Potential Impacts of Antibiotics in the Environment

Size: px
Start display at page:

Download "Potential Impacts of Antibiotics in the Environment"

Transcription

1 Potential Impacts of Antibiotics in the Environment Amy Pruden Assistant Professor, Civil Engineering, Colorado State University R1 R D C R3 R B A H CNH 2 H H H

2 verview Agricultural Antibiotics verview of potential impacts Why study resistance genes? Poudre River Study Conclusions Recommendations

3 Agricultural Antibiotics More than ½ used in U.S. Animals Subtherapeutic use promotes weight gain. Animal waste > 130 x human waste (United States Senate Committee on Agriculture, 1997) Antibiotics can be excreted unaltered. Animal Waste Treatment??

4 Antibiotic Pathways Modified from

5 Antibiotics Used: Tetracyclines Chlortet., oxytet., tet... Sulfonamides Macrolides Tylosin, erythromycin.. Ionophores Monensin.. β-lactams Penicilillin H 3 C H H H 3 C H C H H CH 3 H H 3 C H N Erythromycin (Ery) H H 3 C R1 R D C R3 R B H H H C 2 H 3 H 6 17 N--CH 2 --CH 2 -CH 2 - H 3 C H H H 3 C H 5 A Tetracylcline (Tet) CH H H H 3 C N CH3 Tylosin (Tyl) C 4 1 H 3 CH 3 2 H H CNH 2 H 3 C H Roxithromycin (Rox) H H N

6 Public Concern

7 Potential Impacts Toxicity to Aquatic life (H. Ramsdell, CSU) Planaria, flathead minnow, and Hyalella Chlortetracycline, tylosin, sulfamethazine, metronidizine, monensin and lyolocid showed toxicity Monensin strong toxicity and widespread use LD 50 = 5 ppm in water for minnows LD 50 = 20 ppm in sediment for Planaria LD 50 = 1 ppm in water for Hyalella Sublethal effects?

8 Potential Impacts Sub-lethal impacts: Endocrine disruptors Micropollutants not removed by wastewater treatment May cause hermaphroditism Effects on frogs Fish in Chesapeake Bay Sower et al., Env. Health Perspect. 2000

9 Potential Impacts Plant Uptake Antibiotic uptake by plants from soil fertilized with animal manure- Kumara et al. U. Minn. J Environ Qual (2005) Greenhouse studies: corn, green onion, & cabbage Uptake of chlortetracycline, but not tylosin Low: 2 17 ng/g, but correlates with manure concentration Implications for allergic individuals

10 Antibiotic Resistance Genes (ARG) Spread of ARG one of most urgent human health issues according to WH Use of antibiotics selects for antibiotic resistant organisms Shea, 2003; Fedorka-Cray et al., 2002; Smith et al., 2002; Sørum and L Abée-Lund, 2002; Teuber, Can be spread across microbial populations and in the environment ARG as pollutants

11 Resistance Gene Transfer ASM News November, 2004

12 Antibiotic Resistance Genes If we can detect and quantify resistance genes, then we have an assay on the bioavailability/impact of the antibiotics.

13 Mechanisms of Resistance Alteration of the antibiotic or target site tetm tets tet tetw tetq tett tetbp Impaired uptake or enhanced efflux teta tetb tetc tetd tete tetg teth tetj tety tetz verproduce target so higher concentration of antibiotic needed sul genes (PABA overproduction to make folic acid) Degrade antibiotic β-lactams Resistance transfer: Plasmids can be exchanged within and between species

14 Methods Plate counting: R2A agar with antibiotics. Polymerase chain reaction (PCR) assays: Presence/absence of a resistance gene family. Quantitative real-time PCR (Q-PCR) Quantify resistance gene families. Goal: Indicator of Bioavailability/impact of Antibiotics

15 Study Site: Poudre River

16 Map of Study Sites

17 CFU at Sites: April 2004 CFU Per Gram of Sediment Chlortetracycline xytetracycline Mecolcycline Sulfamethoxazole Sulfamethazine Erythromycin Tylosin Monensin No Ab. site 1 site 2 site 3 site 4 site 5

18 CFU at Sites: February 2005 CFU Per Gram of Sediment Chlortetracycline xytetracycline Mecolcycline Sulfamethoxazole Sulfamethazine Erythromycin Tylosin Monensin No Ab. site 1 site 2 site 3 site 4 site 5

19 Pitfalls of Culture-Based Methods 99% of environmental organisms cannot be cultured on standard media (Amann et al., Pace et al.). 16S rrna gene as a target for detecting microorganisms in environmental samples (Woese et al.). Targeting of functional genes.

