cassette chromosome mec type XI carrying highly divergent meca, meci, mecr1, blaz, and ccr genes in human clinical isolates of clonal complex 130 methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother 2011; 55: Skov R, Smyth R, Larsen AR, BolmstrÙm A, Karlsson A, Mills K. Phenotypic detection of methicillin resistance in Staphylococcus aureus by disk diffusion testing and etest on Mueller-Hinton agar. J Clin Microbiol 2006; 44: Stegger M, Andersen PS, Kearns A, Pichon B, Holmes MA, Edwards G, Laurent F, Teale C, Skov R, Larsen AR. Rapid detection, differentiation and typing of methicillin-resistant Staphylococcus aureus harbouring either meca or the new meca homologue meca( LGA251 ). Clin Microbiol Infect 2012; 18(4): Swenson JM, Tenover FC; the Cefoxitin Disk Study Group. Results of disk diffusion testing with cefoxitin correlate with presence of meca in Staphylococcus spp. J Clin Microbiol 2005; 43: Swenson JM, Lonsway D, McAllister S, Thompson A, Jevitt L, Patel JB. Detection of meca-mediated Resistance Using Cefoxitin Disk Diffusion (DD) in a Collection of Staphylococcus aureus Expressing Borderline oxacillin MICs. Diagn Microbiol Infect Dis 2007; 58: Tenhagen BA, Köster G, Wallmann J, Heuwieser W. Prevalence of mastitis pathogens and their resistance against antimicrobial agents in dairy cows in Brandenburg, Germany. J Dairy Sci 2006; 89: van Duijkeren E, Jansen MD, Flemming SC, de Neeling H, Wagenaar JA, Schoormans AH, van Nes A, Fluit AC. Methicillin-resistant Staphylococcus aureus in pigs with exudative epidermitis. Emerging Infect Dis 2007; 13: van Loo I, Huijsdens XW, Tiemersma E, de Neeling AJ, van de Sande-Bruinsma N, Beaujean D, Voss A, Kluytmans J.. Emergence of methicillin-resistant Staphylococcus aureus of animal origin. Emerging Infect Dis 2007; 13: Voss A, Loeffen F, Bakker J, Klaassen C, Wulf M.. Methicillin-resistant Staphylococcus aureus in pig farming. Emerging Infect Dis 2005; 11: Walther B, Monecke S, Ruscher C, Friedrich AW, Ehricht R, Slickers P, Soba A, Wleklinski CG, Wieler LH, Lübke-Becker A. Comparative molecular analysis substantiates zoonotic potential of equine methicillin-resistant Staphylococcus aureus. J Clin Microbiol. 2009; 47: Weese J, Caldwell F, Willey B, Kreiswirth B, McGeer A, Rousseau J, Low D. An outbreak of methicillin-resistant Staphylococcus aureus skin infections resulting from horse to human transmission in a veterinary hospital. Vet Microbiol 2006; 114: Witte W, Strommenger B, Stanek C, Cuny C. Methicillin-resistant Staphylococcus aureus ST398 in humans and animals, central Europe. Emerging Infect Dis 2007; 13: Wulf MW, Sørum M, van Nes A, Skov R, Melchers WJ, Klaassen CH, Voss A. Prevalence of methicillin-resistant Staphylococcus aureus among veterinarians: An international study. Clin Microbiol Infect 2007; 14:
10 27. Žutić M, Ćirković I, Pavlović Lj, Ašanin J, Jovanović S, Žutić j, Ašanin R. First isolation methicillin-resistant Staphylococcus aureus from pigs clinical samples in Serbia. Acta Vet Brno 2012a; 81: Žutić M, Ćirković I, Pavlović Lj, Žutić J, Ašanin J, Radanović O, Pavlović N. Occurrence of methicillin-resistant Staphylococcus aureus in milk samples from Serbian cows with subclinical mastitis. African J Microbiol Res 2012b; 6: ENGLISH METHODS OF DETECTION AND TYPING OF METHICILLIN RESISTANT STAPHYLOCOCCUS AUREUS ISOLATED FROM ANIMALS Radosavljević V., Žutić Jadranka, Pavlović Ljiljana, Bošković Tamara, Radanović O., Žutić M. In this work there was evaluated the method of detection of methicillin resistant Staphylococcus aureus (MRSA) by using two molecular and three phenotypic tests in investigation procedure of 70 strains of S.aureus isolated from animals. Recent findings of the new meca homologue, meca LGA251, minimise the significance of meca gene presence detection as a confirmation method of methicillin resistant Staphylococcus aureus identification. For this reason, along with multiplex PCR set of primers(165rdnk, nuc, meca) for detection meca gene, there was also used multiplex PCR set of primers (spa, meca, pvl, meca LGA251 ) for differentiation meca LGA251 from meca, with simultaneous detection of luk-pv and spa gene fragments. In all 70 investigated isolates there was detected the presence of specific 16 SrDNK fragment and nuc gene which encodes a thermostable S. aureus nuclease, while in 5 out of 70 S. aureus isolates, there was proven meca gene presence using