The Microbiome of Food Animals and the Effects of Antimicrobial Drugs

Transcription

1 Microbial Ecology Group The Microbiome of Food Animals and the Effects of Antimicrobial Drugs Paul S. Morley DVM, PhD, DACVIM Professor of Epidemiology and Infection Control / Colorado State University Professor of Epidemiology / Colorado School of Public Health Director of Infection Control / James L. Voss Veterinary Teaching Hospital

2 Microbial Ecology Group Paul Morley and Keith Belk MEG.ColoState.edu

3 Microbial Ecology Group: Special Thanks to Our Research Partners National Cattlemen s Beef Association

4 Microbial Ecology of Food Production common antibiotics microbial contamination food distribution antimicrobial resistance & disease sewage drinking water food quality fertilization manure mgmt water runoff

5

6 Antimicrobial Resistance as a Public Health Risk oanthropogenic Hypothesis Antimicrobial Drug Use in Food Animals Antimicrobial Resistance in Enteric Bacteria Infection/Colonization in Humans (in food) Adverse Health Events in Humans

7 Amoxicillin-Clavulanate Ampicillin Cefoxitin Ceftiofur Ceftriaxone *Cephalothin *Chloramphenicol Ciprofloxacin Gentamicin Kanamycin *Naladixic Acid Streptomycin Sulfamethoxazole *Tetracycline Trimethoprim-Sulfa Adjusted Percent Resistance Ecological Disconnect in Our Studies? 100s to 1000s of Cattle ~30 kg feces/day bacteria per gram E. coli Fecal Microbiome >1000 bacterial species Firmicutes Proteobacteria Actinobacteria Bacteroidetes 1g from animals 1 to 5 Colonies 1 or 2 Species AMDs Conclusions about Risks 1 to 3 Wks (n=999) 90% 4 to 6 Wks (n=2,295) 7 to 9 Wks (n=1,458) 80% 10 to 12 Wks (n=1,098) 13 to 15 Wks (n=420) 70% 16 to 27 Wks (n=2,612) 60% 50% 40% 30% 100% 20% 10% 0% What Does This Represent?

8 Previous Research on Microbial Ecology & Antimicrobial Resistance What Has Been Suggested We Study What is Easy to Culture AMR in Fecal E. coli ASSUMING IT REPRESENTS EVERYTHING ELSE - Pathogens & Non-Pathogens - Culturable & Non-Culturable - Animals & Humans - Gut - Skin - Respiratory - Environment

9 Percent Resistance Benedict et al., 2015 Feedlot Cattle: E. Coli Isolated from Individual Feedlot Cattle 100% 90% 80% 70% 60% 50% 40% 30% 20% 10% 0% P < P = 0.05 Increasing Resistance Over Time Weak Associations with Tetracycline Use P < P < P < Arrival Sample (n=1663/4042/2379) days on feed (n= 700 /1737 /1037) days on feed (n= 631 / 1552 / 921) >120 days on feed (n= 533 / 1300 / 767) P < P = P = 0.11

10 Amox/Clav Ampicillin Cefoxitin Ceftiofur Ceftriaxone Cephalothin *Chloramphenicol Ciprofloxacin Gentamicin Kanamycin *Naladixic Acid *Streptomycin *Sulfamethoxazole Tetracycline *Trimeth/Sulfa Adjusted Percent Resistance Pen Floor Samples of Feedlot Cattle Adjusted Pct Resistance by Days on Feed 100% 90% 80% PEN EARLY (n=1,966) 70% PEN MID (n=1,905) PEN LATE (n=1,859) HOSPITAL (n=286) More Resistance in Hospital Pen Samples Decreasing Resistance Over Time 60% 50% 40% 30% 20% 10% 0%

11 Morley et al., 2011 Conventional and Natural Feedlot Cattle Increasing Resistance Over Time Despite Absence of Tetracycline Exposure

12 Another Perspective Rather than studying isolates of a single species o Metagenomics Study of genetic material from communities of organisms Inherently more holistic, ecologically based approach for evaluating complex microbial interactions Whole Populations of Microbes (microbiome) All Resistance Genes (resistome)

13 The Omics of the Microbiome? 1. Genome DNA Who is there? Resistome 2. Transcriptome RNA Who is active? 3. Proteome Who is active? 4. Metabalome What is formed? e.g., fatty acids and other metabolites INTEGRATE TO OBTAIN A WHOLISTIC UNDERSTANDING OF MICROBIAL ECOLOGY

