PROBE DESIGN FOR ENVIRONMENTAL DNA DETECTION OF CHELODINA OBLONGA IN THE CAPE YORK REGION

Transcription

1 edna Probe Design for Chelodina oblonga -TropWATER Report no. 17/36 PROBE DESIGN FOR ENVIRONMENTAL DNA DETECTION OF CHELODINA OBLONGA IN THE CAPE YORK REGION Roger Huerlimann, Agnès Le Port, Damien Burrows, Dean Jerry Report No. 17/36 May

2 PROBE DESIGN FOR ENVIRONMENTAL DNA DETECTION OF CHELODINA OBLONGA IN THE CAPE YORK REGION A Report for Balkanu Aboriginal Corporation Report No. 17/36 May 2017 Prepared by Roger Huerlimann, Agnès Le Port, Damien Burrows and Dean Jerry Centre for Tropical Water & Aquatic Ecosystem Research (TropWATER) James Cook University Townsville Phone : (07) TropWATER@jcu.edu.au Web: 2

3 Information should be cited as: Huerlimann R, Le Port A, Burrows D and Jerry, D Probe Design for Environmental DNA Detection of Chelodina oblonga in the Cape York Region. Report 17/36 Centre for Tropical Water and Aquatic Ecosystem Research (TropWATER), James Cook University, Townsville. For further information contact: Centre for Tropical Water and Aquatic Ecosystem Research (TropWATER) James Cook University ATSIP Building 145 Townsville QLD 4811 This publication has been compiled by the Centre for Tropical Water and Aquatic Ecosystem Research (TropWATER), James Cook University. James Cook University, Except as permitted by the Copyright Act 1968, no part of the work may in any form or by any electronic, mechanical, photocopying, recording, or any other means be reproduced, stored in a retrieval system or be broadcast or transmitted without the prior written permission of TropWATER. The information contained herein is subject to change without notice. The copyright owner shall not be liable for technical or other errors or omissions contained herein. The reader/user accepts all risks and responsibility for losses, damages, costs and other consequences resulting directly or indirectly from using this information. Enquiries about reproduction, including downloading or printing the web version, should be directed to TropWATER@jcu.edu.au. 3

4 TABLE OF CONTENTS 1 BACKGROUND AND OBJECTIVE METHODOLOGY AND RESULTS General Concept of Species-Specific Probe Review of Existing and New Sequencing Information Sample Collection, DNA Extraction and Sequencing Species-Specific Probe Design Quantitative PCR Conditions and Optimisation General qpcr conditions Probe efficiency testing Exclusion testing SUMMARY REFERENCES... 9 APPENDIX 1 List of available turtle sequences APPENDIX 2 Probe sequence details

5 1 BACKGROUND AND OBJECTIVE All animals constantly shed traces of their DNA into the environment. This DNA is termed environmental DNA (edna). By analysing water (or soil) samples for this DNA, scientists can determine the presence of that animal without the need to capture any individuals. Thus, the presence of those animals can be determined simply by collecting a water sample for analysis. This has many benefits, especially where the animals are difficult to catch, require specialised equipment to catch, or where it may be dangerous to attempt to catch those animals (for example where crocodiles are present). In remote or difficult to access locations, collecting water samples for edna analysis is often quicker and cheaper than attempting to catch or observe the animals themselves. Thus, this method can be used for regular monitoring across a wide range of locations. To utilise edna methods in field monitoring, it is first necessary to locate a genetic marker that is unique to the species of interest. This marker is termed a genetic probe and when it is detected in water samples, it provides clear evidence of the presence of that species of interest. Genetic markers or probes need to be developed for each species individually. In time, if such markers are developed for all species, the presence or absence of all species in a waterhole could potentially be detected from a single water sample. For the current project, a series of waterholes on Cape York have been fenced to protect them against feral pig disturbance. The turtles that inhabit these waterholes are of particular value to the local indigenous people and they wish to understand if the fencing of the waterholes has been of benefit to turtle populations. As the waterholes are remote and crocodiles may be present, edna may be a useful way of monitoring turtle populations. Thus the aim of current project was to design a probe to reliably detect the presence of northern snake-necked turtles (Chelodina oblonga) in the ephemeral floodplain lagoons in the Cape York region using environmental DNA. Designing a species-specific probe is the first step in any edna detection project. In order to design a genetic edna probe that detects this turtle and no other species, we needed to collect genetic sequence data for this species and also other turtle species that occur in the same area. 2 METHODOLOGY AND RESULTS 2.1 General Concept of Species-Specific Probe In order to assure probe reliability, there are two kinds of errors that need to be tested for. False positives occur when the presence of another turtle species (called exclusion species), that is not the target species, is falsely detected. This depends on the specificity of the probe to the target species and can be difficult to achieve with closely related species. False negatives occur when the target species is present, but not detected. There are two possible causes for false negatives. Firstly, they occur if the probe does not match an individual turtle being tested, for example in populations that are distantly related to the target population, or when the targets are present at very low abundance (below the detection limit). It is therefore important to design the probe to appropriately include the target species, while excluding all other species. In order to design the species specific probes, DNA sequence information for the target and exclusion species needs to be collected. Generally, genes located on the mitochondrial genome are preferred, since they are present at higher copy numbers in each cell, and therefore easier to detect. 5

