Colonisation, diversificationand extinctionof birds in Macaronesia
|
|
- Harold Stone
- 5 years ago
- Views:
Transcription
1 Colonisation, diversificationand extinctionof birds in Macaronesia Juan Carlos Illera Research Unit of Biodiversity (UO-PA-CSIC) /
2 MACARONESIA Azores (0-8 My) Madeira (0-14 My) Selvagens (24 My) Canary Islands (1-22 My) Cape Verde (6-25 My) 668 km
3
4 Colonisation: When? From where????
5 Colonisation and diversification 1) Mitochondrial DNA (maternal inheritance) 1. Phylogeny (among species) 2. Phylogeography (within species) 2) Nuclear DNA (maternal and paternal) 1. Population genetics (genetic structure, gene flow) 2. Phylogeography (origin, dispersal) Flanking region Short tandem repeats (CAC) Flanking region AGTCCTGGCCTGAACACCACCACCACCACCACCACCACCACCCTTAACTGGTAA TCAGGACCGGACTTGTGGTGGTGGTGGTGGTGGTGGTGGTGGGAATTGACCATT
6 3) Next-generation sequencing Colonisation and diversification
7 Origin and diversification of island biota a) A small group of individuals arrive B C A D
8 Colonisation: How? When? From where? F. c. moreletii? Fringilla coelebs F. c. maderensis F. c. palmae F. c. ombriosa F. c. canariensis Marshall & Baker, Mol.Phy.Evol.
9 Fringilla coelebs Rando et al PloS ONE.
10 Character displacement among finches Carduelis aurelioi Rando et al PloS ONE
11 Character displacement among finches Carduelis aurelioi A beak size comparison among the blue chaffinch (F. teydea), the common chaffinch (F. coelebs) and the extinct slender-billed greenfinch (C. aurelioi) Rando et al PloS ONE
12 Colonisation: How? When? From where? Madeira Anthus berthelotii Selvagens? Canary Islands a) mtadnmt: one haplotipe CR & four with cyt-b b) Microsatellites and MHC: Significant genetic structure among archipelagos Illera et al., Mol. Ecol. Spurgin et al., 2011; Mol. Ecol.
13 Colonisation: How? When? From where? Madeira Anthus berthelotii Selvagens? Canary Islands c) Founder effects are responsible for both genetic and phenotypic changes across archipelagos Spurgin et al., Mol. Ecol.
14 Origin and diversification of island biota b) Multiple invasion waves A B A D A F
15 Colonisation: How? When? From where? 0.7 My (R. r. azoricus/inermis) Regulus regulus (R. Madeirensis) 1.8 My (R. r. Ellenthalerae) 2 My (R. r. Teneriffae) Regulus regulus teneriffae Päckert et al., J.Avian Biology
16 Origin and diversification of island biota c) Diversification due to vicariance Brown et al., Mol. Ecol. A A A Milá et al., BMC Evol. Biol. B C B C
17 Origin and diversification of island biota d) Diversification in sympatry A B A
18 Diversification by allochrony Breeding areas of Oceanodroma castro/monteiroi (circles) 1) Allochronic populations genetically structured 2) Allochrony in four archipelagos Friesen V. L. et.al. (2007). PNAS
19 Complex colonisation: How? When? From where? Distibution genus Cyanistes C. caeruleus C. cyanus C. teneriffae Illera et al.,
20 Complex colonisation: How? When? From where? Stervander et al., Mol.Ecol.
21 Complex colonisation: How? When? From where? 1st wave ( my) Spit of cyanus-caeruleus ( my) 2nd wave ( my) 3rd wave (0.27 my) Stervander et al., Mol.Ecol.
22 Colonisation: When? a) Recent colonisation ( My) b) Recent lineages in relation to reptils c) Significant diference in relation to similar archipelagos Mammals Birds My Skinks Geckos My Lizards
23 Conclusions 1) Recent colonisation of extant lineages 2) Complex evolutionary histories 3) Lower diversification than other archipelagos
24 Extinction of birds in Macaronesia Conclusions Ok, but is that all?
25 Extinction of birds in Macaronesia Emberiza alcoveri Ratites Coturnix gomerae Carduelis aurelioi
26 Extinction of birds in Macaronesia Extinction dates of macaronesian birds estimated with radiocarbon and historical records plotted in relation with human occupation of the archipelagos Illera et al., Quaternary Science Reviews