14 METAGENOMIC SEQUENCING WORKFLOW Samples DNA extraction Library Prep High-Throughput Sequencing SEQUENCING (various methods) AGGTCGTGCGTAGTGGTACGAATGTTTACGCGTACCG ACAGATAGACGTGTGACCGTACGGTTGGAAGTCGACG TGCAAGGTCGTGCGTAGTGGTACGAATGTTTACGCGT ACCGACAGATAGACGTGTGACCGTACGGTTGGAAGTC GACGTGCAAGGTCGTGCGTAGTGGTACGAATGTG AMR Gene Annotation PREPARATION DNA Extraction & Purification DNA Fragmentation Library Prep (adapters that allow sequencing & molecular IDs) PCR amplification (16s and target) Microbial Community Structure BIOINFORMATICS Alignment Assembly (De novo and Scaffold) Alignment-Free Methods ANALYSIS & INTERPRETATION

15 How Can We Use This? opresence of microbial agents in context of community Genes and expression oecology of agents Abundance, evenness, diversity, etc. Dysbiosis and Disease ofunction of microbiome Can we adapt to favor animal health and production? e.g., Fiber metabolism More complete digestion More efficient metabolic pathways e.g., Starch metabolism Lower impact on ph (e.g., Lactobacillus spp)

16 Impacts of AMDs on Human Microbiome o Obesity risk o Secondary dysbiosis o Immune function (i.e., so-called hygiene hypothesis o Etc

17 Timsit, et al. Animal Frontiers 2016 doi: /af

18 Figure 4. Venn diagram of the rumen core microbiomes. Petri RM, Schwaiger T, Penner GB, Beauchemin KA, Forster RJ, et al. (2013) Characterization of the Core Rumen Microbiome in Cattle during Transition from Forage to Concentrate as Well as during and after an Acidotic Challenge. PLoS ONE 8(12): e doi: /journal.pone

19

20 Mao S, et al. Scientific Reports 2015 doi: /srep16116

21 beef cattle from weaning to 40 days after arrival at a feedlot The respiratory microbiome changes in growing cattle Timsit, et al. Vet Micro 2016; 187:75-81

22 Changes in Host Community Microbiome Timsit, et al. Animal Frontiers 2016 doi: /af Rapidly changing respiratory microbiome in feedlot cattle

23 Cattle that develop respiratory disease were different at Day 0 Holmes et al., 2015

24 88 Samples Noyes et al. elife 2016;5:e13195

25 Microbiome Clustered by Sample Matrix & Location Noyes et al. elife 2016;5:e13195 SOIL FECES FECES PLANT TRUCK

26 Matrix Feces Noyes et al. elife 2016;5:e13195 Resistome composition was significantly different based on sample matrix Soil Water The resistome changed significantly during the feeding period in: b) Feces c) Soil d) Water

27 Differences between samples in Resistome composition were correlated with differences in Microbiome Noyes et al. elife 2016;5:e13195

28 Log-Fold Change in Abundance soil water feces Abundance of Resistance Genes Generally Declines During Feeding (Source: Noyes et al., 2016) More abundant at placement More abundant at shipping spectinomycin aminocoumarin aminoglycoside MLS tetracycline phenicol β-lactam sulfonamide bacitracin fluoroquinolone permeability genes polymyxin B rifampin modulatory genes efflux pumps Class of Resistance Genes

29 Relative Abundance AMR genes NOT identified in postfabrication samples (Source: Noyes et al., 2016) 0.12% feces soil water 0.10% 0.08% 0.06% 0.04% 0.02% 0.00% Placement Shipping Truck Holding Post-fab

30 Sci Rep J 2016; 6:24645 The pre-ruminant calf fecal resistome differed from the adult dairy fecal resistome

31 Effect of Tulathromycin Exposure on Microbial Community in Feedlot Cattle Doster E, Rovira P, Noyes N, Yang X, Yang H, Boucher CA, Jones KL, Belk KE, Morley PS Analysis to investigate differences otreatment group (Draxxin metaphylaxis vs. Control) otime (Arrival vs. day 11) MEG.ColoState.Edu

32 Fecal Microbiome Greatest changes occurred over TIME, not by treatment group Fecal Resistome Groups:

33 Impact of "Raised Without Antibiotics" Beef Cattle Production Practices on Occurrences of Antimicrobial Resistance. Vikram et al., 2016 AEM, In Press Normalized abundance of hits to ARGs were not substantively different

34 Normalized hits Normalized hits Antimicrobial Resistance Genes in Conventional and RWA Rearing Systems ofeedlots odairies Soil WW Feces late Feces early Soil WW Feces high Feces low 0 0 CONV NAT CONV ORG (Source: Rovira et al., in preparation)

35 Other Research Has Found Resilience in Microbiomes of Animals Treated with AMDs o Milk microbiome Ganda et al., Microbiom 2017 o Young broilers Wisselink et al, Poutry Sci 2017 o Growing swine Kim et al., J Microbiol Biotechnol 2016 Cautionary Notes o Over-generalization impacts of specific treatment regimens o Genotype vs. Expression o Repetition is a good thing in research!

36 The Ecology of Antimicrobial Resistance common antibiotics microbial contamination food distribution antimicrobial resistance & disease sewage drinking water food quality fertilization manure mgmt water runoff

37 Thank You Office: Cell: