PROBE DESIGN FOR ENVIRONMENTAL DNA DETECTION OF CHELODINA OBLONGA IN THE CAPE YORK REGION
|
|
- Leo Simmons
- 6 years ago
- Views:
Transcription
1 edna Probe Design for Chelodina oblonga -TropWATER Report no. 17/36 PROBE DESIGN FOR ENVIRONMENTAL DNA DETECTION OF CHELODINA OBLONGA IN THE CAPE YORK REGION Roger Huerlimann, Agnès Le Port, Damien Burrows, Dean Jerry Report No. 17/36 May
2 PROBE DESIGN FOR ENVIRONMENTAL DNA DETECTION OF CHELODINA OBLONGA IN THE CAPE YORK REGION A Report for Balkanu Aboriginal Corporation Report No. 17/36 May 2017 Prepared by Roger Huerlimann, Agnès Le Port, Damien Burrows and Dean Jerry Centre for Tropical Water & Aquatic Ecosystem Research (TropWATER) James Cook University Townsville Phone : (07) TropWATER@jcu.edu.au Web: 2
3 Information should be cited as: Huerlimann R, Le Port A, Burrows D and Jerry, D Probe Design for Environmental DNA Detection of Chelodina oblonga in the Cape York Region. Report 17/36 Centre for Tropical Water and Aquatic Ecosystem Research (TropWATER), James Cook University, Townsville. For further information contact: Centre for Tropical Water and Aquatic Ecosystem Research (TropWATER) James Cook University ATSIP Building 145 Townsville QLD 4811 This publication has been compiled by the Centre for Tropical Water and Aquatic Ecosystem Research (TropWATER), James Cook University. James Cook University, Except as permitted by the Copyright Act 1968, no part of the work may in any form or by any electronic, mechanical, photocopying, recording, or any other means be reproduced, stored in a retrieval system or be broadcast or transmitted without the prior written permission of TropWATER. The information contained herein is subject to change without notice. The copyright owner shall not be liable for technical or other errors or omissions contained herein. The reader/user accepts all risks and responsibility for losses, damages, costs and other consequences resulting directly or indirectly from using this information. Enquiries about reproduction, including downloading or printing the web version, should be directed to TropWATER@jcu.edu.au. 3
4 TABLE OF CONTENTS 1 BACKGROUND AND OBJECTIVE METHODOLOGY AND RESULTS General Concept of Species-Specific Probe Review of Existing and New Sequencing Information Sample Collection, DNA Extraction and Sequencing Species-Specific Probe Design Quantitative PCR Conditions and Optimisation General qpcr conditions Probe efficiency testing Exclusion testing SUMMARY REFERENCES... 9 APPENDIX 1 List of available turtle sequences APPENDIX 2 Probe sequence details
5 1 BACKGROUND AND OBJECTIVE All animals constantly shed traces of their DNA into the environment. This DNA is termed environmental DNA (edna). By analysing water (or soil) samples for this DNA, scientists can determine the presence of that animal without the need to capture any individuals. Thus, the presence of those animals can be determined simply by collecting a water sample for analysis. This has many benefits, especially where the animals are difficult to catch, require specialised equipment to catch, or where it may be dangerous to attempt to catch those animals (for example where crocodiles are present). In remote or difficult to access locations, collecting water samples for edna analysis is often quicker and cheaper than attempting to catch or observe the animals themselves. Thus, this method can be used for regular monitoring across a wide range of locations. To utilise edna methods in field monitoring, it is first necessary to locate a genetic marker that is unique to the species of interest. This marker is termed a genetic probe and when it is detected in water samples, it provides clear evidence of the presence of that species of interest. Genetic markers or probes need to be developed for each species individually. In time, if such markers are developed for all species, the presence or absence of all species in a waterhole could potentially be detected from a single water sample. For the current project, a series of waterholes on Cape York have been fenced to protect them against feral pig disturbance. The turtles that inhabit these waterholes are of particular value to the local indigenous people and they wish to understand if the fencing of the waterholes has been of benefit to turtle populations. As the waterholes are remote and crocodiles may be present, edna may be a useful way of monitoring turtle populations. Thus the aim of current project was to design a probe to reliably detect the presence of northern snake-necked turtles (Chelodina oblonga) in the ephemeral floodplain lagoons in the Cape York region using environmental DNA. Designing a species-specific probe is the first step in any edna detection project. In order to design a genetic edna probe that detects this turtle and no other species, we needed to collect genetic sequence data for this species and also other turtle species that occur in the same area. 2 METHODOLOGY AND RESULTS 2.1 General Concept of Species-Specific Probe In order to assure probe reliability, there are two kinds of errors that need to be tested for. False positives occur when the presence of another turtle species (called exclusion species), that is not the target species, is falsely detected. This depends on the specificity of the probe to the target species and can be difficult to achieve with closely related species. False negatives occur when the target species is present, but not detected. There are two possible causes for false negatives. Firstly, they occur if the probe does not match an individual turtle being tested, for example in populations that are distantly related to the target population, or when the targets are present at very low abundance (below the detection limit). It is therefore important to design the probe to appropriately include the target species, while excluding all other species. In order to design the species specific probes, DNA sequence information for the target and exclusion species needs to be collected. Generally, genes located on the mitochondrial genome are preferred, since they are present at higher copy numbers in each cell, and therefore easier to detect. 5