6 2.2 Review of Existing and New Sequencing Information Geneious (Version R10, Kearse et al., 2012) was used to search the publicly available National Center for Biotechnology Information (NCBI database) for sequences of mitochondrial genes. Date of last access was on 29/07/2016. This search focused on 25 different species of turtles native to Australia and one exotic species (see Appendix 1 for list of available sequences). Genetic sequence information for northern snake-necked turtles (C. oblonga) was found, but only from individuals collected outside the Cape York region. While useful, these sequences might not reflect the genetic diversity of the target species in the target region. Therefore it was necessary to obtain tissue samples of C. oblonga from the Cape York region for sequencing (see section 2.3). We also obtained publicly-available gene sequences of the following turtle species that cooccurr with C. oblonga in the Cape York region: Emydura subglobosa subglobosa, Emydura s. worrelli, Emydura tanybaraga, and Pelochelys bibroni. No sequences were found for the closely related, co-occuring species Chelodina canni, which is of high importance as it is often found in the same waterholes as C. oblonga. In the absence of publicly-available sequences for C. canni, we obtained our own via a tissue sample from an individual C. canni from the Archer River region, Cape York (see section 2.3). We also found sequences for the following turtle species that are co-occuring with C. oblonga outside of the Cape York region: Carettochelys insculpta, Elseya dentata, Elseya lavarackorum, Emydura victoriae, and Wollumbinia latisternum. Lastly, even though they do not co-occur with C. oblonga in any part of their range, we obtained sequences of an additional 15 Australian turtle species to be sure our probe for the C. oblonga was unique to that species. A detailed list of available sequences can be found in Appendix Sample Collection, DNA Extraction and Sequencing To obtain DNA for probe development and validation, hind leg skin tissue samples from 23 Chelodina oblonga, one C. canni, six Emydura s. worrelli, four Myuchelys latisternum were collected from the Archer River and Kalan wetland areas (Cape York), as well as two Rheodytes leukops from the Fitzroy Barrage (central Qld), and two Elseya lavarackorum from Gregory River (NW Qld) (Table 1). The Chelodina spp. DNA was collected for sequencing and PCR testing, while the DNA of the other species was collected for PCR testing only. Total genomic DNA was extracted from the preserved tissues through CTAB extraction (Doyle and Doyle, 1987). In short, an approximately 2x2 mm piece of tissue was lysed for 2 hours in 700 µl CTAB buffer with 20 µl Proteinase K. After two washes with an equal amount of Chloroform:Isoamyl alcohol, the DNA was precipitated for 1 hour with isopropanol at -20 C and subsequently centrifuged for 30 min at 16,000 x g. After two washes with 70% ethanol, the samples were dried and reconstituted in 50 µl TE buffer. To supplement the existing, publicly available sequences, an additional 20 samples for C. oblonga and one sample for C. canni were sequenced (Table 1). For PCR amplification, the following primer pairs were used for 16S: Forward GCCTGTTTAYCAAAAACATCGC, Reverse CCGGTCTGAACTCAGATCACGT and COI: Forward AAYCAYAAAGAYATYGGYACCCT, Reverse CTTCTGGGTGNCSRAARAAYCA. Sequencing was carried out at the Australian Genome Research Facility in Brisbane. 6