two multiplex PCR tests. In the investigated strains there was determined neither mecc (meca LGA251 )gene presence, nor Panton Valentine Leukocidin encoding gene. By application cefoxitin disk-diffusion, latex-agglutination and two multiplex PCR tests, the identical results in identification 5 methicillin resistant out of 70 investigated S. aureus strains were obtained. In our investigation there was determined a complete correlation between the results of phenotypic and genotypic identification of methicillin resistant S. aureus. Key words: Staphylococcus aureus, MRSA, cefoxitin, multiplex PCR, meca LGA251 РУССКИЙ МЕТОДЫ ОБНАРУЖЕНИЯ И ТИПИЗАЦИИ МЕТИЦИЛЛИН-РЕЗИСТЕНТНЫХ STAPHYLOCOCCUS AUREUS ВЫДЕЛЕНЫХ ИЗ ЖИВОТНЫХ В. Радосавлевич, Ядранка Жутич, Лиляна Павлович, Тамара Бошкович, О. Раданович, М. Жутич В этой статье мы оценили метод обнаружения метициллин-резистентного Staphylococcus aureus (MRSA) употребляя два молекуларных и три фенотипических тестов, оценивая 70 штаммов S. aureus выделеных из животных. Последние результаты но- 98
11 вого meca гомолога, meca LGA2514 уменьшают важность доказать наличие meca гена, как подтверждающего метода в выявлении метициллин-устойчивого Staphylococus aureus. По этой причине, в дополнение к нескольким наборам PCR-праймеров для обнаружения meca генов, использовали и детали мультиплексного PCR набора праймеров (spa, meca, pvl, meca LGA2514 ) с дифференциациeй meca LGA2514 от meca путем обнаружения lukf-pv и фрагментов гена SPA. У всех 70 исследованных штаммов был обнаружен конкретный фрагмент 16 S rdnk и nuc ген, кодирующий термостабильную нуклеазу Staphylococus aureus, а в 5 из 70 изолятов Staphylococus aureus с помощью двух мультиплекс PCR-анализ обнаружен ген meca. В тестируемых штаммах не обнаружены mecc ген и Пантон-Валентайна лейкоцидин кодирующий ген. С помощью диск-дифузного Cefoxitin-a, латекс аглютационного и два мультиплексных PCR анализов, получены идентичны результаты в идентификации пяти метициллин-резистентных из 70 обследованных штаммов Staphylococus aureus. В нашем исследовании обнаружена абсолютная корреляция между результатами фенотипической и генотипической идентификации метициллин-устойчивого Staphylococus aureus. meca LGA2514 Ключeвые слова: Staphylococus aureus, MRSA, Cefoxitin, мультиплекс PCR, 99
Methicillin resistant Staphylococcus aureus (MRSA) Lina Cavaco
Methicillin resistant Staphylococcus aureus (MRSA) Lina Cavaco licav@food.dtu.dk 1 DTU Food, Technical University of Denmark Staphylococcus aureus Gram positive cocci Catalase positive Coagulase postive
More informationReceived 19 June 2012; returned 12 July 2012; revised 19 July 2012; accepted 22 July 2012
J Antimicrob Chemother 2012; 67: 2809 2813 doi:10.1093/jac/dks329 Advance Access publication 31 August 2012 The newly described meca homologue, meca LGA251, is present in methicillin-resistant Staphylococcus
More informationMRSA surveillance 2014: Poultry
Vicky Jasson MRSA surveillance 2014: Poultry 1. Introduction In the framework of the FASFC surveillance, a surveillance of MRSA in poultry has been executed in order to determine the prevalence and diversity
More informationPersistence of livestock-associated MRSA after short term occupational exposure to
JCM Accepts, published online ahead of print on 12 January 2011 J. Clin. Microbiol. doi:10.1128/jcm.00493-10 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All
More informationTrinity College Dublin, Ireland. College, St. James s Hospital, Dublin, Ireland
G.I. Brennan et al. Original article Evaluation of commercial chromogenic media for the detection of meticillin-resistant Staphylococcus aureus G.I. Brennan a,b,*, C. Herra c, D.C. Coleman b, B. O Connell
More informationState Veterinary Institute Olomouc, Czech Republic 2. National Institute of Public Health, Prague, Czech Republic 4
ACTA VET. BRNO 2012, 81: 219 223; doi:10.2754/avb201281030219 Occurrence and characteristic of methicillin-resistant Staphylococcus aureus on pig farms in the Czech Republic Jan Bardoň 1,2, Milan Kolář
More informationEdinburgh Research Explorer
Edinburgh Research Explorer Short communication: Methicillin-resistant Staphylococcus aureus detection in US bulk tank milk Citation for published version: Virgin, JE, Van Slyke, TM, Lombard, JE & Zadoks,
More informationEvaluation of isolation procedures and chromogenic agar media for detection of MRSA in nasal swabs from pigs and veal calves.