6 2.2 Review of Existing and New Sequencing Information Geneious (Version R10, Kearse et al., 2012) was used to search the publicly available National Center for Biotechnology Information (NCBI database) for sequences of mitochondrial genes. Date of last access was on 29/07/2016. This search focused on 25 different species of turtles native to Australia and one exotic species (see Appendix 1 for list of available sequences). Genetic sequence information for northern snake-necked turtles (C. oblonga) was found, but only from individuals collected outside the Cape York region. While useful, these sequences might not reflect the genetic diversity of the target species in the target region. Therefore it was necessary to obtain tissue samples of C. oblonga from the Cape York region for sequencing (see section 2.3). We also obtained publicly-available gene sequences of the following turtle species that cooccurr with C. oblonga in the Cape York region: Emydura subglobosa subglobosa, Emydura s. worrelli, Emydura tanybaraga, and Pelochelys bibroni. No sequences were found for the closely related, co-occuring species Chelodina canni, which is of high importance as it is often found in the same waterholes as C. oblonga. In the absence of publicly-available sequences for C. canni, we obtained our own via a tissue sample from an individual C. canni from the Archer River region, Cape York (see section 2.3). We also found sequences for the following turtle species that are co-occuring with C. oblonga outside of the Cape York region: Carettochelys insculpta, Elseya dentata, Elseya lavarackorum, Emydura victoriae, and Wollumbinia latisternum. Lastly, even though they do not co-occur with C. oblonga in any part of their range, we obtained sequences of an additional 15 Australian turtle species to be sure our probe for the C. oblonga was unique to that species. A detailed list of available sequences can be found in Appendix Sample Collection, DNA Extraction and Sequencing To obtain DNA for probe development and validation, hind leg skin tissue samples from 23 Chelodina oblonga, one C. canni, six Emydura s. worrelli, four Myuchelys latisternum were collected from the Archer River and Kalan wetland areas (Cape York), as well as two Rheodytes leukops from the Fitzroy Barrage (central Qld), and two Elseya lavarackorum from Gregory River (NW Qld) (Table 1). The Chelodina spp. DNA was collected for sequencing and PCR testing, while the DNA of the other species was collected for PCR testing only. Total genomic DNA was extracted from the preserved tissues through CTAB extraction (Doyle and Doyle, 1987). In short, an approximately 2x2 mm piece of tissue was lysed for 2 hours in 700 µl CTAB buffer with 20 µl Proteinase K. After two washes with an equal amount of Chloroform:Isoamyl alcohol, the DNA was precipitated for 1 hour with isopropanol at -20 C and subsequently centrifuged for 30 min at 16,000 x g. After two washes with 70% ethanol, the samples were dried and reconstituted in 50 µl TE buffer. To supplement the existing, publicly available sequences, an additional 20 samples for C. oblonga and one sample for C. canni were sequenced (Table 1). For PCR amplification, the following primer pairs were used for 16S: Forward GCCTGTTTAYCAAAAACATCGC, Reverse CCGGTCTGAACTCAGATCACGT and COI: Forward AAYCAYAAAGAYATYGGYACCCT, Reverse CTTCTGGGTGNCSRAARAAYCA. Sequencing was carried out at the Australian Genome Research Facility in Brisbane. 6
7 Table 1 List of species for which tissue samples were collected, number of samples that were extracted, and number of samples that were sequenced Species name Common name # samples # Samples sequenced extracted (16S and COI) Chelodina oblonga Northern snake-necked turtle Chelodina canni Cann s snake-necked turtle 1 1 Emydura subglobosa worrelli Diamond-headed turtle 6 - Wollumbinia latisternum Saw-shelled turtle 4 - Rheodytes leukops Fitzroy River turtle 2 - Elseya lavarackorum Gulf snapping turtle Species-Specific Probe Design For probe design, Geneious (Version R10, Kearse et al., 2012) was used for sequence processing and in-silico testing (collection, curation, alignment, tree building) and AlleleID (V7, Premier Biosoft) was used to design probes. After assessing the genetic information, we decided to focus on the C. oblonga sequences collected by us in the Cape York region for the probe design. Most publicly available C. oblonga sequences, all of which were collected from outside the Cape York region, differed from the Cape York sequences we obtained. This was either due to natural genetic variation between the different populations or species misidentification. This probe is therefore specifically designed for C. oblonga occurring in the Cape York region. While this probe could be used on this species outside of Cape York, it is advisable to collect and sequence additional C. oblonga tissue samples from other regions to validate the occurrence of potential false negative results. We investigated the COI and 16S genes to design this probe. Due to the close relatedness of the listed turtle species in general, and C. oblonga and C. canni specifically, the locations of where a probe could be placed were limited. To design the probes, the collected sequences for the two different genes were individually aligned in Geneious using MUSCLE and curated for sequence quality and sequence length. The aligned sequences where then loaded into AlleleID to determine the optimal probe location in each gene using the Taxa Specific/Cross Species TaqMan Design option in the TaqMan MGB probe design tool. The probes suggested by AlleleID were then compared to the alignments in Geneious for visual control and the best location was determined to be in the 16S region. See Appendix 2 for details on the probe sequences. 2.5 Quantitative PCR Conditions and Optimisation General qpcr conditions The C. oblonga probe was manufactured by Applied Biosystems (Thermo Fisher Scientific) and TaqMan Environmental Master Mix 2.0 (Thermo Fisher Scientific) was used for the qpcr reactions. The optimal annealing temperature for the primers associated with the probe was determined through a gradient PCR from 55 C to 65 C using genomic DNA of C. oblonga as a template. The gradient PCR showed that the primers are performing well up to 59 C, using C. oblonga genomic DNA as a template (Fig. 1). 7