27 Extinction of birds in Macaronesia Puffinus olsoni 0,6-0,4 m.a. Puffinus puffinus Ramírez et al., PLoS ONE
28 Extinction of birds in Macaronesia
29 Acknowledgements Postdoctoral research associated positions JuandelaCiervaandRamónyCajalfellowships Mercibeaucoup!!
Biodiversity and Distributions. Lecture 2: Biodiversity. The process of natural selection
Lecture 2: Biodiversity What is biological diversity? Natural selection Adaptive radiations and convergent evolution Biogeography Biodiversity and Distributions Types of biological diversity: Genetic diversity
More informationLecture 11 Wednesday, September 19, 2012
Lecture 11 Wednesday, September 19, 2012 Phylogenetic tree (phylogeny) Darwin and classification: In the Origin, Darwin said that descent from a common ancestral species could explain why the Linnaean
More information6. The lifetime Darwinian fitness of one organism is greater than that of another organism if: A. it lives longer than the other B. it is able to outc
1. The money in the kingdom of Florin consists of bills with the value written on the front, and pictures of members of the royal family on the back. To test the hypothesis that all of the Florinese $5
More informationFringilla coelebs all others
Period 2008-2012 European Environment Agency European Topic Centre on Biological Diversity Annex I International action plan No No Eurasian Chaffinch, Fringilla coelebs, is a species of passerine bird
More informationThe Galapagos Islands: Crucible of Evolution.
The Galapagos Islands: Crucible of Evolution. I. The Archipelago. 1. Remote - About 600 miles west of SA. 2. Small (13 main; 6 smaller); arid. 3. Of recent volcanic origin (5-10 Mya): every height crowned
More informationName: Per. Date: 1. How many different species of living things exist today?
Name: Per. Date: Life Has a History We will be using this website for the activity: http://www.ucmp.berkeley.edu/education/explorations/tours/intro/index.html Procedure: A. Open the above website and click
More informationModern Evolutionary Classification. Lesson Overview. Lesson Overview Modern Evolutionary Classification
Lesson Overview 18.2 Modern Evolutionary Classification THINK ABOUT IT Darwin s ideas about a tree of life suggested a new way to classify organisms not just based on similarities and differences, but
More informationTemporal changes in mitochondrial diversity highlights contrasting population events in Macaronesian honey bees
Temporal changes in mitochondrial diversity highlights contrasting population events in Macaronesian honey bees Irene Muñoz, Maria Pinto, Pilar De La Rúa To cite this version: Irene Muñoz, Maria Pinto,
More informationDarwin s Finches: A Thirty Year Study.
Darwin s Finches: A Thirty Year Study. I. Mit-DNA Based Phylogeny (Figure 1). 1. All Darwin s finches descended from South American grassquit (small finch) ancestor circa 3 Mya. 2. Galapagos colonized
More informationA review on the impacts of feral cats (Felis silvestris catus) in the Canary Islands: implications for the conservation of its endangered fauna
Biodivers Conserv (2009) 18:829 846 DOI 10.1007/s10531-008-9503-4 REVIEW PAPER A review on the impacts of feral cats (Felis silvestris catus) in the Canary Islands: implications for the conservation of
More informationTemporal mitochondrial DNA variation in honeybee populations from Tenerife (Canary Islands, Spain)
Temporal mitochondrial DNA variation in honeybee populations from Tenerife (Canary Islands, Spain) Mª Jesús Madrid-Jiménez, Irene Muñoz, Pilar De la Rúa Dpto. de Zoología y Antropología Física, Facultad
More informationPhylogeographic assessment of Acanthodactylus boskianus (Reptilia: Lacertidae) based on phylogenetic analysis of mitochondrial DNA.
Zoology Department Phylogeographic assessment of Acanthodactylus boskianus (Reptilia: Lacertidae) based on phylogenetic analysis of mitochondrial DNA By HAGAR IBRAHIM HOSNI BAYOUMI A thesis submitted in
More informationEvolution as Fact. The figure below shows transitional fossils in the whale lineage.
Evolution as Fact Evolution is a fact. Organisms descend from others with modification. Phylogeny, the lineage of ancestors and descendants, is the scientific term to Darwin's phrase "descent with modification."
