GROWTH PERFORMANCE, CARCASS TRAITS AND ECONOMIC VALUES OF PEKIN, MUSCOVY, AND MULARD DUCKS
|
|
- Emily Horton
- 5 years ago
- Views:
Transcription
1 Slov Vet Res 2018; 55 (Suppl 20): DOI /SVR Originl Reserch Article GROWTH PERFORMANCE, CARCASS TRAITS AND ECONOMIC VALUES OF PEKIN, MUSCOVY, AND MULARD DUCKS Frdos A.M. Hssn, Elshim M. Roushdy, Asm W. Zglool, Mohmmed A. Ali, Imn E. El-Arby* Deprtment of Animl Welth Development, Fculty of Veterinry Medicine, Zgzig University, El-Zer str. 114, Zgzig, Egypt *Corresponding uthor, Emil: Abstrct: This study imed to reconnoiter breed vritions in productivity, trits of crcss, economic rte, nd IGF-1 gene regultion for met production mong Pekin, Muscovy, nd Mulrd ducks. A 10-week tril ws conducted, using 120 ducklings (2-week old) tht were divided into three groups bsed on breed. Ech breed ws kept in seprte group, divided into four replictes of 10 birds ech. Muscovy ducks exhibited superior body weight, weight gin, feed conversion rtio, dressing nd brest percentge compred to the other breeds (P 0.001). The highest percentge of crude protein ws observed in the met of Mulrd ducks leg (23.17) nd brest (50.55), nd in Muscovy brest met (51.04). Pekin ducks yielded significntly higher (P 0.001) leg nd brest ft content (6.27, 6.40 respectively) thn Muscovy (4.58, 4.26 respectively) or Mulrd ducks (4.13, 3.88 respectively). Notbly, Muscovy ducks in comprison to the other breeds yielded the highest gross mrgin ($1.12) nd lowest budget to produce 1kg of live body weight ($2.08) (P= 0.004). Furthermore, heptic IGF-1 nd IGF1R expression ws higher in the Muscovy breed thn in the other breeds. These genes increse the growth nd development of muscles. Therefore, the Muscovy ducks re generlly superior in terms of performnce, crcss trits, nd economic vlues. Key words: duck breeds; performnce; crcss merits; costs; IGF-1; IGF-1R Introduction Ducks hve been consumed spordiclly in the pst, but re now rered both intensively nd commercilly. They re primrily rered for met nd eggs, lthough their fethers lso hve economic vlue. Duck met is comprble to tht of chicken nd is n lterntive source of protein, minerls, nd other nutrients for humns. In comprison to chickens, ducks re better dpted to vrying environmentl conditions, require less cre, nd re more resistnt to number of diseses (1). These chrcteristics likely form the bsis for the incresing importnce nd populrity of the duck industry. Some of the populr duck breeds rised for met production under Egyptin conditions include the Pekin, Muscovy, nd Mulrd. The Pekin duck is commonly bred for met production in Egypt. Improvements in White Pekin strins tke dvntge of the duck s nturl bility to grow rpidly nd its resistnce to infections to which other poultry re susceptible. Thus, producers re ble to reduce input costs while improving crcss qulity nd Received: August 2018 Accepted for publiction: September 2018
2 358 F. A.M. Hssn, E. M. Roushdy, A. W. Zglool, M. A. Ali, I. E. El-Arby fethering. Genetic improvements hve now cused the modern domestic White Pekin to surpss the broiler breeds of chicken in feed efficiency nd weight gin t similr living mrket weight (2). On the other hnd, Muscovy ducks re very populr becuse they dpt well to vrious rering conditions nd they hve high brest met with unique tste nd lest clorie content (3) in comprison to Pekin ducks. The Mulrd (hybrid of Muscovy nd Pekin ducks) hs been used for production of fttened liver s well s for met production (4,5). Their crcsses re chrcterized by high proportion of brest nd leg muscle nd low proportion of subcutneous ft. Economic trits such s crcss trits nd growth performnce re very significnt in duck production. These trits re controlled by sets of cndidte genes which ply n importnt role in ducks growth nd development s the insulin-like growth fctors genes (IGF-1 nd IGF-2). The IGF-1 hs the potentil to be key regultor of growth, body composition nd skeletl trits during postntl development (6), wheres IGF-2 reportedly functions primrily during embryonic growth nd development (7). Therefore, this study ws crried out to evlute performnce, crcss merits, economic vlues, nd IGF-1 nd IGF1R gene regultion in Pekin, Muscovy, nd Mulrd ducks rered under Egyptin subtropicl conditions Mteril nd methods Experimentl design, diets, nd husbndry of duck flock: A totl of 120 mle, two weeks old Muscovy, Pekin, nd Mulrd ducklings (40 ech) of uniform body weight were used in this study. Ech breed ws rered until the ge of 12 weeks nd mintined s seprte groups, divided into four replictes with 10 ducklings ech. A wing bnd ws used to lbel ech duck. During the experiment, wter nd feed were supplied d libitum. Strter diets with 20% crude protein (from 2 to 7 weeks) nd Tble 1: Ingredients nd chemicl composition of experimentl diets fed to ducks Items Strter (2 7 weeks) Grower/Finisher (8 12 weeks) Ingredients (g/kg) Yellow corn Soyben mel, 44% Corn gluten, 60% Soyben oil Clcium crbonte Dibsic clcium phosphte Sodium chloride Premix 1 DL- Methionine, 98% L-lysine, 78% Clculted chemicl composition 2 ME, MJ CP, % EE, % CF, % C, % Avilble Ph, % Lysine, % Methionine, % Supplied per kg of diet: Vitmin A (12000 IU); Vitmin D 3 (2200 IU); Vitmin E (10 mg); Vitmin K 3 (3 mg); Vitmin B 1 (1mg); Vitmin B 2 (5 mg); Vitmin B 6 (1.5 g); Pntothenic cid (10 mg); Vitmin B 12 (10mg); Nicin (30 mg); Folic cid (1mg); Biotin (50 mg); Fe (30 mg); Mn (60 mg); Cu (4 mg); I (1mg); Co (1mg); Se (1 mg); nd Zn (50 mg); Choline chloride (300 mg). 2 Clculted ccording to NRC (1994) tbles. ME = Metbolizble energy; CP = Crude protein; EE = Ether extrct; CF = Crude fiber.