Evaluation of isolation procedures and chromogenic agar media for detection of MRSA in nasal swabs from pigs and veal calves. Haitske Graveland, Engeline Van Duijkeren, Arie Van Nes, Anky Schoormans, Marian
More informationDepartment of Microbiology, Maulana Azad Medical College, New Delhi, India
Review Article Indian J Med Res 140, September 2014, pp 339-344 Use of antibiotics in animal agriculture & emergence of methicillinresistant Staphylococcus aureus (MRSA) clones: need to assess the impact
More informationAntimicrobial Resistance and Molecular Epidemiology of Staphylococcus aureus in Ghana
Antimicrobial Resistance and Molecular Epidemiology of Staphylococcus aureus in Ghana Beverly Egyir, PhD Noguchi Memorial Institute for Medical Research Bacteriology Department, University of Ghana Background
More informationAnnual survey of methicillin-resistant Staphylococcus aureus (MRSA), 2014
Annual survey of methicillin-resistant Staphylococcus aureus (MRSA), 2014 Helen Heffernan, Sarah Bakker, Kristin Dyet, Deborah Williamson Nosocomial Infections Laboratory, Institute of Environmental Science
More informationAn investigation of resistance to β-lactam antimicrobials among staphylococci isolated from pigs with exudative epidermitis
Park et al. BMC Veterinary Research 2013, 9:211 RESEARCH ARTICLE Open Access An investigation of resistance to β-lactam antimicrobials among staphylococci isolated from pigs with exudative epidermitis
More informationVETERINARSKI ARHIV 81 (1), 91-97, 2011
VETERINARSKI ARHIV 81 (1), 91-97, 2011 In vitro activity of cefovecin, extended-spectrum cephalosporin, against 284 clinical isolates collected from cats and dogs in Croatia Branka Šeol*, Krešimir Matanović,
More informationPDF hosted at the Radboud Repository of the Radboud University Nijmegen
PDF hosted at the Radboud Repository of the Radboud University Nijmegen The following full text is a publisher's version. For additional information about this publication click this link. http://hdl.handle.net/2066/118324
More informationMethicillin-Resistant Staphylococcus aureus
Methicillin-Resistant Staphylococcus aureus By Karla Givens Means of Transmission and Usual Reservoirs Staphylococcus aureus is part of normal flora and can be found on the skin and in the noses of one
More informationDetection of Methicillin Resistant Strains of Staphylococcus aureus Using Phenotypic and Genotypic Methods in a Tertiary Care Hospital
International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 6 Number 7 (2017) pp. 4008-4014 Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2017.607.415
More informationInt.J.Curr.Microbiol.App.Sci (2018) 7(8):
International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 7 Number 08 (2018) Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2018.708.378
More informationAnnual survey of methicillin-resistant Staphylococcus aureus (MRSA), 2015
Annual survey of methicillin-resistant Staphylococcus aureus (MRSA), 2015 Helen Heffernan and Sarah Bakker Nosocomial Infections Laboratory, Institute of Environmental Science and Research Limited (ESR);
More informationDetection and quantification of methicillin-resistant Staphylococcus aureus (MRSA) clones in retail meat products
Letters in Applied Microbiology ISSN 0266-8254 ORIGINAL ARTICLE Detection and quantification of methicillin-resistant Staphylococcus aureus (MRSA) clones in retail meat products J.S. Weese 1, B.P. Avery
More informationMethicillin-resistant Staphylococcus aureus (MRSA) on Belgian pig farms
Methicillinresistant Staphylococcus aureus (MRSA) on Belgian pig farms Dewaele I., De Man I., Stael A., Delputte P., Butaye P., Vlaemynck G., Herman L., Heyndrickx M., Rasschaert G. 1 ILVO: Institute for
More informationGenotypic and Phenotypic Characterization of Staphylococcus. aureus from Wild Boars
AEM Accepts, published online ahead of print on 21 December 2012 Appl. Environ. Microbiol. doi:10.1128/aem.03189-12 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 1 2 3 4 Genotypic
More informationMRCoNS : .Duplex-PCR.
- ( ) - * (MRCoNS) : Vancomycin Resistant Coagulase Negative ) VRCoNS. (Vancomycin Intermediate Coagulase Negative Staphylococci) VICoNS (Staphylococci Methicillin-Resistant Coagulase ) MRCoNS.. VRCoNS
More informationOne issue associated with Staphylococcus aureus is the development of drug resistance.
Abstract One issue associated with Staphylococcus aureus is the development of drug resistance. A recently emerged strain of MRSA, ST398, has been identified as livestock-associated and transmission has
More informationINVESTIGATION OF PRESENCE OF METHICILLIN RESISTANT STAPHYLOCOCCI IN STUDENTS OF THE FACULTY OF VETERINARY MEDICINE AT THE UNIVERSITY OF BELGRADE
Original research paper UDK 616.98:371.212 INVESTIGATION OF PRESENCE OF METHICILLIN RESISTANT STAPHYLOCOCCI IN STUDENTS OF THE FACULTY OF VETERINARY MEDICINE AT THE UNIVERSITY OF BELGRADE Milan Rađenović
More informationIn vitro activity of tigecycline against methicillin-resistant Staphylococcus aureus, including livestock-associated strains
Eur J Clin Microbiol Infect Dis (2010) 29:503 507 DOI 10.1007/s10096-010-0886-2 ARTICLE In vitro activity of tigecycline against methicillin-resistant Staphylococcus aureus, including livestock-associated
More informationDepartment of Microbiology, School of Medicine, Isfahan University of Medical Sciences, Isfahan, Iran.