7 Table 1 List of species for which tissue samples were collected, number of samples that were extracted, and number of samples that were sequenced Species name Common name # samples # Samples sequenced extracted (16S and COI) Chelodina oblonga Northern snake-necked turtle Chelodina canni Cann s snake-necked turtle 1 1 Emydura subglobosa worrelli Diamond-headed turtle 6 - Wollumbinia latisternum Saw-shelled turtle 4 - Rheodytes leukops Fitzroy River turtle 2 - Elseya lavarackorum Gulf snapping turtle Species-Specific Probe Design For probe design, Geneious (Version R10, Kearse et al., 2012) was used for sequence processing and in-silico testing (collection, curation, alignment, tree building) and AlleleID (V7, Premier Biosoft) was used to design probes. After assessing the genetic information, we decided to focus on the C. oblonga sequences collected by us in the Cape York region for the probe design. Most publicly available C. oblonga sequences, all of which were collected from outside the Cape York region, differed from the Cape York sequences we obtained. This was either due to natural genetic variation between the different populations or species misidentification. This probe is therefore specifically designed for C. oblonga occurring in the Cape York region. While this probe could be used on this species outside of Cape York, it is advisable to collect and sequence additional C. oblonga tissue samples from other regions to validate the occurrence of potential false negative results. We investigated the COI and 16S genes to design this probe. Due to the close relatedness of the listed turtle species in general, and C. oblonga and C. canni specifically, the locations of where a probe could be placed were limited. To design the probes, the collected sequences for the two different genes were individually aligned in Geneious using MUSCLE and curated for sequence quality and sequence length. The aligned sequences where then loaded into AlleleID to determine the optimal probe location in each gene using the Taxa Specific/Cross Species TaqMan Design option in the TaqMan MGB probe design tool. The probes suggested by AlleleID were then compared to the alignments in Geneious for visual control and the best location was determined to be in the 16S region. See Appendix 2 for details on the probe sequences. 2.5 Quantitative PCR Conditions and Optimisation General qpcr conditions The C. oblonga probe was manufactured by Applied Biosystems (Thermo Fisher Scientific) and TaqMan Environmental Master Mix 2.0 (Thermo Fisher Scientific) was used for the qpcr reactions. The optimal annealing temperature for the primers associated with the probe was determined through a gradient PCR from 55 C to 65 C using genomic DNA of C. oblonga as a template. The gradient PCR showed that the primers are performing well up to 59 C, using C. oblonga genomic DNA as a template (Fig. 1). 7

8 Fig. 1 Gradient PCR for C. oblonga primers Each qpcr reaction was carried out with 10 µl environmental master mix, 4 µl water, 1 µl probe and 5 µl sample, resulting in a total reaction volume of 20 µl on a Rotorgene qpcr thermocycler (QIAGEN). Based on the gradient PCR and initial probe efficiency testing (see 2.5.2), the optimal PCR cycling protocol was determined to be 30 seconds at 58 C, followed by 30 seconds at 60 C, for 50 cycles (Table 2). These conditions were used for the final probe efficiency testing and species exclusion testing. Table 2 qpcr cycling protocol used for qpcr Step Temp Time Cycles Initial denaturation 95 C 10 min 1 Denaturation 95 C 15 s Annealing 58 C 30 s Extension 60 C 30 s Probe efficiency testing In qpcr, efficiency is a measure of how well a probe is amplifying the target species and can range from 0% to 100%. Under ideal conditions; efficiency will be 100%, which equals to one doubling per PCR cycle; however, an efficiency as low as 80% is still acceptable for a presence/absence assay like the one that is being developed here. To determine the efficiency of the C. oblonga probe, we made a standard curve ranging from 2 ng/µl to 2 *10-7 ng/ul of genomic DNA in the original sample. For this, we used a dilution series with a ten-fold dilution each step for 8 standards. Out of the eight standards, only the first five returned acceptable amplification. This is in line with probe assays that TropWATER has developed for tilapia and barramundi. The efficiency was 84%, which is in the acceptable range for this assay (Fig. 2). Standard five reflects the lower detection limit and is equivalent to 0.2 pg/ul genomic DNA in the original sample. The R 2 value of is on the low side, but is in the acceptable range for this type of assay (Fig. 5). 8