8 Fig. 1 Gradient PCR for C. oblonga primers Each qpcr reaction was carried out with 10 µl environmental master mix, 4 µl water, 1 µl probe and 5 µl sample, resulting in a total reaction volume of 20 µl on a Rotorgene qpcr thermocycler (QIAGEN). Based on the gradient PCR and initial probe efficiency testing (see 2.5.2), the optimal PCR cycling protocol was determined to be 30 seconds at 58 C, followed by 30 seconds at 60 C, for 50 cycles (Table 2). These conditions were used for the final probe efficiency testing and species exclusion testing. Table 2 qpcr cycling protocol used for qpcr Step Temp Time Cycles Initial denaturation 95 C 10 min 1 Denaturation 95 C 15 s Annealing 58 C 30 s Extension 60 C 30 s Probe efficiency testing In qpcr, efficiency is a measure of how well a probe is amplifying the target species and can range from 0% to 100%. Under ideal conditions; efficiency will be 100%, which equals to one doubling per PCR cycle; however, an efficiency as low as 80% is still acceptable for a presence/absence assay like the one that is being developed here. To determine the efficiency of the C. oblonga probe, we made a standard curve ranging from 2 ng/µl to 2 *10-7 ng/ul of genomic DNA in the original sample. For this, we used a dilution series with a ten-fold dilution each step for 8 standards. Out of the eight standards, only the first five returned acceptable amplification. This is in line with probe assays that TropWATER has developed for tilapia and barramundi. The efficiency was 84%, which is in the acceptable range for this assay (Fig. 2). Standard five reflects the lower detection limit and is equivalent to 0.2 pg/ul genomic DNA in the original sample. The R 2 value of is on the low side, but is in the acceptable range for this type of assay (Fig. 5). 8
9 Fig. 2 Standard curve with five standards using C. oblonga genomic DNA to determine range, detection limit and efficiency Exclusion testing To test whether the probe is specific to C. oblonga only, we ran a qpcr using genomic DNA from multiple individuals of five other turtle species consisting of one C. canni, two Elseya lavarackorum, two Emydura s. worrelli, one Myuchelys latisternum, and two Rheodytes leukops in triplicates using general qpcr conditions outlined above. No false positives were detected for M. latisternum, R. leukops, and E. lavarackorum. While C. canni did not come up as a false positive, it did show a small response below the detection limit which should not interfere with the use of the probe. Lastly, Emydura s. worrelli came up as a false positive, but only irregularly and at DNA concentrations much higher than expected in the wild; however, this is pending the evaluation of the probe with actual edna samples collected from the field which is a recommended next step. 3 SUMMARY The purpose of this small pilot project was to develop an edna probe for northern snakenecked turtles (Chelodina oblonga) in the Cape York region. The species specific probe was tested for its performance, consistent detection limit and exclusion of other turtle species. The probe passed the performance test and consistently detected the target species in a laboratory setting. The probe is therefore successful in detecting C. oblonga using TaqMan qpcr. However, before this probe is used in monitoring, a study should be carried out to assess its performance in the field. This project was focused on the laboratory analytical work but there are many factors that affect the successful collection and detection probability of edna in the field and these should be investigated as part of any monitoring program for C. oblonga. 4 REFERENCES Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M., Sturrock, S., Buxton, S., Cooper, A., Markowitz, S., Duran, C., Thierer, T., Ashton, B., Mentjies, P., & Drummond, A. (2012). Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics, 28: Doyle JJ & Doyle JL (1987). A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin, 19:
10 APPENDIX 1 LIST OF AVAILABLE TURTLE SEQUENCES edna Probe Design for Chelodina oblonga -TropWATER Report no. 17/36 Last accessed: 29/07/2016 Genes Complete Species Common Name Importance COI 12S 16S Cytb ND4 Mitochondrial Carettochelys insculpta Pig-nosed turtle Exclusion species Chelodina burrungandjii Sandstone snake-necked Turtle Chelodina canni Cann's snake-necked turtle Exclusion species Chelodina expansa Broad-shelled long-necked turtle Chelodina longicollis Eastern long-necked turtle Chelodina rugosa/oblonga Northern snake-necked turtle Target species Chelodina steindachneri Dinner-plate turtle Elseya albagula White-throated snapping turtle Elseya dentata Northern snapping turtle Exclusion species Elseya irwini Irwin's turtle Elseya lavarackorum Gulf snapping turtle Exclusion species Elusor macrurus Mary River turtle Emydura m. krefftii Krefft s River Turtle Emydura s. subglobosa Red-bellied short-necked turtle Exclusion species Emydura s. worrelli Diamond headed turtle Exclusion species Emydura tanybaraga Yellow-faced turtle Exclusion species Emydura victoriae Red-faced turtle Exclusion species Macrodiremys collei South-western snake-necked turtle Pelochelys bibroni New Guinea giant softshell turtle Exclusion species Pseudemydura umbrina Western swamp turtle Rheodytes leukops Fitzroy River turtle Trachemys scripta Pond slider Wollumbinia bellii Namoi River snapping turtle Wollumbinia georgesi Bellinger River snapping turtle Wollumbinia latisternum Saw-shelled turtle Exclusion species Wollumbinia purvisi Manning River turtle
11 APPENDIX 2 PROBE SEQUENCE DETAILS PCR Fragment information Gene Species Fragment length [bp] Thermo Fisher Catalogue Number 16S Northern snake-necked turtle edna Probe Design for Chelodina oblonga -TropWATER Report no. 17/36 Probe information Probe name Dye Probe sequence Modification Length Cheobl_16S_Probe FAM CACCAAAGTGCCCAA MGB 15 Forward primer information Forward primer name Forward primer sequence Length Cheobl_P_16S_F GTGACCTTGGAGAACAATA 19 Reverse primer information Reverse primer name Reverse primer sequence Length Cheobl_P_16S_R CACCATTAGGATGTCCTG 18 11
INDIVIDUAL IDENTIFICATION OF GREEN TURTLE (CHELONIA MYDAS) HATCHLINGS
INDIVIDUAL IDENTIFICATION OF GREEN TURTLE (CHELONIA MYDAS) HATCHLINGS Ellen Ariel, Loïse Corbrion, Laura Leleu and Jennifer Brand Report No. 15/55 Page i INDIVIDUAL IDENTIFICATION OF GREEN TURTLE (CHELONIA
More informationThe Australian Freshwater Turtle Catalogue. Edition
1 www.guntherschmida.com.au The concept, text, lay-out and all images contained in this publication are by Gunther Schmida and protected by copyright. The Australian Freshwater Turtle Catalogue This preview
More informationDiagnosis of Living and Fossil Short-necked Turtles of the Genus Elseya using skeletal morphology
Diagnosis of Living and Fossil Short-necked Turtles of the Genus Elseya using skeletal morphology by Scott Andrew Thomson B.App.Sc. University of Canberra Institute of Applied Ecology University of Canberra
More informationEVOLUTION AND BIOGEOGRAPHY OF AUSTRALASIAN
Announcing EVOLUTION AND BIOGEOGRAPHY OF AUSTRALASIAN VERTEBRATES EDITED BY J.R. Merrick M. Archer G.M. Hickey M.S.Y. Lee A ground-breaking volume of international significance. An overview of Australasian
More informationFirst report of the molecular detection of Ancylostoma caninum in Lahore, Pakistan: the threat from pets