3 Growth performnce, crcss trits nd economic vlues of Pekin, Muscovy, nd Mullrd ducks 359 grower/finisher diets with 18% crude protein (from 8 to 12 weeks) were fed to the ducklings in the form of dry msh. All experimentl diets were formulted to ensure n dequte supply of ll nutrients ccording to the Ntionl Reserch Council (8) recommendtions for duck breeds (Tble 1). Ducks of ll groups were kept under similr mngement conditions nd housed in pens with similr floors (5 birds/m 2 ) covered with 5-cm thickness of wood shvings s bedding. The temperture of the houses ws mintined t 25 C, nd continuous light ws provided from the 2 nd week until the end of the study. All ducklings were vccinted by live ttenuted vccines ginst duck choler (1 ml/duckling, subcutneous), duck plgue (0.5 ml/duck, intrmusculr), nd duck virus heptitis (1 ml/duck, intrmusculr) t the ge of 28, 46 nd 50 dys, respectively. The niml experiment protocol ws pproved by the Institutionl Animl cre nd Use committee t Zgzig University. The experiment ws conducted t the reserch frm of Poultry nd Rbbit, Fculty of Veterinry Medicine, Zgzig University, Egypt. Growth performnce Finl live body weight (LBW) ws recorded nd body weight gin (BWG), verge feed intke (AFI), nd feed conversion rtios (FCR) were clculted t the end of experiment. The feed ws withdrwn before birds weighing for 2h. Feed conversion ws clculted s g feed/g gin. LBW nd BWG were evluted bsed on individul bird dt, wheres AFI nd FCR were ssessed bsed on the replicte unit. Smple collection, crcss trits, nd met nlysis Eight ducks from ech studied breeds (two from ech replicte) were selected ccording to n verge body weight for the respective breed nd fsted for 12h before slughtering. The birds were mrked with individul numbers, weighed, nd euthnized by cervicl disloction before being mnully defethered nd eviscerted. The giblets (liver, gizzrd, nd hert), eviscerted crcss, brest nd thigh muscles were weighed nd their percentges reltive to live body weight were clculted. After slughter, the liver ws weighed nd two 1-cm sections were immeditely resected, gently flushed with PBS, nd stored t -80 C until mrna extrction. Smples of brest nd thigh met of selected individuls were lso resected, dried, ground, nd subjected to proximte nlysis to determine crude protein, moisture, totl sh, nd ft content. Smples were investigted using stndrd procedures (9). IGF-1 nd IGF1R gene expression in liver by Rel-Time PCR RNA from the liver smples ws extrcted using QIAmp RNesy Mini kit (Qigen, Germny) ccording to the mnufcturers instructions. A GeneQunt spectrophotometer (Phrmci Biotech, Freiburg, Germny) ws used to estimte purity nd concentrtion of RNA. Complementry DNA (cdna) ws obtined by reverse trnscriptse of RNA using RevertAid Reverse Trnscription kit (Thermo Fisher). Rel-time PCR nlysis ws performed using QuntiTect SYBR Green PCR kit (Qigen, Germny), with β-ctin s the internl control gene. Gene-specific primer sequences F1:CAACGAGCGGTTCAGGTGT, R1:TGGAGTTGAAGGTGGTCTCG, F2: ATCCAGCAGTAGACGCTTACACC, R2: CGTGCAGACTTAGGTGGCTTTA nd F3: GGTATTCCACCTCACTCTCCT, R3: AACTTCCTTCACAACTCCATCT were used to mplify 92 bp of Duck β-ctin, 117 bp of IGF-1, nd160 bp of IGF1R (10). The qrt-pcr ws crried out in 25µl volume of 12.5 µl of 2 QuntiTect SYBR Green PCR Mster Mix; 0.5 µl of ech primer, 0.25 µl of RevertAid Reverse Trnscriptse (200 U/µL); 3 µl of the templte nd 8.25 µl of nuclese free wter. The cycling ws progrmmed s follows: 95 C for 5 min; followed by 40 cycles of 15s t 95 C, 15s t 60 C, nd 15s t 72 C. Melt-curve nlysis ws performed between 65 C to 95 C, using increments in temperture of 0.5 C. Ct vlues for the SYBR green RT-PCR were mesured using Strtgene MX3005P softwre
4 360 F. A.M. Hssn, E. M. Roushdy, A. W. Zglool, M. A. Ali, I. E. El-Arby (Strtgene Technicl Services, USA). To clculte the vrition in gene expression in the RNA of vrious smples, the Ct of ech smple ws compred with tht of the Pekin breed s reference (the lowest growth breed) ccording to the "ΔΔCt method outlined by Yun et l. (11). Economic vlues of duck breeds The economic vlue of the breeds under investigtion ws evluted using cost-benefit nlysis, by estimting the totl vrible costs (TVC), gross income for live weight, gross mrgin, nd benefit cost rtio (BCR). Totl vrible costs were estimted by considering the cost incurred in obtining the ducklings, s well s the expenses of feed, litter, lbor, veterinry services, electricity, nd other miscellneous expenditure. Fixed costs were not included in the nlysis, becuse they were equl cross ll breeds. Gross mrgin nlysis ws used to determine profitbility of the breeds, s described by Olukosi nd Erhbor (12). The unit of mesurement ws USD/kg live weight. The following eqution ws used to derive gross mrgin: GM= GI TVC, where GM= gross mrgin; GI= gross income/kg live weight; nd TVC= totl vrible cost tht represents the totl cost of production/kg live weight. The benefit cost rtio (BCR) ws derived by the following formul: GM/TVC. Sttisticl nlysis All sttisticl nlyses were performed using SPSS V.16 softwre (SPSS, IL, USA). Dt were nlyzed using one-wy ANOVA, fter normlity ws verifying using the Kolmogorov Smirnov test. The Tukey s (HSD) multiple comprison test ws used to determine significnt differences between men vlues. Vribility in the dt ws expressed s the pooled SEM, nd the lph level for determintion of significnce ws set t Results Growth performnce As shown in Tble (2), the Muscovy breed showed the gretest finl BW ( ) nd BWG ( ) followed by the Mulrd ( nd , respectively) nd Pekin ( nd , respectively). In ddition, AFI nd FCR were significntly declined in Muscovy breed compred to the other breeds. However, no significnt chnge ws detected between the Pekin nd the Mulrd. Tble 2: Growth performnce of Muscovy, Pekin, nd Mulrd ducks Breed Prmeter Muscovy Pekin Mulrd SEM P-vlue Initil BW (g) Finl BW (g) c b BWG (g) c b AFI (g) b FCR (g feed: g gin) 2.94 b BW: Body weight, BWG: Body weight gin, AFI: Averge feed intke, FCR: Feed conversion rtio c Mens bering different superscript letters within the sme row re significntly different (P<0.05). SEM: Stndrd error of mens. Crcss trits nd met composition Crcss trits of the vrious breeds re summrized in tble 3. The results reveled tht the dressing percentge of Muscovy ducks (75.20) ws highly significnt (P 0.001) thn tht of Mulrd or Pekin ducks (73.73, respectively). Both Muscovy nd Mulrd ducks possess higher reltive brest weight (51.04, respectively) compred to Pekin ducks (49.39). The reltive thigh weight differed significntly mong the breeds, with the Muscovy breed yielding the highest vlues (P = 0.001). Differences in the percentges observed
5 Reltive mrnaexpression of IGF-1&IGF-1R Growth performnce, crcss trits nd economic vlues of Pekin, Muscovy, nd Mullrd ducks 361 Tble 3: Crcss trits nd met composition of Muscovy, Pekin, nd Mulrd ducks Breed Prmeter Muscovy Pekin Mulrd SEM P-vlue Crcss chrcteristics Dressing % c b Brest % b Thigh % b b Hert % Liver % 2.36 b 2.26 b Gizzrd % Brest met composition Moisture % b Protein % b Ft % 4.26 b b Ash % Thigh met composition Moisture % Protein % b b Ft % 4.58 b b Ash % c Mens bering different superscripts within the sme row re significntly different (P<0.05). SEM: Stndrd error of mens. 3 Muscovy Pekin Mulrd 2,5 b 2 1,5 b 1 c c 0,5 0 1-IGF 1-IGFR Figure 1: Quntittive expression of IGF-1 nd IGF1R extrcted from the liver of vrious duck breeds (men ± SEM) fter 10 weeks. Groups with different letters re significntly different (P< 0.05, one-wy ANOVA)