Volume 7 Number 3 (June 2015) 161-167 ORIGINAL ARTICLE Detection of meca and enterotoxin genes in Staphylococcus aureus isolates associated with bovine mastitis and characterization of Staphylococcal cassette
More informationNational MRSA Reference Laboratory
Author: Gráinne Brennan Date: 23/02/2017 Date of Issue: 23/02/2017 National MRSA Reference Laboratory User s Manual NMRSARL Users Manual Page 1 of 12 Table of Contents Page 1. Location... 3 2. Contact
More informationAbsence of LA-MRSA CC398 as nasal colonizer of pigs raised
AEM Accepts, published online ahead of print on 9 December 2011 Appl. Environ. Microbiol. doi:10.1128/aem.07260-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions.
More informationJanuary 2014 Vol. 34 No. 1
January 2014 Vol. 34 No. 1. and Minimum Inhibitory Concentration (MIC) Interpretive Standards for Testing Conditions Medium: diffusion: Mueller-Hinton agar (MHA) Broth dilution: cation-adjusted Mueller-Hinton
More informationTel: Fax:
CONCISE COMMUNICATION Bactericidal activity and synergy studies of BAL,a novel pyrrolidinone--ylidenemethyl cephem,tested against streptococci, enterococci and methicillin-resistant staphylococci L. M.
More informationMRSA in Animals and the Risk of Infection in Humans
International Journal of Global Health and Health Disparities Volume 6 Number 1 Article 9 2009 MRSA in Animals and the Risk of Infection in Humans Shannon Tucker Follow this and additional works at: http://scholarworks.uni.edu/ijghhd
More informationMicrobiological Surveillance of Methicillin Resistant Staphylococcus aureus (MRSA) in Belgian Hospitals in 2003
Microbiological Surveillance of Methicillin Resistant Staphylococcus aureus (MRSA) in Belgian Hospitals in 3 Final report Olivier Denis and Marc J. Struelens Reference Laboratory for Staphylococci Department
More informationDOI: /AVB H UDK :579.84:
Acta Veterinaria (Beograd), Vol. 61, No. 5-6, 585-590, 2011. DOI: 10.2298/AVB1106585H UDK 615.014.4.8:579.84:599.731.1 ANTIMICROBIAL SUSCEPTIBILITY OF ENTEROTOXIGENIC STRAINS OF ESCHERICHIA COLI ISOLATED
More informationFailure of Cloxacillin in a Patient with BORSA Endocarditis ACCEPTED
JCM Accepts, published online ahead of print on 30 December 2008 J. Clin. Microbiol. doi:10.1128/jcm.00571-08 Copyright 2008, American Society for Microbiology and/or the Listed Authors/Institutions. All
More informationPRESENCE OF Campylobacter coli IN SLAUGHTERED PIGS AND ITS RESISTANCE TO ANTIBIOTICS **
Biotechnology in Animal Husbandry 23 (5-6), p 403-410, 2007 ISSN 1450-9156 Publisher: Institute for Animal Husbandry, Belgrade-Zemun UDC 591.2 PRESENCE OF Campylobacter coli IN SLAUGHTERED PIGS AND ITS
More information56 Clinical and Laboratory Standards Institute. All rights reserved.
Table 2C 56 Clinical and Laboratory Standards Institute. All rights reserved. Table 2C. Zone Diameter and Minimal Inhibitory Concentration Breakpoints for Testing Conditions Medium: Inoculum: diffusion:
More informationEDUCATIONAL COMMENTARY - Methicillin-Resistant Staphylococcus aureus: An Update
EDUCATIONAL COMMENTARY - Methicillin-Resistant Staphylococcus aureus: An Update Educational commentary is provided through our affiliation with the American Society for Clinical Pathology (ASCP). To obtain
More informationFrequency of MecA, Van A and Van B Genes in Staphylococcus aureus isolates among pediatric clinical specimens in Khartoum Hospitals 2017
EUROPEAN ACADEMIC RESEARCH Vol. VI, Issue 3/ June 2018 ISSN 2286-4822 www.euacademic.org Impact Factor: 3.4546 (UIF) DRJI Value: 5.9 (B+) Frequency of MecA, Van A and Van B Genes in Staphylococcus aureus
More informationA potential diagnostic problem: The Newly Emerging mecc Methicillin-Resistant Staphylococcus aureus strains
IOSR Journal of Pharmacy and Biological Sciences (IOSR-JPBS) e-issn: 2278-3008, p-issn:2319-7676. Volume 10, Issue 5 Ver. III (Sep - Oct. 2015), PP 84-93 www.iosrjournals.org A potential diagnostic problem:
More informationSTAPHYLOCOCCI: KEY AST CHALLENGES
Romney Humphries, PhD D(ABMM) Section Chief, UCLA Clinical Microbiology Los Angeles CA rhumphries@mednet.ucla.edu STAPHYLOCOCCI: KEY AST CHALLENGES THE CHALLENGES detection of penicillin resistance detection
More informationSupplemental Information. Discovery of Reactive Microbiota-Derived. Metabolites that Inhibit Host Proteases
Cell, Volume 168 Supplemental Information Discovery of Reactive Microbiota-Derived Metabolites that Inhibit Host Proteases Chun-Jun Guo, Fang-Yuan Chang, Thomas P. Wyche, Keriann M. Backus, Timothy M.