Veterinarni Medicina, 62, 2017 (10): 559564 Original Paper First report of the molecular detection of Ancylostoma caninum in Lahore, Pakistan: the threat from pets A. Rehman 1, R. Akhtar 2 *, H. Akbar
More informationPCR detection of Leptospira in. stray cat and
PCR detection of Leptospira in 1 Department of Pathology, School of Veterinary Medicine, Islamic Azad University, Shahrekord Branch, Shahrekord, Iran 2 Department of Microbiology, School of Veterinary
More informationAustralian and New Zealand College of Veterinary Scientists. Membership Examination. Medicine and Surgery of Unusual Pets Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2017 Medicine and Surgery of Unusual Pets Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours
More informationA phylogeny for side-necked turtles (Chelonia: Pleurodira) based on mitochondrial and nuclear gene sequence variation
Bivlogkal Journal ofthe Linnean So&& (1998), 67: 2 13-246. \\'ith 4 figures Article ID biji.1998.0300, avaiiable online at http://www.idealihrary.lom on IDE kt @ c A phylogeny for side-necked turtles (Chelonia:
More information5/11/ :37 AM No. 4: November, 2014 [Unsubscribe] In this issue
Having trouble viewing this email?click here [Unsubscribe] No. 4: November, 2014 In this issue Emydura subglobosa found alive and well on Cape York Great job opportunity Turtle does well in the 'burbs
More informationHabitat Use and Movements in an Upland Population of
Herpetological Conservation and Biology 13(2):464 472. Submitted: 3 March 2017; Accepted: 25 March 2018; Published: 31 August 2018. Habitat Use and Movements in an Upland Population of Johnstone River
More informationThis document is a preview generated by EVS
TECHNICAL SPECIFICATION ISO/TS 17822-1 First edition 2014-12-15 In vitro diagnostic test systems Qualitative nucleic acid-based in vitro examination procedures for detection and identification of microbial
More informationLong-Necked Turtle rescued, rehabilitated and released by Len & Christine Riding
Freshwater Turtles in the Central West Care and Handling supplementary notes by Len and Christine Riding Long-Necked Turtle rescued, rehabilitated and released by Len & Christine Riding The only Turtle
More informationHabitats and Field Methods. Friday May 12th 2017
Habitats and Field Methods Friday May 12th 2017 Announcements Project consultations available today after class Project Proposal due today at 5pm Follow guidelines posted for lecture 4 Field notebooks
More informationTitle of Project: Distribution of the Collared Lizard, Crotophytus collaris, in the Arkansas River Valley and Ouachita Mountains
Title of Project: Distribution of the Collared Lizard, Crotophytus collaris, in the Arkansas River Valley and Ouachita Mountains Project Summary: This project will seek to monitor the status of Collared
More informationHabitats and Field Techniques
Habitats and Field Techniques Keys to Understanding Habitat Shelter, Sunlight, Water, Food Habitats of Interest Rivers/Streams Lakes/Ponds Bogs/Marshes Forests Meadows Sandy Edge Habitat Rivers/Streams
More informationGenome. Improving herpetological surveys in eastern North America using the environmental DNA method
Improving herpetological surveys in eastern North America using the environmental DNA method Journal: Manuscript ID gen-2015-0218.r3 Manuscript Type: Article Date Submitted by the Author: 02-Aug-2016 Complete
More informationStudents will plot a nature trail at their school Students will produce a trail guide to go with the nature trail
Post Visit 1 on the Wildside School hike Students will plot a nature trail at their school Students will produce a trail guide to go with the nature trail Paper Printer Permission to use school property
More informationStructure of the OIE Manual of Diagnostic Tests and Vaccines for Terrestrial Animals
Structure of the OIE Manual of Diagnostic Tests and Vaccines for Terrestrial Animals Regional Seminar for OIE National Focal Points for Veterinary Laboratories Jeju, Republic of Korea, 5-7 April 2016 Dr.
More informationUniversity of Canberra. This thesis is available in print format from the University of Canberra Library.
University of Canberra This thesis is available in print format from the University of Canberra Library. If you are the author of this thesis and wish to have the whole thesis loaded here, please contact
More informationFinnzymes Oy. PathoProof Mastitis PCR Assay. Real time PCR based mastitis testing in milk monitoring programs
PathoProof TM Mastitis PCR Assay Mikko Koskinen, Ph.D. Director, Diagnostics, Finnzymes Oy Real time PCR based mastitis testing in milk monitoring programs PathoProof Mastitis PCR Assay Comparison of the
More informationAbout Reptiles A Guide for Children. Cathryn Sill Illustrated by John Sill
About Reptiles About Reptiles A Guide for Children Cathryn Sill Illustrated by John Sill For the One who created reptiles. Genesis 1:24 Published by PEACHTREE PUBLISHERS, LTD. 1700 Chattahoochee Avenue
More informationHow to load and run an Agarose gel PSR
How to load and run an Agarose gel PSR Agarose gel electrophoresis is the most effective way of separating DNA fragments of varying sizes ranging from100 bp to 25 kb. This protocol divided into three stages:
More informationAdditional copies may be obtained from the following address:
Turtle Coloring and Activity Book Art and Text By Holly Dumas Gulfport High School Additional copies may be obtained from the following address: Gulf Coast Research Laboratory The University of Southern
More informationThe OIE Manual of Diagnostic Tests and Vaccines for Terrestrial & Aquatic Animals
The OIE Manual of Diagnostic Tests and Vaccines for Terrestrial & Aquatic Animals Regional seminar for OIE National Focal Points for Veterinary Products, Tokyo, Japan, 3-5 December 2014 Barbara Freischem,
More informationAustralian and New Zealand College of Veterinary Scientists. Membership Examination. Medicine of Australasian Wildlife Species Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2018 Medicine of Australasian Wildlife Species Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours
More informationLESSON TWO: Turtle Physical Features and Habitat PHASE LEARNING SEQUENCE ACTIVITY RESOURCES Engage
Unique Adaptations to a Unique Environment: Mary River Turtle and its Environs LESSON TWO: Turtle Physical Features and Habitat PHASE LEARNING SEQUENCE ACTIVITY RESOURCES Engage ASOT goal: Display and
More informationActivities are for use as intended at home, in the classroom, and story-times. Copyright 2007 by Sylvan Dell Publishing.