6 362 F. A.M. Hssn, E. M. Roushdy, A. W. Zglool, M. A. Ali, I. E. El-Arby Tble 4: Economic vlues for Muscovy, Pekin, nd Mulrd ducks Prmeter Breed Muscovy Pekin Mulrd SEM P-vlue Feed cost / duck ($) 4.59 b Feed cost / kg weight gin ($) b TVC / kg live weight ($) 2.08 b 2.15 b Gross income / duck ($) c b GM / kg live weight ($) c 0.64 b Benefit cost rtio (BCR) c 0.28 b Costs per kg feed=$0.45 nd $0.41 for strter nd grower rtion, respectively. Purchsing price per duck= $2.56, $1.41, $2.30 for Muscovy, Pekin, nd Mulrd, respectively. Selling price (Gross income)/kg live weight= $3.20, $2.43, $2.94 for Muscovy, Pekin nd Mulrd, respectively. TVC = Totl vrible costs; GM = Gross mrgin. -c Mens bering different superscripts within the sme row re significntly different (P< 0.05). SEM: Stndrd error of mens. for hert nd gizzrd were not significnt (P>0.05) mong the breeds; however, the liver percentge of Mulrd ducks (3.34%) ws considerbly higher thn tht of Muscovy nd Pekin ducks (2.36 nd 2.26%, respectively). As shown in Tble 3, the brest nd thigh met composition differed significntly mong the vrious breeds. The moisture content ws highly significnt (P 0.001) in the brest met of Mulrd nd Muscovy ducks compred to tht of Pekin ducks. The highest percentge of crude protein ws observed in the leg nd brest met of Mulrd ones, nd in Muscovy brest met. Pekin ducks yielded significntly higher (P 0.001) content of ft in both leg nd brest met thn Muscovy nd Mulrd ducks, wheres the crcss ftness of Muscovy nd Mulrd ducks ws similr. No significnt differences (P>0.05) were detected in the sh content of brest nd thigh muscles mong the vrious breeds. IGF-1 nd IGF1Rgenes expression The reltive chnges in IGF-1 mrna trnscript levels re presented in Figure (1). These results clerly demonstrte tht the Muscovy ducks showed higher significnt IGF- 1 gene expression, followed by Mulrd nd Pekin ducks in tht order. Economic vlues of duck breeds Economic clcultions reveled tht Muscovy breed hd significntly lower (P 0.001) feed cost nd feed cost/kg gin compred to the other breeds, wheres there is no significnt difference between Pekin nd Mulrd breeds (Tble 4). However, the totl vrible costs of Muscovy nd Pekin were significntly lesser thn those of Mulrd ducks (P = 0.004). Muscovy ducks showed the highest vlues for gross income ($12.49), gross mrgin ($1.12), nd benefit cost rtio (0.54), followed by Mulrd nd Pekin ducks in tht order. Discussion It is importnt to note tht the three breeds under investigtion (Muscovy, Pekin, nd Mulrd) differ considerbly in terms of growth rte nd the chrcteristics of vluble body prts, but ll hve the bility to grow continuously until the 12 th week of life (13). As shown in our results, Muscovy ducks yielded superior vlues for body weight, weight gin, verge feed intke, nd feed conversion rtio ( , , nd 2.94, respectively), which is consistent with previous studies (14-16). However, Bhuiyn et l. (17) climed tht the Pekin breed is superior to both Muscovy nd Deshi white ducks. The highest weight in Mulrd hybrid ducks during the 12 th week of life, in comprison to Muscovy nd Pekin ducks (13). Numerous studies hve shown tht the crcss s composition nd the met yield of ducks vried by breed. In the present study, Muscovy ducks yielded significntly higher dressing percentge of compred to Pekin (72.41%) nd Mulrd ducks (73.73%). Moreover, the highest brest nd thigh percentges
7 Growth performnce, crcss trits nd economic vlues of Pekin, Muscovy, nd Mullrd ducks 363 were observed in Muscovy ducks. The high dressing percentge observed in the Muscovy could be ttributed to its heviness. In ddition, two possible resons for the higher dressing percentge of Muscovy ducks re reduced plumge nd smller internl orgns in comprison to other breeds (14). Similrly, El- Soukkry et l. (18) reported tht the Muscovy duck hd significntly higher commercil cut yield (including the brest nd drumstick) thn Pekin nd Sudni ducks. Also, Wwro et l. (19) reported tht the highest vlues for brest nd leg muscle weight were observed in the crcsses of Muscovy mles. However, Bhuiyn et l. (17) reported tht the highest dressing yield ws observed in Pekin ducks (70%) s compred to Muscovy nd Deshi White ducks. The present study clrified tht the moisture content in the brest met of Mulrd nd Muscovy ws highly significnt thn tht of Pekin breed. The highest percentge of crude protein ws observed in the met of leg nd brest of Mulrd ducks, nd in Muscovy brest met. Pekin ducks yielded significntly higher in both leg nd brest met ft content thn either Muscovy or Mulrd ducks. No significnt vrinces (P> 0.05) were detected in sh content of brest nd thigh muscles mong the vrious breeds. These results re consistent with those of nother study conducted by Wwro et l. (19), who reported the highest crude protein vlues ( = 19.5%) in Muscovy nd Mulrd brest muscles, nd low significnt vlue in the Pekin brest muscle ( = 19.0%). According to Isguzr et l. (20), the ft content of the Pekin leg nd brest met is significntly higher thn tht of locl Turkish breeds. The moisture percentge in the Muscovy leg nd brest met ws higher thn Sudni ducks (21). In contrst, Bons et l. (22) noted greter content of brest protein (21.5%) nd muscles of leg (22.5%) of Pekin breed. The thigh nd brest muscle wter content were significntly higher, nd the sh content ws significntly lower in the Pekin thn in the Muscovy (15). The IGF system hs been considered s n essentil regultory system for controlling development nd growth in mmmls nd chickens. IGF-1, s member of the IGF fmily, is growth, metbolism, body composition, skeletl chrcteristics, ft deposition nd growth of dipose tissue cndidte gene in chickens (23). Moreover, IGFIR is membrne glycoprotein mediting the biologicl ctions of IGF-1 nd IGF-2, which hve gret effect on chicken growth nd qulity trits of met nd crcss (24). IGF1R plyed importnt roles on the developmentl nd dult stges such s the cell cycle, trnsplnttion, subsistence, metbolism, propgtion nd differentition (25) In previous studies, higher significnt of heptic IGF-1 expression hs shown breed specificity in ducks (26), nd chickens (27). Similrly, the present results showed significnt differences in IGF-1 expression mong the vrious breeds. The highest expression ws observed in the Muscovy, finding tht might be responsible for its superior muscle growth nd crcss merit. Assessment of the three breeds indicted tht the Muscovy ws the most economicl (followed by the Mulrd nd Pekin), both in terms of the cost to produce 1kg live weight nd the feed cost per unit gin. In ddition, the highest profit mrgin ws relized from the Muscovy. The min contributing fctors to the comprtively higher profit mrgin of Muscovy ducks include the higher mrket price of the met, nd to lesser extent, the superior biologicl efficiency of Muscovy ducks in comprison to Mulrd nd Pekin ducks (28). In comprison to other breeds, the Muscovy yields the best vlues for net income, net income mrgin, nd gross return ttributed to the totl vrible costs per 100 prent ducks (29). Conclusion In conclusion, Muscovy ducks showed higher performnce, dressing percentge, nd IGF-1 expression thn Mulrd or Pekin ducks. The Muscovy nd Mulrd breeds yielded better qulity thn the Pekin, owing to higher protein content nd lower body ft. Conflict of interest The uthors declre tht they hve no conflict of interest.