More informationHelen Heffernan and Sarah Bakker Nosocomial Infections Laboratory, Institute of Environmental Science and Research Limited (ESR); October 2018
2017 survey of methicillin-resistant Staphylococcus aureus (MRSA) Helen Heffernan and Sarah Bakker Nosocomial Infections Laboratory, Institute of Environmental Science and Research Limited (ESR); October
More informationPresence of extended spectrum β-lactamase producing Escherichia coli in
1 2 Presence of extended spectrum β-lactamase producing Escherichia coli in wild geese 3 4 5 A. Garmyn* 1, F. Haesebrouck 1, T. Hellebuyck 1, A. Smet 1, F. Pasmans 1, P. Butaye 2, A. Martel 1 6 7 8 9 10
More informationSCIENTIFIC REPORT OF EFSA
EFSA Journal 2012;10(10):2897 SCIENTIFIC REPORT OF EFSA Technical specifications on the harmonised monitoring and reporting of antimicrobial resistance in methicillin-resistant Staphylococcus aureus in
More informationAlarming Proportions of Methicillin-Resistant Staphylococcus aureus (MRSA) in Wound Samples from Companion Animals, Germany
Alarming Proportions of Methicillin-Resistant Staphylococcus aureus (MRSA) in Wound Samples from Companion Animals, Germany 2010 2012 Szilvia Vincze 1 *, Ivonne Stamm 2, Peter A. Kopp 2, Julia Hermes 3,
More informationResearch Article Genotyping of Methicillin Resistant Staphylococcus aureus Strains Isolated from Hospitalized Children
International Pediatrics, Article ID 314316, 4 pages http://dx.doi.org/10.1155/2014/314316 Research Article Genotyping of Methicillin Resistant Staphylococcus aureus Strains Isolated from Hospitalized
More informationDetection of (meca)gene in methicillin resistant Staphylococcus aureus (MRSA) at Prince A / Rhman Sidery Hospital, Al-Jouf, Saudi Arabia
Journal of Medical Genetics and Genomics Vol. 3 (3) pp. 41-45, March 211 Available online http://www.academicjournals.org/jmgg ISSN 2141-2278 211 Academic Journals Full Length Research Paper Detection
More information*Corresponding Author:
Original Research Article DOI: 10.18231/2394-5478.2017.0098 Prevalence and factors associated with the nasal colonization of Staphylococcus aureus and Methicillin-Resistant Staphylococcus aureus among
More informationMethicillin-Resistant Staphylococcus aureus (MRSA) in Food. Production Animals
Methicillin-Resistant Staphylococcus aureus (MRSA) in Food Production Animals W. VANDERHAEGHEN 1,2 K. HERMANS 2 F. HAESEBROUCK 2 P. BUTAYE 1,2 1 Operational Directorate of Bacterial Diseases, Veterinary
More informationKey words: Campylobacter, diarrhea, MIC, drug resistance, erythromycin
Key words: Campylobacter, diarrhea, MIC, drug resistance, erythromycin Table 1 Detection rate of Campylobacter from stool samples taken from sporadic diarrheic patients Table 2 Detection rates of Campylobacter
More informationAPPENDIX III - DOUBLE DISK TEST FOR ESBL
Policy # MI\ANTI\04\03\v03 Page 1 of 5 Section: Antimicrobial Susceptibility Testing Manual Subject Title: Appendix III - Double Disk Test for ESBL Issued by: LABORATORY MANAGER Original Date: January
More informationVolume-7, Issue-2, April-June-2016 Coden IJABFP-CAS-USA Received: 5 th Mar 2016 Revised: 11 th April 2016 Accepted: 13 th April 2016 Research article
Volume-7, Issue-2, April-June-2016 Coden IJABFP-CAS-USA Copyrights@2016 Received: 5 th Mar 2016 Revised: 11 th April 2016 Accepted: 13 th April 2016 Research article A STUDY ON ANTIBIOTIC SUSCEPTIBILITY
More informationFinnzymes Oy. PathoProof Mastitis PCR Assay. Real time PCR based mastitis testing in milk monitoring programs
PathoProof TM Mastitis PCR Assay Mikko Koskinen, Ph.D. Director, Diagnostics, Finnzymes Oy Real time PCR based mastitis testing in milk monitoring programs PathoProof Mastitis PCR Assay Comparison of the
More informationStaphylococcus aureus
The National Reference Centre (NRC) for S. aureus of Université Libre de Bruxelles (ULB) provides the following tasks: - Identification and antimicrobial susceptibility testing of Staphylococcus sp. strains
More informationTitle: Analysis of borderline oxacillin resistant Staphylococcus aureus (BORSA) isolated in
JCM Accepts, published online ahead of print on 18 July 2012 J. Clin. Microbiol. doi:10.1128/jcm.01354-12 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 Title: Analysis of
More informationLA-MRSA in the Netherlands: the past, presence and future.