More informationVIERAEA Vol Santa Cruz de Tenerife, noviembre 2006 ISSN X
VIERAEA Vol. 34 65-70 Santa Cruz de Tenerife, noviembre 2006 ISSN 0210-945X On the scientific name of the extant Giant Lizard of La Gomera (Canary Islands): Gallotia gomerana Hutterer, 1985 vs. G. bravoana
More informationProf. Neil. J.L. Heideman
Prof. Neil. J.L. Heideman Position Office Mailing address E-mail : Vice-dean (Professor of Zoology) : No. 10, Biology Building : P.O. Box 339 (Internal Box 44), Bloemfontein 9300, South Africa : heidemannj.sci@mail.uovs.ac.za
More informationMuseu de História Natural do Funchal. Madeira 31.XII.2012 No. 235
1 ISSN 0523-7904 B O C A G I A N A Museu de História Natural do Funchal Madeira 31.XII.2012 No. 235 FIRST DATA ON BREEDING OF MANDARIN DUCK AIX GALERICULATA IN THE MADEIRAN ARCHIPELAGO BY DOMINGO TRUJILLO
More informationPhylogeography of the Madeiran endemic lizard Lacerta dugesii inferred from mtdna sequences
Molecular Phylogenetics and Evolution 26 (2003) 222 230 MOLECULAR PHYLOGENETICS AND EVOLUTION www.elsevier.com/locate/ympev Phylogeography of the Madeiran endemic lizard Lacerta dugesii inferred from mtdna
More informationHistory of Lineages. Chapter 11. Jamie Oaks 1. April 11, Kincaid Hall 524. c 2007 Boris Kulikov boris-kulikov.blogspot.
History of Lineages Chapter 11 Jamie Oaks 1 1 Kincaid Hall 524 joaks1@gmail.com April 11, 2014 c 2007 Boris Kulikov boris-kulikov.blogspot.com History of Lineages J. Oaks, University of Washington 1/46
More informationWild: Amazing animals in a changing world
Wild: Amazing animals in a changing world Worldwide biodiversity Begin this trail looking over the balcony from Darwin to DNA into Wild. While looking from the balcony, consider the following: Are there
More informationBiology of the Galapagos
Biology of the Galapagos Wikelski reading, Web links 26 March 2009, Thurs ECOL 182R UofA K. E. Bonine Alan Alda Video? 1 Student Chapter of the Tucson Herpetological Society COME JOIN!!!!! 2 General Information
More information2015 Artikel. article Online veröffentlicht / published online: Deichsel, G., U. Schulte and J. Beninde
Deichsel, G., U. Schulte and J. Beninde 2015 Artikel article 7 - Online veröffentlicht / published online: 2015-09-21 Autoren / Authors: Guntram Deichsel, Biberach an der Riß, Germany. E-Mail: guntram.deichsel@gmx.de
More informationAre reptile and amphibian species younger in the Northern Hemisphere than in the Southern Hemisphere?
doi: 1.1111/j.142-911.211.2417.x SHORT COMMUNICATION Are reptile and amphibian species younger in the Northern Hemisphere than in the Southern Hemisphere? S. DUBEY & R. SHINE School of Biological Sciences,
More informationQuiz Flip side of tree creation: EXTINCTION. Knock-on effects (Crooks & Soule, '99)
Flip side of tree creation: EXTINCTION Quiz 2 1141 1. The Jukes-Cantor model is below. What does the term µt represent? 2. How many ways can you root an unrooted tree with 5 edges? Include a drawing. 3.
More informationBird Species Fact Sheets
MODULE 1: LEARNING ABOUT BIRDS Bird Species Fact Sheets The following fact sheets cover 4 different birds, Blue tit, Chaffinch, Sand martin and House martin. These 4 species are featured because they can
More informationComparing DNA Sequence to Understand
Comparing DNA Sequence to Understand Evolutionary Relationships with BLAST Name: Big Idea 1: Evolution Pre-Reading In order to understand the purposes and learning objectives of this investigation, you
More informationCentre of Macaronesian Studies, University of Madeira, Penteada, 9000 Funchal, Portugal b
Molecular Phylogenetics and Evolution 34 (2005) 480 485 www.elsevier.com/locate/ympev Phylogenetic relationships of Hemidactylus geckos from the Gulf of Guinea islands: patterns of natural colonizations
More informationBi156 Lecture 1/13/12. Dog Genetics
Bi156 Lecture 1/13/12 Dog Genetics The radiation of the family Canidae occurred about 100 million years ago. Dogs are most closely related to wolves, from which they diverged through domestication about
More informationCLADISTICS Student Packet SUMMARY Phylogeny Phylogenetic trees/cladograms
CLADISTICS Student Packet SUMMARY PHYLOGENETIC TREES AND CLADOGRAMS ARE MODELS OF EVOLUTIONARY HISTORY THAT CAN BE TESTED Phylogeny is the history of descent of organisms from their common ancestor. Phylogenetic
More informationHow can one species become two?
Speciation How can one species become two? Species: a group of organisms that can interbreed and produce viable offspring Speciation: the process of forming new species Reproductive Isolation Reproductive
More informationHybridization among Three Native North American Canis Species in a Region of Natural Sympatry
University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Other Publications in Wildlife Management Wildlife Damage Management, Internet Center for 10-2008 Hybridization among Three
More informationThe application of genetic research to the conservation of fruit bats in the western Indian Ocean
O BRIAN, J., T.J. HAYDEN 2004. The application of genetic research to the conservation of fruit bats... Phelsuma 12: 141 146 The application of genetic research to the conservation of fruit bats in the
More informationChapter 22 Darwin and Evolution by Natural Selection
Anaerobic Bacteria Photosynthetic Bacteria Dinosaurs Green Algae Multicellular Animals Flowering Molluscs Arthropods Chordates Jawless Fish Teleost Fish Amphibians Insects Reptiles Mammals Birds Land Plants
More informationIntroduction Histories and Population Genetics of the Nile Monitor (Varanus niloticus) and Argentine Black-and-White Tegu (Salvator merianae) in
Introduction Histories and Population Genetics of the Nile Monitor (Varanus niloticus) and Argentine Black-and-White Tegu (Salvator merianae) in Florida JARED WOOD, STEPHANIE DOWELL, TODD CAMPBELL, ROBERT
More information2016 CHARLES DARWIN ORATION. Evolution in action - Charles Darwin and the Galápagos Finches
2016 CHARLES DARWIN ORATION Evolution in action - Charles Darwin and the Galápagos Finches Emeritus Professor Peter Grant Charles Darwin s life and legacy are well known. You get the impression that not
More informationBIRD RADIATIONS JEFFREY PODOS AND DAVID C. LAHTI THE FUTURE BIRD RADIATIONS ON ISLANDS: ECOLOGICAL AND EVOLUTIONARY INSIGHTS
by endemic mosquitoes in a human-modified landscape with relatively few native birds. Its original host remains unknown, but unlike many islands, New Zealand had endemic mosquitoes, which could have coevolved
More informationWhat is the evidence for evolution?
What is the evidence for evolution? 1. Geographic Distribution 2. Fossil Evidence & Transitional Species 3. Comparative Anatomy 1. Homologous Structures 2. Analogous Structures 3. Vestigial Structures
More information2015 Artikel. article Online veröffentlicht / published online: Ron Peek
2015 Artikel article 1 - Online veröffentlicht / published online: 2015-01-20 Autor / Author:, The Netherlands. E-Mail: ron.peek@hotmail.com Zitat / Citation: Peek, R. (2015): Sound as part of courtship
More informationEvolution of Birds. Summary:
Oregon State Standards OR Science 7.1, 7.2, 7.3, 7.3S.1, 7.3S.2 8.1, 8.2, 8.2L.1, 8.3, 8.3S.1, 8.3S.2 H.1, H.2, H.2L.4, H.2L.5, H.3, H.3S.1, H.3S.2, H.3S.3 Summary: Students create phylogenetic trees to
More informationBiometrics, ageing, sexing and moult of the Blue Chaffinch Fringilla teydea teydea on Tenerife (Canary Islands)
Ringing & Migration (2005) 22, 177-184 Biometrics, ageing, sexing and moult of the Blue Chaffinch Fringilla teydea teydea on Tenerife (Canary Islands) EDUARDO GARCIA-DEL-REY 1 * and ANDREW G. GOSLER 2
More informationIbridazione naturale e antropogenica
Ibridazione naturale e antropogenica Ettore Randi Laboratorio di Genetica ISPRA, sede di Ozzano Emilia (BO) ettore.randi@isprambiente.it Foto Davide Palumbo Foto Giancarlo Tedaldi Images dowloaded for
More informationINQUIRY & INVESTIGATION
INQUIRY & INVESTIGTION Phylogenies & Tree-Thinking D VID. UM SUSN OFFNER character a trait or feature that varies among a set of taxa (e.g., hair color) character-state a variant of a character that occurs
More informationPhylogeography and diversification history of the day-gecko genus Phelsuma in the Seychelles islands. Rocha et al.
Phylogeography and diversification history of the day-gecko genus Phelsuma in the Seychelles islands Rocha et al. Rocha et al. BMC Evolutionary Biology 2013, 13:3 Rocha et al. BMC Evolutionary Biology
More informationComparing DNA Sequences Cladogram Practice
Name Period Assignment # See lecture questions 75, 122-123, 127, 137 Comparing DNA Sequences Cladogram Practice BACKGROUND Between 1990 2003, scientists working on an international research project known
More informationLIZARD RADIATIONS. On major land-bridge islands with favorable climates (i.e., in the tropical, dry, and temperate zones) both liz- MIGUEL VENCES
FURTHER READING Agardy, D. T. 2001. Scientific research opportunities at Palmyra atoll. A report submitted to The Nature Conservancy. Cobb, K. M., C. D. Charles, H. Cheng, and R. L. Edwards. 2003. El Niño
More informationInterpreting Evolutionary Trees Honors Integrated Science 4 Name Per.
Interpreting Evolutionary Trees Honors Integrated Science 4 Name Per. Introduction Imagine a single diagram representing the evolutionary relationships between everything that has ever lived. If life evolved
More informationNAME: DATE: SECTION:
NAME: DATE: SECTION: MCAS PREP PACKET EVOLUTION AND BIODIVERSITY 1. Which of the following observations best supports the conclusion that dolphins and sharks do not have a recent common ancestor? A. Dolphins
More informationSpecies: Panthera pardus Genus: Panthera Family: Felidae Order: Carnivora Class: Mammalia Phylum: Chordata
CHAPTER 6: PHYLOGENY AND THE TREE OF LIFE AP Biology 3 PHYLOGENY AND SYSTEMATICS Phylogeny - evolutionary history of a species or group of related species Systematics - analytical approach to understanding
More informationTenerife, 38206, Canary Islands, Spain b Department of Zoology, Edward Grey Institute of Field Ornithology, South Parks Rd,
This article was downloaded by: [the Bodleian Libraries of the University of Oxford] On: 02 August 2013, At: 08:28 Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number:
More informationMolecular evidence for hybridisation between the two living species of South American ratites: potential. conservation implications
Molecular evidence for hybridisation between the two living species of South American ratites: potential conservation implications Frédéric Delsuc, Mariella Superina, Guillermo Ferraris, Marie-Ka Tilak,
More informationLab 7. Evolution Lab. Name: General Introduction:
Lab 7 Name: Evolution Lab OBJECTIVES: Help you develop an understanding of important factors that affect evolution of a species. Demonstrate important biological and environmental selection factors that
More informationUNIT III A. Descent with Modification(Ch19) B. Phylogeny (Ch20) C. Evolution of Populations (Ch21) D. Origin of Species or Speciation (Ch22)
UNIT III A. Descent with Modification(Ch9) B. Phylogeny (Ch2) C. Evolution of Populations (Ch2) D. Origin of Species or Speciation (Ch22) Classification in broad term simply means putting things in classes
More informationIntroduction to phylogenetic trees and tree-thinking Copyright 2005, D. A. Baum (Free use for non-commercial educational pruposes)
Introduction to phylogenetic trees and tree-thinking Copyright 2005, D. A. Baum (Free use for non-commercial educational pruposes) Phylogenetics is the study of the relationships of organisms to each other.
More informationBiol 160: Lab 7. Modeling Evolution
Name: Modeling Evolution OBJECTIVES Help you develop an understanding of important factors that affect evolution of a species. Demonstrate important biological and environmental selection factors that
More information17.2 Classification Based on Evolutionary Relationships Organization of all that speciation!
Organization of all that speciation! Patterns of evolution.. Taxonomy gets an over haul! Using more than morphology! 3 domains, 6 kingdoms KEY CONCEPT Modern classification is based on evolutionary relationships.
More informationGeo 302D: Age of Dinosaurs LAB 4: Systematics Part 1
Geo 302D: Age of Dinosaurs LAB 4: Systematics Part 1 Systematics is the comparative study of biological diversity with the intent of determining the relationships between organisms. Humankind has always
More informationLizard Surveying and Monitoring in Biodiversity Sanctuaries
Lizard Surveying and Monitoring in Biodiversity Sanctuaries Trent Bell (EcoGecko Consultants) Alison Pickett (DOC North Island Skink Recovery Group) First things first I am profoundly deaf I have a Deaf
More informationThe Brazilian Barcode of Life (BrBOL) initiative and its potential to aid in biodiversity conservation
DNA Barcodes 2015 Guelph, Canada, August 21st, 2015 The Brazilian Barcode of Life (BrBOL) initiative and its potential to aid in biodiversity conservation Eduardo Eizirik Faculdade de Biociências, PUCRS,
More informationLevel 2 Biology, 2017
91157 911570 2SUPERVISOR S Level 2 Biology, 2017 91157 Demonstrate understanding of genetic variation and change 2.00 p.m. Wednesday 22 November 2017 Credits: Four Achievement Achievement with Merit Achievement
More informationGenes What are they good for? STUDENT HANDOUT. Module 4
Genes What are they good for? Module 4 Genetics for Kids: Module 4 Genes What are they good for? Part I: Introduction Genes are sequences of DNA that contain instructions that determine the physical traits
More informationAnimal Traits and Behaviors that Enhance Survival. Copyright 2010:PEER.tamu.edu
Animal Traits and Behaviors that Enhance Survival Copyright 2010:PEER.tamu.edu What We Are Going To Learn: What are traits? Inherited vs. Learned Response to stimuli Evolutionary Adaptations Natural Selection
More information426 Common Chaffinch. Put your logo here. COMMON CHAFFINCH (Fringilla coelebs) IDENTIFICATION
Summer. Adult. Male (01-VI). COMMON CHAFFINCH (Fringilla coelebs) IDENTIFICATION 14-16 cm. Male with head and neck grey; breast and cheeks pinkish, duller in winter. Female and juveniles brownish. Both
More informationTesting Phylogenetic Hypotheses with Molecular Data 1
Testing Phylogenetic Hypotheses with Molecular Data 1 How does an evolutionary biologist quantify the timing and pathways for diversification (speciation)? If we observe diversification today, the processes
More informationAnimal Diversity wrap-up Lecture 9 Winter 2014
Animal Diversity wrap-up Lecture 9 Winter 2014 1 Animal phylogeny based on morphology & development Fig. 32.10 2 Animal phylogeny based on molecular data Fig. 32.11 New Clades 3 Lophotrochozoa Lophophore:
More informationTurtles (Testudines) Abstract
Turtles (Testudines) H. Bradley Shaffer Department of Evolution and Ecology, University of California, Davis, CA 95616, USA (hbshaffer@ucdavis.edu) Abstract Living turtles and tortoises consist of two
More informationMotuora island reptile monitoring report for common & Pacific gecko 2016
Motuora island reptile monitoring report for common & Pacific gecko 6 Prepared by Su Sinclair August 7 Work on this monitoring project was carried out under a Wildlife Act Authority issued by the Department
More informationGlobal comparisons of beta diversity among mammals, birds, reptiles, and amphibians across spatial scales and taxonomic ranks
Journal of Systematics and Evolution 47 (5): 509 514 (2009) doi: 10.1111/j.1759-6831.2009.00043.x Global comparisons of beta diversity among mammals, birds, reptiles, and amphibians across spatial scales
More informationLABORATORY #10 -- BIOL 111 Taxonomy, Phylogeny & Diversity
LABORATORY #10 -- BIOL 111 Taxonomy, Phylogeny & Diversity Scientific Names ( Taxonomy ) Most organisms have familiar names, such as the red maple or the brown-headed cowbird. However, these familiar names
More informationDifferential human impact on the survival of genetically distinct avian lineages
Bird Conservation International (1999) 9:147-154. BirdLife International 1999 Differential human impact on the survival of genetically distinct avian lineages AUSTIN L. HUGHES Summary At the present time
More informationDo the traits of organisms provide evidence for evolution?
PhyloStrat Tutorial Do the traits of organisms provide evidence for evolution? Consider two hypotheses about where Earth s organisms came from. The first hypothesis is from John Ray, an influential British
More information18th century - first to propose that could change over time and that changes could - proposed that relatively had formed many through.
Early Ideas About Evolution 1795 proposed Same occurring in the also occurred in the. - Hutton explained the of landforms as the result of. Contrasts 18th century - first to propose that could change over
More informationActivity 1: Changes in beak size populations in low precipitation
Darwin s Finches Lab Work individually or in groups of -3 at a computer Introduction The finches on Darwin and Wallace Islands feed on seeds produced by plants growing on these islands. There are three
More informationField Guide: Student Worksheet
Field Guide: Student Worksheet Bob Winters Classification (Level 7) 1 1. What is classification? 2. Scientists have divided living things into six kingdoms. The plant and animal kingdom are two of these.