20 Molecular Biology Approach Polymerase Chain Reaction (PCR) Exponentially amplify target genes using primers specific to the target. Low detection limit. Provides a means of presence/absence detection.

21 sul D sul BC sul Bcr sul A sul III sul I sul II Phylogenetics of Sul Sul Genes

22 New Sul Primers Primer Sul I-FW a SulI-RV Sul II-FW Sul II-RV Sul III-FW Sul III-RV Sul A-FW Sul A-RV Sul BC-FW Sul BC-RV Sul Bcr-FW Sul Bcr-RV Sul D-FW Sul D-RV Class targeted Sul I Sul II Sul III Sul A Sul BC Sul Bcr Sul D Sequences cgcaccggaaacatcgctgcac tgaagttccgccgcaaggctcg tccggtggaggccggtatctgg cgggaatgccatctgccttgag tccgttcagcgaattggtgcag ttcgttcacgccttacaccagc tcttgagcaagcactccagcag tccagccttagcaaccacatgg acaaggtcgcttccagactagc agctcggtatctggcatggctc atagctcccattgcgggttctc tttcaggaacgatgaacacagc agagtccagtgtcttagcgacg agtcttgtgctggtagccaggt Q-PCR annealing temp (ºC) Amplicon Size (bp) Specificity verified by cloning and sequencing the inserts.

23 Detection of PCR Product

24 PCR Presence / Absence Assay Gene ID Site 1 April 2004 high-flow spring Site 2 Site 3 Site 4 Site 5 Site 1 February 2005 low-flow winter Site 2 Site 3 Site 4 Site 5 + control tetb(p) tet() tet(s) tet(t) tet(w) sul(i) sul(ii) sul(iii) sul(a)

25 Real-time PCR Fluorescence Number of Cycles

26 Log Copy of sul I Genes per Reaction Sul I Gene Calibration y = x r 2 = Threshold Cycle (CT) Value

27 April, 2004: Spring High-Flow Copy of ARG / Copy of 16S Genes 10-2 sul(i) 10-3 sul(ii) 10-4 tet(w) tet() site 1 site 2 site 3 site 4 site 5

28 Feb, 2005: Winter Low-Flow Copy of ARG / Copy of 16S genes 10-2 sul(i) 10-3 sul(ii) 10-4 tet(w) tet() site 1 site 2 site 3 site 4 site 5

29 Aug, 2005: Summer Low-Flow Copy of ARG / Copy of 16S genes 10-2 sul(i) 10-3 sul(ii) 10-4 tet(w) tet() site 1 site 2 site 3 site 4 site 5

30 Conclusions Resistance genes in Poudre sediments correlate with human and agricultural activity No direct correlation with antibiotics High sulfonamide resistance compared to tet resistance Fate of antibiotics vs fate of genes? High-flow versus low-flow? Implications for transport?

31 Recommendations Need further studies into the origin of the antibiotic resistance genes and their fate Human vs agricultural Do genes persist longer than antibiotics? Investigate and apply treatment strategies for mitigating risk.

32 Composting Field Study

33 Biodegradation of ARG

34 Students!!!

35 Thank You!! Thank you to USDA NRI and to the CSU Agricultural Research Station for supporting this research!! Ken Carlson & Sung-chul Kim Jessica Davis & Kathy Doesken Questions??

A Unique Approach to Managing the Problem of Antibiotic Resistance

A Unique Approach to Managing the Problem of Antibiotic Resistance A Unique Approach to Managing the Problem of Antibiotic Resistance By: Heather Storteboom and Sung-Chul Kim Department of Civil and Environmental Engineering Colorado State University A Quick Review The

More information

AMR dissemination in the environment Professor Liz Wellington

AMR dissemination in the environment Professor Liz Wellington AMR dissemination in the environment Professor Liz Wellington The connectivity of potential sources of antibioticresistant bacteria Antibiotic resistance in the environment: soil, sediments, water bodies

More information

Transport of antibiotic resistant bacteria into tile drainage systems

Transport of antibiotic resistant bacteria into tile drainage systems 11 th Annual Drainage Research Forum Owatonna, Minnesota November 23 rd, 21 Transport of antibiotic resistant bacteria into tile drainage systems Michelle Soupir Agricultural & Biosystems Engineering,

More information

Drug Use on the Farm & Antibiotic Resistance in Raw, Stored, & Treated Manures

Drug Use on the Farm & Antibiotic Resistance in Raw, Stored, & Treated Manures Drug Use on the Farm & Antibiotic Resistance in Raw, Stored, & Treated Manures Jason Oliver, PhD Cornell PRO-DAIRY Dairy Environmental Systems Dairy Practices Council Annual Conference Buffalo, NY Nov.