LA-MRSA in the Netherlands: the past, presence and future. Prof. Jaap Wagenaar DVM, PhD With input from Prof. Jan Kluytmans MD, PhD Department of Infectious Diseases and Immunology, Faculty of Veterinary
More informationDodatak Sertifikatu o akreditaciji broj: Li Annex to Accreditation Certificate Number: Standard: MEST EN ISO/IEC :2011
Dodatak Sertifikatu o akreditaciji broj: Li 11.14 Annex to Accreditation Certificate Number: Standard: MEST EN ISO/IEC 17025 :2011 Datum dodjele/ obnavljanja akreditacije: Date of granting/ renewal of
More informationNasal Carriage Rates of Methicillin Resistant Staphylococcus aureus in Healthy Individuals from a Rural Community in Southeastern United States
World Journal of Medical Sciences 4 (2): 65-69, 2009 ISSN 1817-3055 IDOSI Publications, 2009 Nasal Carriage Rates of Methicillin Resistant Staphylococcus aureus in Healthy Individuals from a Rural Community
More informationMethicillin and Clindamycin resistance in biofilm producing staphylococcus aureus isolated from clinical specimens
Original article Methicillin and Clindamycin resistance in biofilm producing staphylococcus aureus isolated from clinical specimens Pankaj A. Joshi, Dhruv K.Mamtora,. Neeta PJangale., Meena N.Ramteerthakar,
More informationBlake W. Buchan, PhD, 1 and Nathan A. Ledeboer, PhD, D(ABMM) 1,2. Abstract
Microbiology and Infectious Disease / Borderline Resistant Strains of S AUREUS Identification of Two Borderline Oxacillin-Resistant Strains of Staphylococcus aureus From Routine Nares Swab Specimens by
More informationDetection of inducible clindamycin resistance among clinical isolates of Staphylococcus aureus in a tertiary care hospital
ISSN: 2319-7706 Volume 3 Number 9 (2014) pp. 689-694 http://www.ijcmas.com Original Research Article Detection of inducible clindamycin resistance among clinical isolates of Staphylococcus aureus in a
More informationImpact of livestock-associated MRSA in a hospital setting
van de Sande-Bruinsma et al. Antimicrobial Resistance and Infection Control (2015) 4:11 DOI 10.1186/s13756-015-0053-8 RESEARCH Open Access Impact of livestock-associated MRSA in a hospital setting Nienke
More informationInt.J.Curr.Microbiol.App.Sci (2016) 5(12):
International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 5 Number 12 (2016) pp. 644-649 Journal homepage: http://www.ijcmas.com Original Research Article http://dx.doi.org/10.20546/ijcmas.2016.512.071
More informationMRSA CC398. Erwin Verkade
Characterization of livestock-associated MRSA CC398 detection, transmission & virulence Erwin Verkade 2014 Colofon ISBN 978-94-6169-511-6 Lay-out thesis by Erwin Verkade Design cover by Kelly Reijnders
More informationEvaluation of a computerized antimicrobial susceptibility system with bacteria isolated from animals
J Vet Diagn Invest :164 168 (1998) Evaluation of a computerized antimicrobial susceptibility system with bacteria isolated from animals Susannah K. Hubert, Phouc Dinh Nguyen, Robert D. Walker Abstract.
More informationRESEARCH NOTE COMMUNITY-ACQUIRED METHICILLIN-RESISTANT STAPHYLOCOCCUS AUREUS IN A MALAYSIAN TERTIARY CENTRE
RESEARCH NOTE COMMUNITY-ACQUIRED METHICILLIN-RESISTANT STAPHYLOCOCCUS AUREUS IN A MALAYSIAN TERTIARY CENTRE Zetti Zainol Rashid 1, Norazlah Bahari 1, Amizah Othman 1, Roslinda Jaafar 1, Nurul Azmawati
More informationChanging epidemiology of methicillin-resistant Staphylococcus aureus colonization in paediatric intensive-care units
Washington University School of Medicine Digital Commons@Becker Open Access Publications 2012 Changing epidemiology of methicillin-resistant Staphylococcus aureus colonization in paediatric intensive-care
More informationHigh occurrence of methicillin-resistant Staphylococcus aureus ST398 in equine nasal samples
Available online at www.sciencedirect.com Veterinary Microbiology 133 (2009) 138 144 www.elsevier.com/locate/vetmic High occurrence of methicillin-resistant Staphylococcus aureus ST398 in equine nasal
More informationPrevalence and Molecular Characteristics of Methicillin-resistant Staphylococcus aureus Isolates in a Neonatal Intensive Care Unit
Journal of Bacteriology and Virology 2016. Vol. 46, No. 2 p.99 103 http://dx.doi.org/10.4167/jbv.2016.46.2.99 Communication Prevalence and Molecular Characteristics of Methicillin-resistant Staphylococcus
More informationSUSCEPTIBILITY OF RESPIRATORY ISOLATES OF STREPTOCOCCUS PNEUMONIAE ISOLATED FROM CHILDREN HOSPITALIZED IN THE CLINICAL CENTER NIŠ
110 Dinić MM, et al. Susceptibility of Streptococcus Pneumoniae Institute for Public Health Niš 1 Clinical Center Niš 2 Professional article Stručni članak UDK 615.33.07:579.86 UDK 616.24-002-085 DOI:
More informationOriginal Article. Suthan Srisangkaew, M.D. Malai Vorachit, D.Sc.
Original Article Vol. 21 No.1 The optimum agent for ESBL screening and confirmatory tests:- Srisangkaew S & Vorachit M. 1 The Optimum Agent for Screening and Confirmatory Tests for Extended-Spectrum Beta-Lactamases
More informationEmergence of MRSA of unknown origin in the Netherlands
ORIGINAL ARTICLE EPIDEMIOLOGY Emergence of MRSA of unknown origin in the Netherlands W. S. N. Lekkerkerk 1,2, N. van de Sande-Bruinsma 2, M. A. B. van der Sande 2,3, A. Tjon-A-Tsien 4, A. Groenheide 1,
More informationTitle. CitationJapanese Journal of Veterinary Research, 62(4): 163- Issue Date DOI. Doc URL. Type. File Information /jjvr.62.4.
Title Characterization of methicillin-resistant Staphyloco Author(s)Jang, Yunho; Bae, Dong hwa; Cho, Jae-Keun; Bahk, Gyu CitationJapanese Journal of Veterinary Research, 62(4): 163- Issue Date 2014-11
More informationAntimicrobial Resistance Strains
Antimicrobial Resistance Strains Microbiologics offers a wide range of strains with characterized antimicrobial resistance mechanisms including: Extended-Spectrum β-lactamases (ESBLs) Carbapenamases Vancomycin-Resistant
More informationAbstract. Background. Editor: G. Lina
ORIGINAL ARTICLE BACTERIOLOGY Evidence of transmission of a Panton Valentine leukocidin-positive community-acquired methicillin-resistant Staphylococcus aureus clone: a family affair P. Cocchi 1, G. Taccetti
More informationNasal Colonization of Humans with Methicillin-Resistant Staphylococcus aureus (MRSA) CC398 with and without Exposure to Pigs
Nasal Colonization of Humans with Methicillin-Resistant Staphylococcus aureus (MRSA) CC398 with and without Exposure to Pigs Christiane Cuny 1, Rolf Nathaus 3, Franziska Layer 1, Birgit Strommenger 1,
More informationPigs as Source of Methicillin- Resistant Staphylococcus aureus CC398 Infections in Humans, Denmark
Pigs as Source of Methicillin- Resistant Staphylococcus aureus CC398 Infections in Humans, Denmark Hannah C. Lewis, Kåre Mølbak, Catrin Reese, Frank M. Aarestrup, Mette Selchau, Marit Sørum, and Robert
More informationGeoffrey Coombs 1, Graeme Nimmo 2, Julie Pearson 1, Samantha Cramer 1 and Keryn Christiansen 1
Community Onset MRSA Infections in Australia: A Tale of Two Clones Geoffrey Coombs 1, Graeme Nimmo 2, Julie Pearson 1, Samantha Cramer 1 and Keryn Christiansen 1 Community Associated MRSA First isolated
More informationStudy Type of PCR Primers Identified microorganisms
Study Type of PCR Primers Identified microorganisms Portillo et al, Marín et al, Jacovides et al, Real-time multiplex PCR (SeptiFasta, Roche Diagnostics) 16S rr gene was amplified using conventional PCR.
More informationVETERINARSKI ARHIV 84 (3), , 2014
. VETERINARSKI ARHIV 84 (3), 205-214, 2014 The prevalence of methicillin resistance and Panton-Valentine leukocidin synthesis genes in Staphylococcus aureus isolates of bovine and human origin Marija J.
More informationACCEPTED. Association between staphylococcal PVL gene and a lower inhospital. survival in Pulmonary Patients. Spain. Científicas (CSIC), Madrid, Spain
JCM Accepts, published online ahead of print on 8 November 006 J. Clin. Microbiol. doi:10.118/jcm.003-06 Copyright 006, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights
More informationAntimicrobial Activity of Ceftaroline and ME1036 Tested against Clinical Strains of Community-Acquired ACCEPTED. Helio S Sader 1,2 *,
AAC Accepts, published online ahead of print on 7 January 2008 Antimicrob. Agents Chemother. doi:10.1128/aac.01351-07 Copyright 2008, American Society for Microbiology and/or the Listed Authors/Institutions.