More informationTitle: Phylogenetic Methods and Vertebrate Phylogeny
Title: Phylogenetic Methods and Vertebrate Phylogeny Central Question: How can evolutionary relationships be determined objectively? Sub-questions: 1. What affect does the selection of the outgroup have
More informationEvolution by Natural Selection
Evolution by Natural Selection 2006-2007 DOCTRINE But the Fossil record OBSERVATION Quaternary 1.5 Tertiary 63 Cretaceous 135 Jurassic 180 Triassic 225 Permian 280 Carboniferous 350 Devonian 400 Silurian
More information2013 Holiday Lectures on Science Medicine in the Genomic Era
INTRODUCTION Figure 1. Tasha. Scientists sequenced the first canine genome using DNA from a boxer named Tasha. Meet Tasha, a boxer dog (Figure 1). In 2005, scientists obtained the first complete dog genome
More informationSeeds. Rough pastures. Insects. Worms. Farmland. Larvae. Sand-dunes. Insects. Farmland. Worms. Moorland Sand-dunes. Seeds. Berries. Insects.
Common Name Skylark Meadow pipit Rook Scientific Name Alauda arvensis Anthus pratensis Corvus frugilegus Irish Name Resident/ Migrant Habitat Food Distinctive features Fuiseog Resident Moorland Long streaked
More informationNew methods to identify conserved microsatellite loci and develop primer sets of high cross-species utility as demonstrated for birds
Molecular Ecology Resources (2010) 10, 475 494 doi: 10.1111/j.1755-0998.2009.02775.x TECHNICAL ADVANCES New methods to identify conserved microsatellite loci and develop primer sets of high cross-species
More informationEvolution by Natural Selection
Evolution by Natural Selection 225 Permian Seed Plants Flowering Plants Birds Land Plants Mammals Insects Reptiles Teleost Fish Amphibians Chordates Molluscs Arthropods Dinosaurs 180 Triassic Jawless Fish
More informationOur ref: Your ref: PPL - D. Clendon. Date: 1/10/2015. From: Technical Advisor Ecology - J. Marshall. Waitaha Hydro - Lizards
Internal Correspondence To: PPL - D. Clendon Our ref: Your ref: Date: 1/10/2015 From: Technical Advisor Ecology - J. Marshall Subject: Waitaha Hydro - Lizards Summary The applicant has employed a respected
More informationLineage Classification of Canine Title Disorders Using Mitochondrial DNA 宮原, 和郎, 鈴木, 三義. Journal of Veterinary Medical Sci Citation
' ' Lineage Classification of Canine Title Disorders Using Mitochondrial DNA TAKAHASI, Shoko, MIYAHARA, Kazuro Author(s) Hirosi, ISHIGURO, Naotaka, SUZUKI 宮原, 和郎, 鈴木, 三義 Journal of Veterinary Medical Sci
More informationMotuora island reptile monitoring report for common & Pacific gecko 2017
Motuora island reptile monitoring report for common & Pacific gecko 7 Prepared by Su Sinclair August 7 Work on this monitoring project was carried out under a Wildlife Act Authority issued by the Department
More informationExtinction. Extinction occurs when all individuals of a species are gone and have left no descendants. If all the species within a genus are
Extinction Extinction occurs when all individuals of a species are gone and have left no descendants. If all the species within a genus are extinct then the genus is extinct. If all genera in a family
More informationDrivers of Extinction Risk in Terrestrial Vertebrates
LETTER Drivers of Extinction Risk in Terrestrial Vertebrates Simon Ducatez & Richard Shine School of Biological Sciences, University of Sydney, NSW 2006, Australia Keywords Amphibians; birds; endangerment;
More informationDarwin s Finches and Natural Selection
Darwin s Finches and Natural Selection by Cheryl Heinz, Dept. of Biological Sciences, Benedictine University, and Eric Ribbens, Dept. of Biological Sciences, Western Illinois University 1 The Galapagos
More informationLife s Natural History = a record of Successions & Extinctions. Anaerobic Bacteria. Photosynthetic Bacteria. Green Algae. Multicellular Animals
Evolution by Natural Selection (Chapter 22) DOCTRINE TINTORETTO The Creation of the Animals 1550 The Fossil record OBSERVATION mya Quaternary 1.5 Tertiary 63 Cretaceous 135 Jurassic 180 Triassic 225 Permian
More informationBiology of the Galapagos
Biology of the Galapagos Why can you get so close to the wildlife in the Galapagos? 23 March 2010, Thurs ECOL 182R UofA K. E. Bonine Alan Alda Video? 1 9 Galapagos 1000 km Ecuador S. America Origins of
More informationName: Date: Hour: Fill out the following character matrix. Mark an X if an organism has the trait.