9 Fig. 2 Standard curve with five standards using C. oblonga genomic DNA to determine range, detection limit and efficiency Exclusion testing To test whether the probe is specific to C. oblonga only, we ran a qpcr using genomic DNA from multiple individuals of five other turtle species consisting of one C. canni, two Elseya lavarackorum, two Emydura s. worrelli, one Myuchelys latisternum, and two Rheodytes leukops in triplicates using general qpcr conditions outlined above. No false positives were detected for M. latisternum, R. leukops, and E. lavarackorum. While C. canni did not come up as a false positive, it did show a small response below the detection limit which should not interfere with the use of the probe. Lastly, Emydura s. worrelli came up as a false positive, but only irregularly and at DNA concentrations much higher than expected in the wild; however, this is pending the evaluation of the probe with actual edna samples collected from the field which is a recommended next step. 3 SUMMARY The purpose of this small pilot project was to develop an edna probe for northern snakenecked turtles (Chelodina oblonga) in the Cape York region. The species specific probe was tested for its performance, consistent detection limit and exclusion of other turtle species. The probe passed the performance test and consistently detected the target species in a laboratory setting. The probe is therefore successful in detecting C. oblonga using TaqMan qpcr. However, before this probe is used in monitoring, a study should be carried out to assess its performance in the field. This project was focused on the laboratory analytical work but there are many factors that affect the successful collection and detection probability of edna in the field and these should be investigated as part of any monitoring program for C. oblonga. 4 REFERENCES Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M., Sturrock, S., Buxton, S., Cooper, A., Markowitz, S., Duran, C., Thierer, T., Ashton, B., Mentjies, P., & Drummond, A. (2012). Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics, 28: Doyle JJ & Doyle JL (1987). A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin, 19:

10 APPENDIX 1 LIST OF AVAILABLE TURTLE SEQUENCES edna Probe Design for Chelodina oblonga -TropWATER Report no. 17/36 Last accessed: 29/07/2016 Genes Complete Species Common Name Importance COI 12S 16S Cytb ND4 Mitochondrial Carettochelys insculpta Pig-nosed turtle Exclusion species Chelodina burrungandjii Sandstone snake-necked Turtle Chelodina canni Cann's snake-necked turtle Exclusion species Chelodina expansa Broad-shelled long-necked turtle Chelodina longicollis Eastern long-necked turtle Chelodina rugosa/oblonga Northern snake-necked turtle Target species Chelodina steindachneri Dinner-plate turtle Elseya albagula White-throated snapping turtle Elseya dentata Northern snapping turtle Exclusion species Elseya irwini Irwin's turtle Elseya lavarackorum Gulf snapping turtle Exclusion species Elusor macrurus Mary River turtle Emydura m. krefftii Krefft s River Turtle Emydura s. subglobosa Red-bellied short-necked turtle Exclusion species Emydura s. worrelli Diamond headed turtle Exclusion species Emydura tanybaraga Yellow-faced turtle Exclusion species Emydura victoriae Red-faced turtle Exclusion species Macrodiremys collei South-western snake-necked turtle Pelochelys bibroni New Guinea giant softshell turtle Exclusion species Pseudemydura umbrina Western swamp turtle Rheodytes leukops Fitzroy River turtle Trachemys scripta Pond slider Wollumbinia bellii Namoi River snapping turtle Wollumbinia georgesi Bellinger River snapping turtle Wollumbinia latisternum Saw-shelled turtle Exclusion species Wollumbinia purvisi Manning River turtle

11 APPENDIX 2 PROBE SEQUENCE DETAILS PCR Fragment information Gene Species Fragment length [bp] Thermo Fisher Catalogue Number 16S Northern snake-necked turtle edna Probe Design for Chelodina oblonga -TropWATER Report no. 17/36 Probe information Probe name Dye Probe sequence Modification Length Cheobl_16S_Probe FAM CACCAAAGTGCCCAA MGB 15 Forward primer information Forward primer name Forward primer sequence Length Cheobl_P_16S_F GTGACCTTGGAGAACAATA 19 Reverse primer information Reverse primer name Reverse primer sequence Length Cheobl_P_16S_R CACCATTAGGATGTCCTG 18 11