More informationSTAPHYLOCOCCI: KEY AST CHALLENGES
Romney Humphries, PhD D(ABMM) Section Chief, UCLA Clinical Microbiology Los Angeles CA rhumphries@mednet.ucla.edu STAPHYLOCOCCI: KEY AST CHALLENGES THE CHALLENGES detection of penicillin resistance detection
More informationMRSA found in British pig meat
MRSA found in British pig meat The first evidence that British-produced supermarket pig meat is contaminated by MRSA has been found in new research commissioned by The Alliance to Save Our Antibiotics
More informationStaphylococcus aureus Programme 2007 (SAP 2007) Hospital Survey MRSA Epidemiology and Typing Report
AGAR The Australian Group on Antimicrobial Resistance http://antimicrobial-resistance.com Staphylococcus aureus Programme 2007 (SAP 2007) Hospital Survey MRSA Epidemiology and Typing Report PREPARED BY:
More informationHigh prevalence of nasal MRSA carriage in slaughterhouse workers in contact with live pigs in The Netherlands
Epidemiol. Infect. (2010), 138, 756 763. f Cambridge University Press 2010 doi:10.1017/s0950268810000245 High prevalence of nasal MRSA carriage in slaughterhouse workers in contact with live pigs in The
More informationThis is an author version of the contribution published on: Corcione S,Motta I,Fossati L,Campanile F,Stefani S,Cavallo R,Di Perri G,Ranieri VM,De Rosa FG Molecular epidemiology of methicillin-resistant
More informationStaphylococcal Cassette Chromosome mec Types and Staphylococcus aureus Isolates from Maharaj Nakorn Chiang Mai Hospital
Staphylococcal Cassette Chromosome mec Types and Antibiogram of Methicillin-Resistant Staphylococcus aureus Isolates from Maharaj Nakorn Chiang Mai Hospital ชน ดของสแตฟฟ ลโลคอคคอล คาสเซทโครโมโซมเมค เมค
More informationSpread of a methicillin-resistant Staphylococcus aureus ST80 strain in the community of the northern Netherlands
Eur J Clin Microbiol Infect Dis (2007) 26:723 727 DOI 10.1007/s10096-007-0352-y CONCISE ARTICLE Spread of a methicillin-resistant Staphylococcus aureus ST80 strain in the community of the northern Netherlands
More informationThe population structure of Staphylococcus aureus among general practice patients from The Netherlands
Postprint Version 1.0 Journal website http://www3.interscience.wiley.com/journal/121668164/abstract Pubmed link http://www.ncbi.nlm.nih.gov/pubmed/19178545 DOI 10.1111/J.1469-0691.2008.02662.X The population
More informationDOI: /AVB G UDK 619: :
Acta Veterinaria (Beograd), Vol. 6, No., 2-3, 20. DOI: 0.2298/AVB002G UDK 69:66.98:48.65.33 INVESTIGATION OF THE SENSITIVITY OF E. COLI STRAINS ISOLATED FROM DOMESTIC ANIMALS TO ANTIBIOTICS AND HEMIOTHERAPEUTICS
More informationNasal Carriage of Staphylococcus aureus in Healthy Adults and in School Children
ACTA FACULTATIS MEDICAE NAISSENSIS DOI: 10.2478/v10283-012-0033-3 UDC: 616.211-053.2-053.8:579.8 Scientific Journal of the Faculty of Medicine in Niš 2013;30(1):31-36 Original article Nasal Carriage of
More informationSCOTTISH MRSA REFERENCE LABORATORY
Title SCOTTISH MRSA REFERENCE LABORATORY LABORATORY PROCEDURE NUMBER / VERSION User Manual DATE OF ISSUE 20/01/2017 REVIEW INTERVAL AUTHORISED BY AUTHOR 1 Year Dr. B. Jones Dr E. Dickson COPY 1 of 1 Master
More informationSaxena Sonal*, Singh Trishla* and Dutta Renu* (Received for publication January 2012)
J. Commun. Dis. 44(2) 2012 : 97-102 Practical disk diffusion method for detection of inducible clindamycin resistance in Staphylococcus aureus at a tertiary care hospital: Implications for clinical therapy
More informationOriginal Article. Suwanna Trakulsomboon, Ph.D., Visanu Thamlikitkul, M.D.
Original Article Vol. 25 No. 2 In vitro activity of daptomycin against MRSA:Trakulsomboon S & Thamlikitkul V. 57 In Vitro Activity of Daptomycin against Methicillin- Resistant Staphylococcus aureus (MRSA)
More informationEvaluation of methicillin-resistant Staphylococcus aureus nasal carriage in Malagasy patients
Original Article Evaluation of methicillin-resistant Staphylococcus aureus nasal carriage in Malagasy patients Tsiry Rasamiravaka, Saida Rasoanandrasana, Norosoa Julie Zafindraibe, Aimée Olivat Rakoto
More informationGHI-Thailand Dairy farming in Chiang Mai, Thailand. Khwanchai Kreausukon Faculty of Veterinary Medicine Chiang Mai University
GHI-Thailand 2012 Dairy farming in Chiang Mai, Thailand Khwanchai Kreausukon Faculty of Veterinary Medicine Chiang Mai University History of Dairy farming in Thailand The conventional dairy farming was
More informationSTAPHYLOCOCCI: KEY AST CHALLENGES
Romney Humphries, PhD D(ABMM) Section Chief, UCLA Clinical Microbiology Los Angeles CA rhumphries@mednet.ucla.edu STAPHYLOCOCCI: KEY AST CHALLENGES THE CHALLENGES detection of penicillin resistance detection
More informationThe population structure of Staphylococcus aureus among general practice patients from The Netherlands
ORIGINAL ARTICLE 10.1111/J.1469-0691.2008.02662.X The population structure of Staphylococcus aureus among general practice patients from The Netherlands G. A. Donker 1, R. H. Deurenberg 2, C. Driessen
More informationMETODE ZA ODREĐIVANJE ANTIMIKROBNE REZISTENCIJE KOD MIKROORGANIZAMA U HRANI
Ветеринарски журнал Републике Српске Veterinary Journal of Republic of Srpska (Бања Лука-Banja Luka), Вол/Vol.XVIII, Бр/No.1, 207 224, 2018 207 DOI: 10.7251/VETJ1801207L UDK: 614.31:641/642 Pregledni naučni
More information