8 364 F. A.M. Hssn, E. M. Roushdy, A. W. Zglool, M. A. Ali, I. E. El-Arby References 1. Adzitey F, Adzitey SP. Duck production: Hs potentil to reduce poverty mong rurl households in Asin communities A review. J.World's Poult. Res. 2011; 1: Xu TS, Liu XL, Hung W, Hou SS. Estimtes of genetic prmeters for body weight nd crcss composition in Pekin ducks. J. Anim Vet. Adv. 2011; 10: Wu X, Yn MJ, Lin SY, Liu XT, Li A, et l. GH gene polymorphisms nd expression ssocited with egg lying in Muscovy ducks (Cirinmoscht). Heredits 2014; 151: Béz E, Slichon MR, Mrche G, Wcrenier N, Dominguez B, Culioli J, et l. Effect of ge nd sex on the structurl, chemicl, technologicl chrcteristics of mule duck met. Br. Poult. Sci. 2000; 41: Wwro K, Bochno R, Wilkiewicz- Wwro E. Slughter vlue of crossbred ducks (Muscovy Pekin) slughtered t different ge. NATSCI. 2001; 8: Mrk McM, Richrds P, Poch SM, McMurtry JP. Expression of insulin-like growth fctor system genes in liver nd brin tissue during embryonic nd post-htch development of the turkey. CBP 2005; 141: Mc Murtry JP, Frncis GL, Upton Z. Insulin-like growth fctors in poultry. Domest. Anim. Endocrinol.1997; 14: Richrds MP, Poch SM, McMurtry JP. Expression of insulin-like growth fctor system genes in liver nd brin tissue during embryonic nd post-htch development of the turkey. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2005; 141: Ntionl Reserch Council (NRC). Nutrient requirements of poultry, 9 th revised edition. Ntionl Acdemy Press, Wshington, DC, USA 1994; AOAC. Officil methods of nlysis (18 th ed).assocition of Officil Anlyticl Chemist. Arlington, VA, USA 2004; Song CL, Liu HH, Kou J, Lv L, Li L, Wng WX nd Wng JW. Expression profile of insulin-like growth fctor system genes in muscle tissues during the postntl development growth stge in ducks. Genet. Mol. Res. 2013; 12 (4): Yun JS, Reed A, Chen F, Stewrt CN, et l. Sttisticl nlysis of rel-time PCR dt. BMC Bioinformtics 2006; 7: Olukosi JO, Erhbor PO. Introduction to frm mngement: principles nd pplictions. Agitb Publishers Limited, Zri, Nigeri 1988; Szász S. Chnges in fether development nd met producing cpcity of the Pekin, Mule nd Muscovy ducks ccording to the ge nd sex. PhD thesis, Deprtment of Poultry Breeding, Fculty of Animl Science, 2003; University of Kposvár, Kposvár, Hungry. 15. Rshid MA, Kwsr MH, Rshid MA, Mih MY, Howlider MAR, et l. Fertility nd htchbility of Pekin nd Muscovy duck eggs nd performnce of their ducklings. Progress. gric. 2009; 20: Gll A, Ali WAH, Ahmed AMH, AliKh AA, et l. Performnce nd crcss chrcteristics of Dumyti, Muscovy, Peking nd Sudni duck breeds. Egyptin J. Anim. Prod.2011; 48: Stęczny K, Kuźnick J, Admski M. Comprison of growth rte nd body weight of ducks of different origins. Act Sci.Pol., Zootechnic 2015; 14: Bhuiyn MM, Khn MH, Khn MAH, Ds BC, Lucky NS, Uddin MB, et l. A study on the comprtive performnce of different breeds of broiler ducks under frmer s condition t Frming System Reserch nd Development (FSRD) site, Sylhet, Bngldesh. Int. J. Poult. Sci. 2005; 4: El-Soukkry FAH, Mohmed HMA, Dwood AAA, Abd-El Syed SY, et l. Physicochemicl, microbiologicl nd lipid chrcteristics of duck met. Minufiy J. Agric. Res. 2005; 30: Wwro K, Wilkiewicz-Wwro E, Kleczek K, Brzozowski W, et l. Slughter vlue nd met qulity of Muscovy ducks, Pekin ducks nd their crossbreeds, nd evlution of the heterosis effect. Arch. Anim. Breed. 2004; 47: Isguzr E, Kock C, Pingel H. Growth, crcss trits nd met qulity of different locl ducks nd Turkish Pekins (short communiction). Arch. Anim. Breed. 2002; 45:
9 Growth performnce, crcss trits nd economic vlues of Pekin, Muscovy, nd Mullrd ducks Abd El-Smee LD, El-Allwy HMH, Mghrby NA, et l. Comprtive study on some productive trits of Muscovy nd Sudni ducks in Egypt. Int. J. Poult. Sci. 2012; 11: Bons A, Timmler R, Jeroch H, et l. Chnges in body composition nd crude nutrient content of Pekin ducks during growth. In Proceedings of the First World s Wterfowl Conference, 1-4 December 1999, Tichung, Tiwn, pp Zhou H, Mitchell AD, McMurtry JP, Ashwell CM, Lmont SJ, et l. Insulin-like growth fctor-i Gene polymorphism ssocitions with growth, body composition, skeleton integrity, nd metbolic trits in chickens. Poult. Sci. 2005; 84: Amills M, Jiménez N, Villlb D, Tor M, Molin E, Cubiló D, Mrcos C, Frncesch A, Sànchez A, Estny J, et l. Identifiction of three single nucleotide polymorphisms in the chicken insulin-like growth fctor 1 nd 2 genes nd their ssocitions with growth nd feeding trits. Poult. Sci. 2003; 82: Lei M, Peng X, Zhou M, Luo C, Nie Q, Zhng X, et l. Polymorphisms of the IGF1R gene nd their genetic effects on chicken erly growth nd crcss trits. BMC Genet. 2008; 9: Shu J, Li H, ShnY, XuW, Chen W, Song C, Song W, et l. Expression profile of IGF-I-clcineurin-NFATc3-dependentpthwy genes in skeletl muscle during erly development between duck breeds differing in growth rtes. Dev. Genes Evol. 2015; 225: Goud EM, Esswy GS. Polymorphism of insulin-like growth fctor I gene mong chicken breeds in Egypt. Z. Nturforsch. 2010; 65: Solomon JKQ, Austin R, Cumberbtch RN, Gonslves J, Seforth E, et l. A comprison of live weight nd crcss gin of Pekin, Kunshn nd Muscovy ducks on commercil rtion. livestock res. rurl dev. 2006; 18: 154.
Comparative Study on Some Productive Traits of Muscovy and Sudani Ducks in Egypt
Interntionl Journl of Poultry Science 11 (4): 264-268, 2012 ISSN 1682-8356 Asin Network for Scientific Informtion, 2012 Comprtive Study on Some Productive Trits of Muscovy nd Sudni Ducks in Egypt Lil D.
More informationet.al.2002;sartori et.al.2001 Finisher Gonzales et.al.(2000) adlibitum Dry matter
5 6 Suget et.l. Sleh et.l,6 Leeson Zuir Gonzles et.l.(000) Tumov et.l.00;srtori et.l.00 Finisher Brto 6 Dgs& Bustri, Bene et.l. 00 Hood C : P 6 6 C : P 5 6 6 dliitum 6 5 6 Dry mtter 5 Orgnic mtter A.O.A.C
More informationComparative Study on Production Efficiency of Two Strains of Brown and White Egg Laying Hens in Kuwait
Interntionl Journl of Poultry Science 12 (7): 383-389, 2013 ISSN 1682-8356 Asin Network for Scientific Informtion, 2013 Comprtive Study on Production Efficiency of Two Strins of Brown nd White Egg Lying
More informationIntroduction: Definition of Palatability
Mesurement of pltility of common ingredients used in feed mixes for lms nd ewes A. Mereu,, G. Molle, V. Giovnetti, M. Acciro, M. Decndi, A. Cnns Diprtimento di Scienze Zootecniche, Università di Sssri,
More informationEffect of Dwarfism on Reproductive and Meat Yield Parameters of Crossbred Chicken
Interntionl Journl of Poultry Science 4 (6): 372-377, 2005 ISSN 1682-8356 Asin Network for Scientific Informtion, 2005 Effect of Dwrfism on Reproductive nd Met Yield Prmeters of Crossred Chicken 1 2 3
More informationTECHNICAL SUMMARY October 2013
TECHNICAL SUMMARY October 2013 GeneSTAR MVPs Moleculr Vlue Predictions for beef feed efficiency, 1 mrbling 2 nd tenderness Key Points GeneSTAR is DNA-mrker test for importnt production trits in ll breeds
More informationESTIMATION OF BREEDING VALUES AND THEIR ACCURACIES USING MULTIVARIATES ANIMAL MODEL ANALYSIS FOR GROWTH TRAITS IN THREE LOCAL STRAINS OF CHICKENS
Egypt. Poult. Sci. Vol. 0 (IV) Dec. 000 (98-00) ESTIMATION OF BREEDING VALUES AND THEIR ACCURACIES USING MULTIVARIATES ANIMAL MODEL ANALYSIS FOR GROWTH TRAITS IN THREE LOCAL STRAINS OF CHICKENS M. M. IRAQI,
More informationThe Use of Dried Tomato Pulp in Diets of Laying Hens
Interntionl Journl of Poultry Science 5 (7): 68-622, 2006 ISSN 682-8356 Asin Network for Scientific Informtion, 2006 The Use of Dried Tomto Pulp in Diets of Lying Hens 2 Mssoud Jfri, Rsoul Pirmohmmdi nd
More informationCHARACTERISTICS ASSOCIATED WITH OUT CROSSING IN A SHORT DURATION IMPROVED RICE (Oryza sativa L) VARIETY AT307
CHARACTERISTICS ASSOCIATED WITH OUT CROSSING IN A SHORT DURATION IMPROVED RICE (Oryz stiv L) VARIETY AT307 Kumr APA 1, Dhnyke Nilnthi 1 *, Phthinyke BD 2 nd Sennyke SGJN 1 1 Deprtment of Agriculturl Biology,
More informationEffect of Rearing Program, Body Conformation and Protein Level of Breeder Feed on Broiler Breeder Hen Reproductive Performance
Interntionl Journl of Poultry Science (): 670-679, 0 ISSN 68-856 Asin Network for Scientific Informtion, 0 Effect of Rering Progrm, Body Conformtion nd Protein Level of Breeder Feed on Broiler Breeder
More informationThe Japanese Quail: A Review
Interntionl Journl of Poultry Science 7 (9): 95-9, 008 ISSN 68-856 Asin Network for Scientific Informtion, 008 The Jpnese Quil: A Review Nsrollh Vli Deprtment of Animl Sciences, Fculty of Agriculture,
More informationHaematological and Biochemical Changes in Japanese Quails Coturnix coturnix Japonica and Chickens Due to Ascaridia galli Infection
Interntionl Journl of Poultry Science 7 (7): 704-70, 2008 ISSN 682-8356 Asin Network for Scientific Informtion, 2008 Hemtologicl nd Biochemicl Chnges in Jpnese Quils Coturnix coturnix Jponic nd Chickens
More informationESTIMATION OF (CO) VARIANCE COMPONENTS OF EWE PRODUCTIVITY TRAITS IN KERMANI SHEEP
Slovk J. Anim. Sci., 46, 2013 (2): 45-51 2013 CVŽV ISSN 1337-9984 ESTIMATION OF (CO) VARIANCE COMPONENTS OF EWE PRODUCTIVITY TRAITS IN KERMANI SHEEP M. R. MOHAMMADABADI*, R. SATTAYIMOKHTARI Deprtment of
More informationMetabolizable Energy Requirements for Broiler Breeder in Different Environmental Temperatures
Interntionl Journl of Poultry Science 11 (7): 453-461, 2012 ISSN 1682-8356 Asin Network for Scientific Informtion, 2012 Metolizle Energy Requirements for Broiler Breeder in Different Environmentl Tempertures
More informationThe. Feeding Value of
The. Feeding Vlue of,e9cv Pcific Northwest Grown Soybens for Mrket Turkeys Specil Re December 1977 Agriculturl Experiment Sttion Oregon Stte University, AUTHORS: P. L. Prdis, J. A. Hrper, H. S. Nkue nd
More informationInfluence of 2-hydroxy-4-(Methylthio)butanoic Acid on Early Egg and Chick Weights of Broiler Breeders
Interntionl Journl of Poultry Science 2 (6): 430-437, 2003 Asin Network for Scientific Informtion 2003 Influence of 2-hydroxy-4-(Methylthio)utnoic Acid on Erly Egg nd Chick Weights of Broiler Breeders
More informationEVALUATION OF S FOR FLY (DIPTERA: MUSCIDAE) CONTROL AS A FEED-THROUGH COMPOUND FOR POULTRY, CATTLE, AND SWINE'
EVALUATION OF S-31183 FOR FLY (DIPTERA: MUSCIDAE) CONTROL AS A FEED-THROUGH COMPOUND FOR POULTRY, CATTLE, AND SWINE' R. W. Miller Livestock Insects Lbortory, LPS! ARS, USDA Beltsville, MD 275 (Accepted
More informationIncreasing survival of wild macaw chicks using foster parents
Gbriel Vigo Truco,b,c nd Donld J. Brightsmithbb,c Deprtment of Wildlife nd Fisheries, Texs A&M University,b Schubot Exotic Bird Helth Center, Texs A&M University, c Tmbopt Mcw Project, Mdre de Dios, Perú
More informationEvaluation of the Growth Potential of Local Chickens in Malawi
Interntionl Journl of Poultry Science 4 (): 64-70, 005 ISSN 168-8356 Asin Network for Scientific Informtion, 005 Evlution of the Growth Potentil of Locl Chickens in Mlwi T.N. Gondwe* nd C.B.A. Wollny Institute
More informationEffects of Genotype and Housing System on the Laying Performance of Chickens in Different Seasons in the Semi-Humid Tropics
Interntionl Journl of Poultry Science 6 (6): 434-439, 2007 ISSN 1682-8356 Asin Network for Scientific Informtion, 2007 Effects of Genotype nd Housing System on the Lying Performnce of Chickens in Different
More informationPLASMA CORTISOL LEVEL AND MAIN METABOLISM EVOLUTION IN PREGNANT EWE
PLASMA CORTISOL LEVEL AND MAIN METABOLISM EVOLUTION IN PREGNANT EWE N. Dojnă, Iulin Codrenu, Costin Budică Fculty of veterinry medicine Buchrest, Romni, dojn2001@yhoo.com. Abstrct The purpose of this reserch
More informationResearch with Finnsheep
I j, I Agriculture Cnd Reserch Brnch Direction generte de l recherche Technicl Bulletin 1991-2E Reserch with Finnsheep in Cnd * ' - * Cnd Digitized by the Internet Archive in 2011 with funding from Agriculture
More informationEffect of mating strategies on genetic and economic outcomes in a Montbéliarde dairy herd
Umotest Umotest Effect of mting strtegies on genetic nd economic outcomes in Montbélirde diry herd MARIE BERODIER M. BROCHARD, C. DEZET TER, N. BAREILLE, V. DUCROCQ Study funded by MO3 The Montbélirde
More informationShell Thickness of Turkey Eggs Affects Cardiac Physiology and Embryo Survival 1
Interntionl Journl of Poultry Science 5 (8): 796-80, 2006 ISSN 682-856 Asin Network for Scientific Informtion, 2006 Shell Thickness of Turkey Eggs Affects Crdic Physiology nd Emryo Survivl 2 2 4 2 V.L.
More informationHigh Frequency of Antimicrobial Resistance in Human Fecal Flora
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Dec. 1988, p. 181-186 66-484188112181-6$2./ Copyright 1988, Americn Society for Microbiology Vol. 32, No. 12 High Frequency of Antimicrobil Resistnce in Humn Fecl
More informationGenetic divergence of early song discrimination between two young songbird species
In the formt provided y the uthors nd unedited. Genetic divergence of erly song discrimintion etween two young songird species Dvid Whetcroft* nd Ann Qvrnström SUPPLEMENTARY INFORMATION VOLUME: 1 ARTICLE
More informationIMPACT OF OIL-SANDS BASED WETLANDS ON THE GROWTH OF MALLARD (ANAS PLATYRHYNCHOS) DUCKLINGS
Environmentl Toxicology nd Chemistry, Vol. 2, No. 2, pp. 7 3, 200 200 SETAC Printed in the USA 0730-728/0 $12.00.00 IMPACT OF OIL-SANDS BASED WETLANDS ON THE GROWTH OF MALLARD (ANAS PLATYRHYNCHOS) DUCKLINGS
More informationImmune Responses and Efficacy After Administration of a Commercial Brucella abortus Strain RB51 Vaccine to Cattle*
Immune Responses nd Efficcy After Administrtion of Commercil Brucell bortus Strin RB51 Vccine to Cttle* Steven C. Olsen, DVM, PhD United Sttes Deprtment of Agriculture Bcteril Diseses of Livestock Reserch
More informationAn Integrated Population Pharmacokinetic Meta-Analysis of Propofol in Morbidly Obese and Nonobese Adults, Adolescents, and Children
Originl Article Cittion: CPT: Phrmcometrics & Systems Phrmcology (13), e73; doi:1.138/psp.13.7 13 ASCPT All rights reserved 163-836/1 www.nture.com/psp An Integrted Popultion Phrmcokinetic Met-Anlysis
More informationRelationship Between Some Serum Enzyme Activities, Liver Functions and Body Weight in Growing Local Chickens
Interntionl Journl of Poultry Science 8 (7): 700-705, 2009 ISSN 1682-856 Asin Network for Scientific Informtion, 2009 Reltionship Between Some Serum Enzyme Activities, Liver Functions nd Body Weight in
More informationDr. Jerry Shurson Department of Animal Science University of Minnesota
Dr. Jerry Shurson Department of Animal Science University of Minnesota Industry adoption ~ 60% of ethanol plants are currently extracting oil > 70% will be extracting oil by the end or 2012 Oil uses >
More informationImproving Performance, Meat Quality and Muscle Fiber Microstructure of Native Indonesian Muscovy Duck Through Feed Protein and Metabolizable Energy
Interntionl Journl of Poultry Science 1 (11): 653-659, 013 ISSN 168-8356 Asin Network for Scientific Informtion, 013 Improving Performnce, Met Qulity nd Muscle Fier Microstructure of Ntive Indonesin Muscovy
More informationEffect of Rumensin on Health and Reproduction of Lactating Dairy Cows
Scientific Updte From Elnco Animl Helth Effect of Rumensin on Helth nd Reproduction of Lctting Diry Cows NADA 095-735 Dvid G. McClry, DVM, MS; Howrd B. Green, MS; Gerld D. Mechor, DVM; nd John I. D. Wilkinson,
More informationLuciana G. Brito, 1 Fábio S. Barbieri, 1 Rodrigo B. Rocha, 1 MárciaC.S.Oliveira, 2 and Elisana Sales Ribeiro Introduction
SAGE-Hindwi Access to Reserch Veterinry Medicine Interntionl Volume 2011, Article ID 806093, 6 pges doi:10.4061/2011/806093 Reserch Article Evlution of the Efficcy of Acricides Used to Control the Cttle
More informationBVD = Bovine Viral Diarrhea
George Perry, South Dkot Stte University 11/2/17 Influence of Modified Live Vccines on Reproductive Performnce in Beef Cttle George A. Perry, Russell F. Dly, nd Christopher C. Chse Deprtment of Animl Science
More informationComparative Study of Three Indigenous Chicken Breeds of South Africa: Body Weight and Linear Body Measurements
Agriculturl Journl 7 (3): 0-5, 01 ISSN: 1816-9155 Medwell Journls, 01 Comprtive Study of Three Indigenous Chicken Breeds of South Afric: Body Weight nd Liner Body Mesurements 1 1 1 O.J. Ali, J.W. Ng mi,
More informationThe following Supplemental Tables represent the data upon which Figures 3 and 4, respectively, are based.