Teaching Activities for Turtles in my Sandbox Sequencing Sentence Strips Geography where in the US do terrapins live? Turtles, Terrapins, & Tortoises: Same or Different? Reptiles versus Mammals: Venn Diagram
More informationCERTIFIED REFERENCE MATERIAL IRMM 313
EUROPEAN COMMISSION JOINT RESEARCH CENTRE Institute for Reference Materials and Measurements (Geel) CERTIFIED REFERENCE MATERIAL IRMM 313 CERTIFICATE OF ANALYSIS PFGE AGAROSE PLUGS Certified value 2) SmaI
More informationReptiles and amphibian behaviour
Reptiles and amphibian behaviour Understanding how a healthy reptile and amphibian should look and act takes a lot of observation and practice. Reptiles and amphibians have behaviour that relates to them
More informationBuy The Complete Version of This Book at Booklocker.com:
An All-In-One Resource to Choose the Best Dog Food. Solve the Dog Food Puzzle Buy The Complete Version of This Book at Booklocker.com: http://www.booklocker.com/p/books/4729.html?s=pdf Copyright & Disclaimer
More informationA New Species of Freshwater Turtle in the Genus Elseya (Testudines: Chelidae) from Central Coastal Queensland, Australia
Chelonian Conservation and Biology, 2006, 5(1): 74 86 Ó 2006 Chelonian Research Foundation A New Species of Freshwater Turtle in the Genus Elseya (Testudines: Chelidae) from Central Coastal Queensland,
More informationThreatened Reptiles of the Brigalow Belt
Threatened Reptiles of the Brigalow Belt Management Needs Knowledge Dr Simon Hudson, CEnvP EIANZ Threatened Species Forum, Townsville, 6 Sep 2013 Why Reptiles? Often a focus on charismatic megafauna iconic
More informationArticle. Diversity of Australasian freshwater turtles, with an annotated synonymy and keys to species
Zootaxa 2496: 1 37 (2010) www.mapress.com/zootaxa/ Copyright 2010 Magnolia Press Article ISSN 1175-5326 (print edition) ZOOTAXA ISSN 1175-5334 (online edition) Diversity of Australasian freshwater turtles,
More informationAmphibians and Reptiles of the Narrow River Watershed
Amphibians and Reptiles of the Narrow River Watershed Nancy Karraker, Associate Professor Department of Natural Resources Science University of Rhode Island Outline of Today s Talk Biology and habitats
More informationCOMPARING DNA SEQUENCES TO UNDERSTAND EVOLUTIONARY RELATIONSHIPS WITH BLAST
Big Idea 1 Evolution INVESTIGATION 3 COMPARING DNA SEQUENCES TO UNDERSTAND EVOLUTIONARY RELATIONSHIPS WITH BLAST How can bioinformatics be used as a tool to determine evolutionary relationships and to
More informationToday there are approximately 250 species of turtles and tortoises.
I WHAT IS A TURTLE OR TORTOISE? Over 200 million years ago chelonians with fully formed shells appeared in the fossil record. Unlike modern species, they had teeth and could not withdraw into their shells.
More informationVisit ABLE on the Web at:
This article reprinted from: Lessem, P. B. 2008. The antibiotic resistance phenomenon: Use of minimal inhibitory concentration (MIC) determination for inquiry based experimentation. Pages 357-362, in Tested
More informationIn the first half of the 20th century, Dr. Guido Fanconi published detailed clinical descriptions of several heritable human diseases.
In the first half of the 20th century, Dr. Guido Fanconi published detailed clinical descriptions of several heritable human diseases. Two disease syndromes were named after him: Fanconi Anemia and Fanconi
More informationCHELONIAN CONSERVATION AND BIOLOGY International Journal of Turtle and Tortoise Research
CHELONIAN CONSERVATION AND BIOLOGY International Journal of Turtle and Tortoise Research Growth in Kyphotic Ringed Sawbacks, Graptemys oculifera (Testudines: Emydidae) WILL SELMAN 1,2 AND ROBERT L. JONES
More informationEUROPEAN REFERENCE LABORATORY (EU-RL) FOR BOVINE TUBERCULOSIS WORK-PROGRAMME PROPOSAL Version 2 VISAVET. Universidad Complutense de Madrid
EUROPEAN COMMISSION HEALTH & CONSUMERS DIRECTORATE-GENERAL Directorate D Animal Health and Welfare Unit D1- Animal health and Standing Committees EUROPEAN REFERENCE LABORATORY (EU-RL) FOR BOVINE TUBERCULOSIS
More informationA New Species of Freshwater Turtle in the Genus Elseya (Testudines: Chelidae) from Central Coastal Queensland, Australia
A New Species of Freshwater Turtle in the Genus Elseya (Testudines: Chelidae) from Central Coastal Queensland, Australia SCOTT THOMSON 1, ARTHUR GEORGES 1 AND COL LIMPUS 2 1 Applied Ecology Research Group
More informationMyuchelys latisternum (Gray 1867) Sawshelled Turtle, Saw-Shell Turtle
Conservation Biology of Freshwater Turtles and Tortoises: A Compilation Project Chelidae of the IUCN/SSC Myuchelys Tortoise and latisternum Freshwater Turtle Specialist Group 073.1 A.G.J. Rhodin, P.C.H.