Name: Date: Hour: CLADOGRAM ANALYSIS What is a cladogram? It is a diagram that depicts evolutionary relationships among groups. It is based on PHYLOGENY, which is the study of evolutionary relationships.
More informationLinking speciation to extinction: Diversification raises contemporary extinction risk in amphibians
LETTER doi:10.1002/evl3.4 Linking speciation to extinction: Diversification raises contemporary extinction risk in amphibians Dan A. Greenberg 1,2,3,4 and Arne Ø. Mooers 1,3 1 Department of Biological
More informationBones, Stones, and Genes: The Origin of Modern Humans Lecture 2- Genetics of Human Origins and Adaptation Sarah A. Tishkoff, Ph.D.
Bones, Stones, and Genes: The Origin of Modern Humans Lecture 2- Genetics of Human Origins and Adaptation Sarah A. Tishkoff, Ph.D. 1. Start of Lecture 2 (0:00) [ Music ] [ANNOUNCER:] From the Howard Hughes
More informationNational Finch & Softbill Society
First Class Mail U.S. Postage PAID Shawnee Msn KS Permit No. 84! 21 Oakcrest Rd S. Weymouth, MA 02190 Journal of the National Finch & Softbill Society Vol. 28, No. 4 Jul / Aug 2011 Using Genetics to Understand
More informationTypes of Evolution: Punctuated Equilibrium vs Gradualism
Biology Types of Evolution: Punctuated Equilibrium vs Gradualism Use the information below AND YOUR NOTES to answer the questions that follow. READ the information before attempting to do the work. You
More informationAP Biology. AP Biology
Evolution by Natural Selection 2006-2007 DOCTRINE TINTORETTO The Creation of the Animals 1550 But the Fossil record OBSERVATION mya Quaternary 1.5 Tertiary 63 Cretaceous 135 Jurassic 180 Triassic 225 Permian
More informationRode Pool Bird Report 2013
Rode Pool Bird Report 2013 RODE POOL BIRD REPORT 2013 ## denotes that the species was seen using the feeding station at the bird hide. Little Grebe (Tachybaptus ruficollis) An increase in records, but
More informationFinal Report for Research Work Order 167 entitled:
Final Report for Research Work Order 167 entitled: Population Genetic Structure of Marine Turtles, Eretmochelys imbricata and Caretta caretta, in the Southeastern United States and adjacent Caribbean region
More informationEvolution of Biodiversity
Long term patterns Evolution of Biodiversity Chapter 7 Changes in biodiversity caused by originations and extinctions of taxa over geologic time Analyses of diversity in the fossil record requires procedures
More informationWhich Came First: The Lizard or the Egg? Robustness in Phylogenetic Reconstruction of Ancestral States
RESEARCH ARTICLE Which Came First: The Lizard or the Egg? Robustness in Phylogenetic Reconstruction of Ancestral States APRIL M. WRIGHT 1 *, KATHLEEN M. LYONS 1, MATTHEW C. BRANDLEY 2,3, AND DAVID M. HILLIS
More informationEvidence of high longevity in an Island lacertid, Teira dugesii (Milne-Edwards, 1829). First data on wild specimens
Acta Herpetologica 7(2): 309-313, 2012 Evidence of high longevity in an Island lacertid, Teira dugesii (Milne-Edwards, 1829). First data on wild specimens J. Jesus Centro de Competências de Ciências da
More informationDaniel J. Newhouse * and Christopher N. Balakrishnan
Newhouse and Balakrishnan BMC Evolutionary Biology (2015) 15:265 DOI 10.1186/s12862-015-0546-3 RESEARCH ARTICLE Open Access High major histocompatibility complex class I polymorphism despite bottlenecks
More informationEvidence for Evolution by Natural Selection. Hunting for evolution clues Elementary, my dear, Darwin!
Evidence for Evolution by Natural Selection Hunting for evolution clues Elementary, my dear, Darwin! 2006-2007 Evidence supporting evolution Fossil record shows change over time Anatomical record comparing
More informationDifferences between Reptiles and Mammals. Reptiles. Mammals. No milk. Milk. Small brain case Jaw contains more than one bone Simple teeth
Differences between Reptiles and Mammals Reptiles No milk Mammals Milk The Advantage of Being a Furball: Diversification of Mammals Small brain case Jaw contains more than one bone Simple teeth One ear
More information