The following Supplementl Tbles represent the dt upon which Figures 3 nd 4, respectively, re bsed. Tble S1: Existence of incidents of unconfined dogs, cts, ferrets: impct on wildlife Effects on Wildlife
More informationDifferences in peripartal plasma parameters related to calcium homeostasis of dairy sheep and goats in comparison with cows
Zurich Open Repository nd Archive University of Zurich Min Lirry Strickhofstrsse 39 CH-8057 Zurich www.zor.uzh.ch Yer: 2014 Differences in periprtl plsm prmeters relted to clcium homeostsis of diry sheep
More informationComparative Studies on the Prevalence of Ixodid Ticks on Some Selected Sedentary Farms and Trade Cattle in Adamawa State, Nigeria
Interntionl Journl of Scientific nd Reserch Publictions, Volume 7, Issue 9, September 2017 505 Comprtive Studies on the Prevlence of Ixodid Ticks on Some Selected Sedentry Frms nd Trde Cttle in Admw Stte,
More informationHereditary ataxia in the Jack Russell Terrier (JRT) is a
J Vet Intern Med 2004;1:1 21 Hereditry Atxi in the Jck Russell Terrier Clinicl nd Genetic Investigtions Annette Wessmnn, Thoms Goedde, Andre Fischer, Peter Wohlsein, Henning Hmnn, Ottmr Distl, nd Andre
More informationBand-tailed Pigeon Population Status, 2010
University of Nebrsk - Lincoln DigitlCommons@University of Nebrsk - Lincoln US Fish & Wildlife Publictions US Fish & Wildlife Service 2010 Bnd-tiled Pigeon Popultion Sttus, 2010 Todd A. Snders U.S. Fish
More informationA Model for Promoting Poultry Industry Development in Togo: Part 1. Management Practices and Incubation Conditions
Interntionl Journl of Poultry Science 13 (3): 176-184, 2014 ISSN 1682-8356 Asin Network for Scientific Informtion, 2014 A Model for Promoting Poultry Industry Development in Togo: Prt 1. Mngement Prctices
More informationResearch Article Interspecific Variation in Temperature Effects on Embryonic Metabolism and Development in Turtles
Interntionl Scholrly Reserch Network ISRN Zoology Volume 212, Article ID 846136, 13 pges doi:1.542/212/846136 Reserch Article Interspecific Vrition in Temperture Effects on Emryonic Metolism nd Development
More informationLuteolysis and pregnancy outcomes after change in dose delivery of prostaglandin F2α in a 5-day timed artificial insemination program in dairy cows
Knss Agriculturl Experiment ttion Reserch Reports Volume Issue 2 Diry Reserch (94-24) Article 9 24 Luteolysis nd pregnncy outcomes fter chnge in dose delivery of prostglndin F2α in -dy timed rtificil insemintion
More informationEfficacy of noviflumuron gel bait for control of the German cockroach, Blattella germanica (Dictyoptera: Blattellidae) laboratory studies
Pest Mngement Science Pest Mng Sci 62:434 439 (2006) Efficcy of noviflumuron gel it for control of the Germn cockroch, Blttell germnic (Dictyopter: Blttellide) lortory studies Chnglu Wng nd Gry W Bennett
More informationFEEDING CHINESE RINGNECK PHEASANTS FOR EFFICIENT REPRODUCTION. Summary *
FEEDING CHINESE RINGNECK PHEASANTS FOR EFFICIENT REPRODUCTION Robert E. Moreng, William K. Pfaff and Eldon W. Kienholz Summary * Two trials were conducted each using 240 Chinese Ringneck pheasant breeder
More informationEffect of Different Lysine and Energy Levels in Diets on Carcass Percentage of Three Strains of Broiler Duck
DOI: http://dx.doi.org/10.14334/proc.intsem.lpvt-2016-p.395-407 Effect of Different Lysine and Energy Levels in Diets on Carcass Percentage of Three s of Broiler Duck Purba M, Sinurat AP, Susanti T Indonesian
More informationCHARACTERISTICS ASSOCIATED WITH OUT CROSSING IN A SHORT DURATION IMPROVED RICE (Oryza sativa L) VARIETY AT307
CHARACTERISTICS ASSOCIATED WITH OUT CROSSING IN A SHORT DURATION IMPROVED RICE (Oryz stiv L) VARIETY AT37 Kumr APA 1, Dhnyke Nilnthi 1 *, Phthinyke BD 2 n Sennyke SGJN 1 1 Deprtment of Agriculturl Biology,
More informationEffects of mercury exposure on the reproductive success of tree swallows (Tachycineta bicolor)
Ecotoxicology (2008) 17:133 141 DOI 10.1007/s10646-007-0163-z Effects of mercury exposure on the reproductive success of tree swllows (Tchycinet bicolor) Rebeck L. Brsso Æ Dniel A. Cristol Accepted: 20
More informationMacrolides belong to the family of macrocyclic antibiotics.
1046 JUHEL-GAUGAIN ET AL.: JOURNAL OF AOAC INTERNATIONAL VOL. 82, NO. 5, 1999 DRUGS, COSMETICS, FORENSIC SCIENCES Multiresidue Chromtogrphic Method for the Determintion of Mcrolide Residues in Muscle by
More informationDo broiler chicks possess enough growth potential to compensate long-term feed and water depravation during the neonatal period?
South African Journal of Animal Science 2011, 41 (no 1) Do broiler chicks possess enough growth potential to compensate long-term feed and water depravation during the neonatal period? F. Abed 1, A. Karimi
More informationMaterials and method Animals and blood samples
Originl Reserch 1 / 12 Veterinri OA México Publicción Digitl de l Fcultd de Medicin Veterinri y Zootecni o http://www.revists.unm.mx/index.php/veterinri-mexico Effect of prostglndin F2α dministrtion during
More informationfact sheet Stage 1: Puppy breeding & raising Puppy Breeding
fct sheet Stge 1: Puppy breeding & rising It tkes two yers nd costs more thn $35,000 to trnsform plyful puppy into responsible Guide Dog. Not ll pups re suitble for guiding people who re vision impired.