More informationCLEVELAND BAY FIELD RESEARCH
The Rivers to Reef to Turtles Project CLEVELAND BAY FIELD RESEARCH UPDATE #4 We all met again at our reference site in Cleveland Bay to sample the environment and turtles for the Rivers to Reef to Turtles
More informationIntroduction Histories and Population Genetics of the Nile Monitor (Varanus niloticus) and Argentine Black-and-White Tegu (Salvator merianae) in
Introduction Histories and Population Genetics of the Nile Monitor (Varanus niloticus) and Argentine Black-and-White Tegu (Salvator merianae) in Florida JARED WOOD, STEPHANIE DOWELL, TODD CAMPBELL, ROBERT
More informationQuantification of Chloramphenicol in Chicken Using Xevo TQD with RADAR Technology
Quantification of Chloramphenicol in Chicken Using Xevo TQD with RADAR Technology Dimple Shah, Marian Twohig, and Jennifer A. Burgess Waters Corporation, Milford, MA, U.S.A. A P P L I C AT ION B E N E
More informationMultiplex real-time PCR for the passive surveillance of ticks, tick-bites, and tick-borne pathogens
Multiplex real-time PCR for the passive surveillance of ticks, tick-bites, and tick-borne pathogens Guang Xu, Stephen Rich Laboratory of Medical Zoology University of Massachusetts Amherst TICKS ARE VECTORS
More informationMyuchelys georgesi (Cann 1997) Bellinger River Turtle
Conservation Biology of Freshwater Turtles and Tortoises: A Compilation Project of Chelidae the IUCN/SSC Myuchelys Tortoise and Freshwater georgesi Turtle Specialist Group 091.1 A.G.J. Rhodin, P.C.H. Pritchard,
More informationThe natural history of nesting in two Australian freshwater turtles.
The natural history of nesting in two freshwater turtles. David T. Booth The University of Queensland, Physiological Ecology Group, School of Biological Sciences, Qld. 4072. Email: d.booth@uq.edu.au ABSTRACT
More informationAP Lab Three: Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST
AP Biology Name AP Lab Three: Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST In the 1990 s when scientists began to compile a list of genes and DNA sequences in the human genome
More informationComparing DNA Sequences to Understand Evolutionary Relationships with BLAST
Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST INVESTIGATION 3 BIG IDEA 1 Lab Investigation 3: BLAST Pre-Lab Essential Question: How can bioinformatics be used as a tool to
More informationTURTLE OBSERVER PROGRAM REPORT 2014
TURTLE OBSERVER PROGR REPORT 214 INTRODUCTION: Marin Municipal Water District Erin Tracy, AmeriCorps Watershed Stewards Project Member Eric Ettlinger, Aquatic Ecologist June, 214 As California s only native
More informationValidation of the PathoProof TM Mastitis PCR Assay for Bacterial Identification from Milk Recording Samples
Validation of the PathoProof TM Mastitis PCR Assay for Bacterial Identification from Milk Recording Samples Mikko Koskinen, Ph.D. Finnzymes Oy Benefits of using DHI samples for mastitis testing Overview
More informationTRACHEMYS. estrategia de control de tortugas invasoras. Project LIFE+Trachemys (LIFE09 NAT/ES/000529)
estrategia de control de tortugas invasoras TRACHEMYS Project LIFE+Trachemys (LIFE09 NAT/ES/000529) INTRODUCTION Neonates of Trachemys scripta captured in the wild Invasive species are one of the biggest
More informationEastern Small Blotched Python (Normal Form) Eastern Small Blotched Python (Blond Form)
Eastern Small Blotched Python (Normal Form) Liasis maculosus, Anteresia maculosus U2818 A small python from the eastern parts of QLD. Generally light brown in colour, with chocolate markings that are usually
More informationUltra-Fast Analysis of Contaminant Residue from Propolis by LC/MS/MS Using SPE
Ultra-Fast Analysis of Contaminant Residue from Propolis by LC/MS/MS Using SPE Matthew Trass, Philip J. Koerner and Jeff Layne Phenomenex, Inc., 411 Madrid Ave.,Torrance, CA 90501 USA PO88780811_L_2 Introduction
More informationAppendix G. Offset proposal for the Fitzroy River turtle and whitethroated
Appendix G Offset proposal for the Fitzroy River turtle and whitethroated snapping turtle Table of contents Glossary and abbreviations... ii 1. Introduction... 1 1.1 Overview... 1 1.2 Approach and methodology...
More informationSurvey options Toad surveys Great Crested Newt edna survey: Great Crested Newt full survey:
Amphibian surveys Survey options Toad surveys: the aim is to visit each survey pond in the 1km square in March or April, and see if frogs, toads or their spawn is present Great Crested Newt edna survey:
More informationAgarose Blenders. Code Description Size
Agarose Blenders Code Description Size K669-100G Agarose I / TBE Blend 0.8% 100 grams K677-100G Agarose I / TBE Blend 1.5% 100 grams K678-100G Agarose I /TBE Blend 2.0% 100 grams K679-100G Agarose I /
More informationThe Importance Of Atlasing; Utilizing Amphibian And Reptile Data To Protect And Restore Michigan Wetlands
The Importance Of Atlasing; Utilizing Amphibian And Reptile Data To Protect And Restore Michigan Wetlands David A. Mifsud, PWS, CPE, CWB Herpetologist Contact Info: (517) 522-3524 Office (313) 268-6189
More informationSmall Animal Medicine
2017 AUSTRALIAN AND NEW ZEALAND COLLEGE OF VETERINARY SCIENTISTS MEMBERSHIP GUIDELINES Small Animal Medicine INTRODUCTION These Membership Guidelines should be read in conjunction with the Membership Candidate
More informationAustralian and New Zealand College of Veterinary Scientists. Membership Examination. Veterinary Epidemiology Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2016 Veterinary Epidemiology Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal
More informationThe epidemiology of infections with Giardia species and genotypes in well cared for dogs and cats in Germany
Pallant et al. Parasites & Vectors (2015) 8:2 DOI 10.1186/s13071-014-0615-2 RESEARCH The epidemiology of infections with Giardia species and genotypes in well cared for dogs and cats in Germany Louise
More informationIntroduction and methods will follow the same guidelines as for the draft
Locomotion Paper Guidelines Entire paper will be 5-7 double spaced pages (12 pt font, Times New Roman, 1 inch margins) without figures (but I still want you to include them, they just don t count towards
More informationAustralian and New Zealand College of Veterinary Scientists. Membership Examination. Veterinary Epidemiology Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2015 Veterinary Epidemiology Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal
More informationPARTIAL REPORT. Juvenile hybrid turtles along the Brazilian coast RIO GRANDE FEDERAL UNIVERSITY
RIO GRANDE FEDERAL UNIVERSITY OCEANOGRAPHY INSTITUTE MARINE MOLECULAR ECOLOGY LABORATORY PARTIAL REPORT Juvenile hybrid turtles along the Brazilian coast PROJECT LEADER: MAIRA PROIETTI PROFESSOR, OCEANOGRAPHY
More informationTurtle Research, Education, and Conservation Program
Turtle Population Declines Turtle Research, Education, and Conservation Program Turtles are a remarkable group of animals. They ve existed on earth for over 200 million years; that s close to 100 times
More informationMary River Turtle Conservation Project nesting season
Mary River Turtle Conservation Project 2008 09 nesting season Project Officers Marilyn Connell Shawn Jarvey Glenda Pickersgill Technical advice Dr Col Limpus Environmental Protection Agency Administration
More information4 Many species of mammals, birds, reptiles, amphibians and fish 940L. Source 1 Habitats
Source 1 Habitats 1 American Alligators can be found in fresh water environments like rivers, lakes, ponds, swamps and marshes. They also like to live in areas that are brackish, which means the water
More informationUPSTART BAY FIELD RESEARCH
UPSTART BAY FIELD RESEARCH UPDATE #5 The Rivers to Reef to Turtles Project On 14 June we all met at our reference site in Upstart Bay to sample the environment and turtles for the Rivers to Reef to Turtles
More informationErin Maggiulli. Scientific Name (Genus species) Lepidochelys kempii. Characteristics & Traits
Endangered Species Common Name Scientific Name (Genus species) Characteristics & Traits (s) Kemp s Ridley Sea Turtle Lepidochelys kempii Triangular head w/ hooked beak, grayish green color. Around 100
More informationMyuchelys bellii (Gray 1844) Western Saw-shelled Turtle, Bell s Turtle
Conservation Biology of Freshwater Turtles and Tortoises: A Compilation Project of the Chelidae IUCN/SSC Tortoise Myuchelys and Freshwater bellii Turtle Specialist Group 088.1 A.G.J. Rhodin, P.C.H. Pritchard,
More informationMolecular Characterization of Staphylococcus aureus of Camel (Camelus dromedarius) Skin Origin
International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 7 Number 01 (2018) Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2018.701.410
More informationPioneer Dairy Wetlands
Pioneer Dairy Wetlands Eastern Long-necked Turtle Green and Golden Bell Frog DRAFT Master plan June 2011 1 Contents WHS contribution 3 Location for Enclosure and Rehabilitation area 4 Eastern Long-necked
More informationRed Eared Slider Secrets. Although Most Red-Eared Sliders Can Live Up to Years, Most WILL NOT Survive Two Years!
Although Most Red-Eared Sliders Can Live Up to 45-60 Years, Most WILL NOT Survive Two Years! Chris Johnson 2014 2 Red Eared Slider Secrets Although Most Red-Eared Sliders Can Live Up to 45-60 Years, Most
More informationChelodina expansa Gray 1857 Broad-Shelled Turtle, Giant Snake-Necked Turtle
Conservation Biology of Freshwater Turtles and Tortoises: A Compilation Project of Chelidae the IUCN/SSC Chelodina Tortoise and Freshwater expansa Turtle Specialist Group 071.1 A.G.J. Rhodin, P.C.H. Pritchard,
More informationTurtle Watch: Enhancing Science Engagement
Turtle Watch: Enhancing Science Engagement Elaine Lewis, Louise Nielsen, Jennifer Pearson and Catherine Baudains Introduction Engaging students in authentic science settings and real-life contexts is viewed
More informationAnglia Examination Syndicate (England) Certificate in English for Overseas Candidates
Please stick your Candidate label here Office Use: Anglia Examination Syndicate (England) Certificate in English for Overseas Candidates Advanced Level Paper A 2005 Time allowed Three hours including listening.
More informationCulicoides species from the subgenus Culicoides in Catalonia (NE Spain)
Culicoides species from the subgenus Culicoides in Catalonia (NE Spain) Pagès, N., Muñoz-Muñoz, F., Talavera, S., Sarto, V., Lorca, C. and Nuñez, J.I. Identification Background Identification of Culicoides
More informationDavid A. Mifsud, PWS, CPE, CWB Herpetologist. Contact Info: (517) Office (313) Mobile
David A. Mifsud, PWS, CPE, CWB Herpetologist Contact Info: (517) 522-3524 Office (313) 268-6189 Mobile DMIfsud@HerpRMan.com www.herprman.com Herps Are Vulnerable to environmental disturbance. Highly sensitive
More informationA Unique Approach to Managing the Problem of Antibiotic Resistance
A Unique Approach to Managing the Problem of Antibiotic Resistance By: Heather Storteboom and Sung-Chul Kim Department of Civil and Environmental Engineering Colorado State University A Quick Review The
More informationLegal Supplement Part B Vol. 53, No th March, NOTICE THE ENVIRONMENTALLY SENSITIVE SPECIES (OLIVE RIDLEY TURTLE) NOTICE, 2014
Legal Supplement Part B Vol. 53, No. 37 28th March, 2014 227 LEGAL NOTICE NO. 92 REPUBLIC OF TRINIDAD AND TOBAGO THE ENVIRONMENTAL MANAGEMENT ACT, CHAP. 35:05 NOTICE MADE BY THE ENVIRONMENTAL MANAGEMENT
More informationVMP Focal point training Casablanca 6 8 December Dr Susanne Münstermann
VMP Focal point training Casablanca 6 8 December 2011 Dr Susanne Münstermann The OIE Specialist Commissions and their mandate The Terrestrial Manual - overview Diagnostic Tests Vaccines The Aquatic Manual
More informationì<(sk$m)=bdjdbg< +^-Ä-U-Ä-U
Life Science Genre Comprehension Skill Text Features Science Content Nonfiction Cause and Effect Labels Captions Glossary Changing Ecosystems by Lillian Duggan Scott Foresman Science 5.6 ì
More informationGrade Level: 3-5. Next Generation Sunshine State Standards SC.3.L.15.1 SC.4.L.16.2; SC.4.L.17.4 SC.5.L.15.1; SC.5.L.17.1
Grade Level: 3-5 Next Generation Sunshine State Standards SC.3.L.15.1 SC.4.L.16.2; SC.4.L.17.4 SC.5.L.15.1; SC.5.L.17.1 Program Overview Discover the realm of reptiles, amazing creatures adapted to land
More informationVeterinary Diagnostics Portfolio Overview. Complete solutions for veterinary testing and pathogen research
Veterinary Diagnostics Portfolio Overview Complete solutions for veterinary testing and pathogen research Sample preparation products Cat. no. (number of preps) Target analyte Product Short description
More informationRED-EARED SLIDER TURTLES AND THREATENED NATIVE RED-BELLIED TURTLES IN THE UPPER DELAWARE ESTUARY. Steven H. Pearson and Harold W.
RESOURCE OVERLAP AND POTENTIAL COMPETITION BETWEEN INVASIVE RED-EARED SLIDER TURTLES AND THREATENED NATIVE RED-BELLIED TURTLES IN THE UPPER DELAWARE ESTUARY Steven H. Pearson and Harold W. Avery Six Most
More informationISO INTERNATIONAL STANDARD
ITERATIOAL STADARD ISO 20776-2 First edition 2007-07-01 Clinical laboratory testing and in vitro diagnostic test systems Susceptibility testing of infectious agents and evaluation of performance of antimicrobial
More informationForensics, phylogeography and population genetics: a case study using the Australasian snake-necked turtle, Chelodina rugosa.
Forensics, phylogeography and population genetics: a case study using the Australasian snake-necked turtle, Chelodina rugosa. By Erika A. Alacs BSc Molecular Biology, Murdoch University BSc Conservation
More informationTesting the Ideal Free Distribution on Turtles in the Field
Testing the Ideal Free Distribution on Turtles in the Field Justin Carasa Nicole Cinquino Christopher Contreras Santiago Londoño Michelle Ortiz Andrea Remiro Alexander Rodriguez Research in Ecology University
More informationSensitive and selective analysis of fipronil residues in eggs using Thermo Scientific GC-MS/MS triple quadrupole technology
APPLICATION NOTE 10575 Sensitive and selective analysis of fipronil residues in eggs using Thermo Scientific GC-MS/MS triple quadrupole technology Authors Cristian Cojocariu, 1 Joachim Gummersbach, 2 and
More informationDevelopment and validation of a diagnostic test for Ridge allele copy number in Rhodesian Ridgeback dogs
Waldo and Diaz Canine Genetics and Epidemiology (2015) 2:2 DOI 10.1186/s40575-015-0013-x RESEARCH Open Access Development and validation of a diagstic test for Ridge allele copy number in Rhodesian Ridgeback
More informationJayhawk Area Council Boy Scout Merit Badge Day at the Topeka Zoo Sunday, October 23, 2016
Jayhawk Area Council Boy Scout Merit Badge Day at the Topeka Zoo Sunday, October 23, 2016 Sunday, October 23, 2016 is Scout Day at the Topeka Zoo. From 12:00 noon to 2:00 pm Boy Scouts can complete some
More informationStudy site #2 the reference site at the southern end of Cleveland Bay.
CHRISTINE HOF / WWF-AUS We all made our way from various parts of Queensland to our reference site at Cleveland Bay in order to sample the environment and turtles for the Rivers to Reef to Turtles (RRT)
More informationASFA Retirement Standard
ASFA Research and Resource Centre ASFA Retirement Standard Detailed budget breakdowns The Association of Superannuation Funds of Australia The Association of Superannuation Funds of Australia Limited Level
More informationASFA Retirement Standard
ASFA Research and Resource Centre ASFA Retirement Standard Detailed budget breakdowns The Association of Superannuation Funds of Australia The Association of Superannuation Funds of Australia Limited Level
More informationASFA Retirement Standard
ASFA Research and Resource Centre ASFA Retirement Standard Detailed budget breakdowns The Association of Superannuation Funds of Australia The Association of Superannuation Funds of Australia Limited Level
More informationEFSA Scientific Opinion on canine leishmaniosis
EFSA Scientific Opinion on canine leishmaniosis Andrea Gervelmeyer Animal Health and Welfare Team Animal and Plant Health Unit AHAC meeting 19 June 2015 PRESENTATION OUTLINE Outline Background ToR Approach
More informationISO INTERNATIONAL STANDARD
INTERNATIONAL STANDARD ISO 20776-2 First edition 2007-07-01 Clinical laboratory testing and in vitro diagnostic test systems Susceptibility testing of infectious agents and evaluation of performance of
More informationAustralian and New Zealand College of Veterinary Scientists. Membership Examination. Veterinary Behaviour Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2014 Veterinary Behaviour Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer
More informationASFA Retirement Standard
ASFA Research and Resource Centre ASFA Retirement Standard Detailed budget breakdowns The Association of Superannuation Funds of Australia The Association of Superannuation Funds of Australia Limited Level
More information