More informationEffect of EM on Growth, Egg Production and Waste Characteristics of Japanese Quail Abstract Introduction Experimental Procedures
Effect of EM on Growth, Egg Production and Waste Characteristics of Japanese Quail S. Chantsavang, P. Piafupoa and O. Triwutanon Department of Animal Science, Kasetsart University, Bangkok, Thailand Abstract
More informationContinuous Subcutaneous Infusion of Morphine vs. Hydromorphone: A Controlled Trial
Vol. 18 No. 1 July 1999 Journl of Pin nd Symptom Mngement 9 Originl Article Continuous Subcutneous Infusion of Morphine vs. Hydromorphone: A Controlled Tril Mry G. Miller, MB, MRCP (Irelnd), Noel McCrthy,
More informationDevelopment of an Assay for Besylate in Amlodipine Besylate by IC and a Second Assay to Simultaneously Determine Amlodipine and Besylate by HPLC
Development of n Assy for in Amlodipine y IC nd Second Assy to Simultneously Determine Amlodipine nd y HPLC Brin De Bor nd Jeffrey Rohrer, Thermo Fisher Scientific, Sunnyvle, CA, USA Overview Purpose:
More informationKnowledge, attitude and practice of antibiotics prescribing among medical officers of public health care facilities in the state of Kedah, Malaysia
ORIGINAL ARTICLE Knowledge, ttitude nd prctice of ntibiotics prescribing mong medicl officers of public helth cre fcilities in the stte of Kedh, Mlysi Tn Wei Leong, MD*, Siti Rhmh@Noor Syhireen Mohmmed,
More informationBody weight, feed coefficient and carcass characteristics of two strain quails and their reciprocal crosses
1 Body weight, feed coefficient and carcass characteristics of two strain quails and their reciprocal crosses N.VALI 1, EDRISS, M.A. 2 and RAHMANI, H.R. 2 1 Department of Animal Sciences, faculty of Agriculture
More informationAppropriateness of antimicrobial therapy: a multicentre prevalence survey in the Netherlands,
Surveillnce nd outbrek reports Appropriteness of ntimicrobil therpy: multicentre prevlence survey in the Netherlnds, 28 29 I Willemsen 1, T vn der Kooij 2, B vn Benthem 2, J Wille 3, J Kluytmns (jnkluytmns@gmil.com)
More informationFeasibility of Miscanthus as alternative bedding for dairy cows
Veterinrni Medicin,, 1 (3): 11 13 Originl Pper doi: 1.171/9-VETMED Fesibility of Miscnthus s lterntive bedding for diry cows S. Vn Weyenberg, T. Ulens, K. De Reu, I. Zwertvegher, P. Demeyer, L. Pluym Institute
More informationFattening performance, carcass and meat quality of slow and fast growing broiler strains under intensive and extensive feeding conditions
Fattening performance, carcass and meat quality of slow and fast growing broiler strains under intensive and extensive feeding conditions M.A. GRASHORN* Dept. of Poultry Science (470c), Inst. of Animal
More informationEffects of litter quality and climate change along an elevation gradient on litter mass loss in an alpine meadow ecosystem on the Tibetan plateau
Plnt Ecol (21) 29:257 268 DOI 1.17/s11258-9-9714- Effects of litter qulity nd climte chnge long n elevtion grdient on litter mss loss in n lpine medow ecosystem on the Tietn plteu Gungping Xu Yigng Hu
More informationSources of contamination, prevalence, and antimicrobial resistance of thermophilic Campylobacter isolated from turkeys
Veterinry World, EISSN: 2231-0916 RESEARCH ARTICLE Open Access Sources of contmintion, prevlence, nd ntimicrobil resistnce of thermophilic Cmpylobcter isolted from turkeys Rdi Bouhmed 1, Leil Bouyd 1,
More informationDragon genetics, pt. II: Monohybrid crosses
Lesson 6.4 Drgon genetics, pt. II: Monohybrid crosses Nme Dte Period Key Terms Monohybrid cross Dominnt trit Recessive trit Engge BCKGROUND: long time go, in world fr, fr wy, gret rce of beings lived on
More informationEvaluation of the Hologic Gen-Probe PANTHER, APTIMA Combo 2 Assay in a Tertiary Care Teaching Hospital
AJCP / Originl Article Evlution of the Hologic Gen-Probe PANTHER, APTIMA Combo 2 Assy in Tertiry Cre Teching Hospitl Annie Cheng, MT, nd Jmes E. Kirby, MD From the Deprtment of Pthology, Beth Isrel Deconess
More informationImpact of Layer Breeder Flock Age and Strain on Mechanical and Ultrastructural Properties of Eggshell in Chicken
Interntionl Journl of Poultry Science 9 (): 139-147, 010 ISSN 168-8356 Asin Network for Scientific Informtion, 010 Impct of Lyer Breeder Flock Age nd Strin on Mechnicl nd Ultrstructurl Properties of Eggshell
More informationASPECTS OF THE BREEDING BIOLOGY OF THE GENTOO PENGUIN PYGOSCELIS PAPUA AT VOLUNTEER BEACH, FALKLAND ISLANDS, 2001/02
ASPECTS OF THE BREEDING BIOLOGY OF THE GENTOO PENGUIN PYGOSCELIS PAPUA AT VOLUNTEER BEACH, FALKLAND ISLANDS, 2001/02 HELEN M. OTLEY, 1 ANDREA P. CLAUSEN, 1 DARREN J. CHRISTIE 1 & KLEMENS PÜTZ 2 1 Flklnds
More informationEffects of Fusaric Acid in Broiler Chicks and Turkey Poults
Interntionl Journl of Poultry Science 4 (6): 356-359, 2005 ISSN 682-8356 Asin Network for Scientific Informtion, 2005 Effects of Fusric Acid in Broiler nd Turkey Poults S.O. Oguno, D.R. Ledoux, J.N. Broomhed,
More informationISSN: Isolation of High Antibiotic Resistant Fecal Bacteria Indicators, Salmonella and Vibrio Species from Raw
ISSN: 2276-7762 Isoltion of High Antibiotic Resistnt Fecl Bcteri Indictors, Slmonell nd Vibrio Species from Rw Abttoirs Sewge in Peri- Urbn Loctions of Nirobi, Keny By Nymboy Rosemry Atieno Okemo Pul Owuor
More informationVerticillium wilt in a cotton variety test at the Judd Hill Cooperative Research Station in 2017
Arknss 2017 Cotton Vriety Test Verticillium wilt in cotton vriety test t the Judd Hill Coopertive Reserch Sttion in 2017 F. Bourlnd W. Brnett C. Kennedy L. Mrtin A. Rouse nd B. Robertson ARKANSAS AGRICULTURAL
More informationThe effects of shank length on incubation results of Japanese quails (Coturnix coturnix japonica) eggs and hatched chick shank length
The effects of shank length on incubation results of Japanese quails (Coturnix coturnix japonica) eggs and hatched chick shank length B. YILMAZ DIKMEN* and A. IPEK Faculty of Agriculture, Animal Science
More informationEfficacy of Clarithromycin for Treatment of Experimental
ANTIMICROBLAL AGENTS AND CHEMOTHERAPY, June 1993, p. 1329-1333 0066-4804/93/061329-05$02.00/0 Copyright X) 1993, Americn Society for Microbiology Vol. 37, No. 6 Efficcy of for Tretment of Experimentl Lyme
More informationFungi participate in driving home-field advantage of litter decomposition in a subtropical forest
https://doi.org/1.17/s1114-18-3865-5 REGULAR ARTICLE Fungi prticipte in driving home-field dvntge of litter decomposition in subtropicl forest Dunmei Lin & Mei Png & Nicols Fnin & Hongjun Wng & Shenhu
More informationThe Anatomy of Sea Turtles
Close this window to return to the previous pge or go to www.ivis.org The Antomy of Se Turtles Jenette Wyneken, Ph.D. Illustrted y Dwn Witherington Close this window to return to the previous pge or go
More informationNutritional Evaluation of Yam Peel Meal for Pullet Chickens: 2. Effect of Feeding Varying Levels on Sexual Maturity and Laying Performance
IJAAAR 7 (1&2): 46-53, 2011 International Journal of Applied Agricultural and Apicultural Research Faculty of Agricultural Sciences, Lautech, Ogbomoso, Ibadan Nigeria, 2011 46 Nutritional Evaluation of
More informationInternational Journal of Science, Environment and Technology, Vol. 7, No 2, 2018,
International Journal of Science, Environment and Technology, Vol. 7, No 2, 2018, 577 583 ISSN 2278-3687 (O) 2277-663X (P) SLAUGHTER AND CARCASS CHARACTERISTICS OF BELTSVILLE SMALL WHITE AND BROAD BREASTED
More informationGrowth Rate, Carcass Weight and Percentage Weight of Carcass Parts of Laying Type Cockerels, Kampong Chicken and Arabic Chicken in Different Ages
Pkistn Journl of Nutrition 14 (7): 377-382, 2015 ISSN 1680-5194 Asin Network for Scientific Informtion, 2015 Growth Rte, Crcss Weight nd Percentge Weight of Crcss Prts of Lying Type Cockerels, Kmpong Chicken
More informationOriginal Article. E Oz 1, *H Cetin 1, J E Cilek 2, O Deveci 3, A Yanikoglu 1
Irnin J Pul Helth, Vol. 39, No.3, 2010, Irnin pp. 102-108 J Pul Helth, Vol. 39, No.3, 2010, pp. 102-108 Originl Article Effects of Two Temperture Storge Regimes on the Efficcy of 3 Commercil Gel Bits ginst
More informationEFFECTS OF SODIUM AND MAGNESIUM SULFATE IN DRINKING WATER ON MALLARD DUCKLINGS
EFFETS OF SODIUM AND MAGNESIUM SULFATE IN DRINKING WATER ON MALLARD DUKLINGS Authors: S. A. Mitchm, nd G. Wobeser Source: Journl of Wildlife Diseses, 24(1) : 3044 Published By: Wildlife Disese Assocition
More informationDistribution and dissemination of antimicrobial-resistant Salmonella in broiler farms with or without enrofloxacin use
Shng et l. BMC Veterinry Reserch (2018) 14:257 https://doi.org/10.1186/s12917-018-1590-1 RESEARCH ARTICLE Open Access Distribution nd dissemintion of ntimicrobil-resistnt Slmonell in broiler frms with
More informationOriginal Article. Introduction
Irnin Journl of Phrmceuticl Reserch (2018), 17 (4): 1182-1190 Received: Mrch 2016 Accepted: Decemer 2016 Originl Article Determintion of Enrofloxcin nd Ciprofloxcin Residues in Five Different Kinds of
More informationSELECTED LIFE HISTORY ASPECTS AND HABITAT USE BY MERRIAM'S WILD TURKEYS IN OREGON
SELECTED LIFE HISTORY ASPECTS AND HABITAT USE BY MERRIAM'S WILD TURKEYS IN OREGON by Robert Scott Lutz A THESIS submitted to Oregon Stte University in prtil fulfillment of the requirements for the degree
More informationEDUCATION AND PRODUCTION
EDUCATION AND PRODUCTION Effects of Body Weight and Feed Allocation During Sexual Maturation in Broiler Breeder Hens. 1. Growth and Carcass Characteristics R. A. RENEMA,* F. E. ROBINSON,*,1 M. NEWCOMBE,
More informationMERCURY EXPOSURE AFFECTS THE REPRODUCTIVE SUCCESS OF A FREE-LIVING TERRESTRIAL SONGBIRD, THE CAROLINA WREN (THRYOTHORUS LUDOVICIANUS)
The Auk 128(4):759 769, 2011 The Americn Ornithologists Union, 2011. Printed in USA. MERCURY EXPOSURE AFFECTS THE REPRODUCTIVE SUCCESS OF A FREE-LIVING TERRESTRIAL SONGBIRD, THE CAROLINA WREN (THRYOTHORUS
More informationComparisons of antifeedancy and spatial repellency of three natural product repellents agains horn flies
United Sttes Deprtment of Agriculture From the SelectedWorks of Dvid B Tylor 14 Comprisons of ntifeedncy nd sptil repellency of three nturl product repellents gins horn flies Junwei J. Zhu, USDA-ARS Agroecosystem
More informationImproving Growth and Yield of Commercial Pheasants Through Diet Alteration and Feeding Program
Improving Growth and Yield of Commercial Pheasants Through Diet Alteration and Feeding Program Sandra G. Velleman 1 and Nicholas B. Anthony 2 1 Department of Animal Sciences, The Ohio State University
More informationA Study on Morbidity Management among Lymphatic Filariasis Patients in Udupi district, Karnataka, India
Int J Med. Public Helth. 2017; 7(2):91-95 A Multifceted Peer Reviewed Journl in the field of Medicine nd Public Helth www.ijmedph.org www.journlonweb.com/ijmedph Originl Article A Study on Morbidity Mngement
More informationImmunostimulation Assays in Bovine Brucellosis
INFECTION AND IMMUNITY, Nov. 1978, p. 486-491 0019-9567/78/0022-0486$02.00/0 Copyright i 1978 Americn Society for Microbiology Vol. 22, No. 2 Printed in U.S.A. Brucell Antigen Preprtions for In Vitro Lymphocyte
More informationKNOWLEDGE, ATTITUDES AND PRACTICES ABOUT ANTIBIOTIC USE AMONG THE GENERAL PUBLIC IN MALAYSIA
KNOWLEDGE, ATTITUDES AND PRACTICES ABOUT ANTIBIOTIC USE AMONG THE GENERAL PUBLIC IN MALAYSIA Frid Islhudin, Aly Mdihh Ahmd Tmezi nd Norid Mohmed Shh Fculty of Phrmcy, Universiti Kebngsn Mlysi, Kul Lumpur,
More informationFactors associated with West Nile virus disease fatalities in horses. (Traduit par Docteur André Blouin) Can Vet J 2007;48:
Article Fctors ssocited with West Nile virus disese ftlities in horses Tsh Epp, Cheryl Wldner, Keith West, Hugh Townsend Astrct In 2003, the occurrence nd loction of horses with clinicl signs of West Nile
More informationEDUCATION AND PRODUCTION. Layer Performance of Four Strains of Leghorn Pullets Subjected to Various Rearing Programs
EDUCATION AND PRODUCTION Layer Performance of Four Strains of Leghorn Pullets Subjected to Various Rearing Programs S. LEESON, L. CASTON, and J. D. SUMMERS Department of Animal and Poultry Science, University
More informationA retrospective study of the causes of morbidity and mortality in farmed elk (Cervus elaphus) Murray R. Woodbury, John Berezowski, Jerry Haigh
A retrospective study of the cuses of morbidity nd mortlity in frmed elk (Cervus elphus) Murry R. Woodbury, John Berezowski, Jerry High Abstrct A survey of North Americn frmed elk (Cervus elphus) producers
More informationThe effects of i.v. fentanyl administration on the minimum alveolar concentration of isoflurane in horses
British Journl of Anesthesi 97 (2): 232 7 (2006) doi:10.1093/bj/el116 Advnce Access publiction My 23, 2006 The effects of i.v. fentnyl dministrtion on the minimum lveolr concentrtion of isoflurne in horses
More informationEffects of Management of Domestic Dogs and Recreation on Carnivores in Protected Areas in Northern California
Contriuted Pper Effects of Mngement of Domestic Dogs nd Recretion on Crnivores in Protected Ares in Northern Cliforni SARAH E. REED AND ADINA M. MERENLENDER Deprtment of Environmentl Science, Policy &
More information3 MENSURATION TASK cm. 8 cm 12 cm. x cm. 30 m. 20 m. 24 m. 40 m
1 3 MENSURTIN TSK 3.1 Give nswers to one deciml plce if necessry. Find the re of ech shpe elow. ll lengths re in cm. 1. 12 2. 4 10 3. 8 10 8 14 9 4. The re of the prllelogrm is equl to the re of the trpezium.
More informationEvaluation of New Biological Product Saltose for Controlling Coccidia and Clostridia in Broiler Chickens
Glol Veterinri 1 (): 57-, 01 ISSN 199-197 IDOSI Pulictions, 01 DOI: 10.589/idosi.gv.01.1.0.81 Evlution of New Biologicl Product Sltose for Controlling Coccidi nd Clostridi in Broiler Chickens 1 K.G. El
More informationMycobacterium paratuberculosis Cultured from Milk and
JOURNAL OF CLINICAL MICROBIOLOGY, Jn. 1992, p. 6-171 95-1137/92/16-6$2./ Copyright C 1992, Americn Society for Microbiology Vol. 3, No. 1 Mycobcterium prtuberculosis Cultured from Milk nd Suprmmmry Lymph
More informationA.S. Fairchild, J.L. Grimes, J.K. Porter, W.J. Croom, Jr., L.R. Daniel and W.M. Hagler, Jr. 1
Interntionl Journl of Poultry Science 4 (6): 350-355, 005 ISSN 68-8356 sin Network for Scientific Informtion, 005 Effects of Dicetoxyscirpenol nd Fusric cid on Poults: Individul nd Comined Effects of Dietry
More informationThe effects of preen oils and soiling on the UV visible reflectance of carotenoid-pigmented feathers
ehv Ecol Sociobiol DOI 1.17/s265-11-1153-y ORIGINL PPER The effects of preen oils nd soiling on the UV visible reflectnce of crotenoid-pigmented fethers Lorenzo Pérez-Rodríguez & Frncois Mougeot & Gry
More informationMeasurement 1: Surface Area and Volume
Mesurement 1: Surfce Are nd Volume Student Book - Series M-1 Mthletics Instnt Workooks Copyright Mesurement 1: Surfce re nd volume Student Book - Series M Contents Topics Topic 1 - The re of prts of circle
More information