More information

Antibiotics & Resistance

Antibiotics & Resistance What are antibiotics? Antibiotics & esistance Antibiotics are molecules that stop bacteria from growing or kill them Antibiotics, agents against life - either natural or synthetic chemicals - designed

More information

Antibiotic Resistance Genes and their Association in Dairy Cattle

Antibiotic Resistance Genes and their Association in Dairy Cattle Antibiotic Resistance Genes and their Association in Dairy Cattle Brittany Willing Virginia Tech February 23, 2013 Overview Antibiotic resistance genes (ARGs) What are they? Linked? Multiple resistance?

More information

Framework for monitoring antibiotic content and antibiotic resistance in the Danube Delta - the EnviroAMR project -

Framework for monitoring antibiotic content and antibiotic resistance in the Danube Delta - the EnviroAMR project - Framework for monitoring antibiotic content and antibiotic resistance in the Danube Delta - the EnviroAMR project - Dr. Cristian COMAN Institute of Biological Research Cluj-Napoca November 18 th November

More information

Fate and Transport of Hormones & Antimicrobials

Fate and Transport of Hormones & Antimicrobials Fate and Transport of Hormones & Antimicrobials Linda S. Lee Purdue University Dept. of Agronomy April 25, 2008 1 Basic Properties & Source Concentrations Fate Processes Transport Processes 2 Hormones:

More information

From Wastewater to Your Tap Water: The Vicious Cycle of Antibiotic Resistance

From Wastewater to Your Tap Water: The Vicious Cycle of Antibiotic Resistance Victoria Sullivan BioTAP March 23, 2015 From Wastewater to Your Tap Water: The Vicious Cycle of Antibiotic Resistance Multi-drug resistant pathogens pose a great challenge to the treatment of infectious

More information

Agriculture & Agri-Food Canada, Research Centre, Lethbridge, AB. Environment Canada, Saskatoon, Saskatchewan

Agriculture & Agri-Food Canada, Research Centre, Lethbridge, AB. Environment Canada, Saskatoon, Saskatchewan The Fate of Antimicrobial Residues during Composting and Stockpiling of Manure Srinivas Sura 1,2, Tim A. McAllister 1, Francis J. Larney 1, Allan J. Cessna 2, Inoka D. Amarakoon 3, Lisa D. Tymensen 4,

More information

ManureTracker: On the Trail of Hormones, Antimicrobials and Antimicrobial Resistance Genes

ManureTracker: On the Trail of Hormones, Antimicrobials and Antimicrobial Resistance Genes ManureTracker: On the Trail of Hormones, Antimicrobials and Antimicrobial Resistance Genes Francis J. Larney 1, Srinivas Sura 2, Shanwei Xu 1, Edward Topp 2, and Tim A. McAllister 1 1 Agriculture & Agri-Food

More information

Are Veterinary Medicines Causing Environmental Risks?

Are Veterinary Medicines Causing Environmental Risks? Are Veterinary Medicines Causing Environmental Risks? Nine species of vultures in the wild numbered 40 million birds in the early 1980s. Today, only about 60,000 birds are left (Vibhu Prakash, Bombay

More information

Antimicrobial resistance: a global problem

Antimicrobial resistance: a global problem Antimicrobial resistance: a global problem The connectivity of potential sources of antibioticresistant bacteria Wellington et al. Lancet Infect Dis 13, 155-65 2013 Studying the environmental gene pool:

More information

Antimicrobial Resistance: Do we know everything? Dr. Sid Thakur Assistant Professor Swine Health & Production CVM, NCSU

Antimicrobial Resistance: Do we know everything? Dr. Sid Thakur Assistant Professor Swine Health & Production CVM, NCSU Antimicrobial Resistance: Do we know everything? Dr. Sid Thakur Assistant Professor Swine Health & Production CVM, NCSU Research Focus Antimicrobial Resistance On farm, Slaughter, Retail, Human Sample

More information

Consequences of Antimicrobial Resistant Bacteria. Antimicrobial Resistance. Molecular Genetics of Antimicrobial Resistance. Topics to be Covered

Consequences of Antimicrobial Resistant Bacteria. Antimicrobial Resistance. Molecular Genetics of Antimicrobial Resistance. Topics to be Covered Antimicrobial Resistance Consequences of Antimicrobial Resistant Bacteria Change in the approach to the administration of empiric antimicrobial therapy Increased number of hospitalizations Increased length

More information

MID 23. Antimicrobial Resistance. Consequences of Antimicrobial Resistant Bacteria. Molecular Genetics of Antimicrobial Resistance

MID 23. Antimicrobial Resistance. Consequences of Antimicrobial Resistant Bacteria. Molecular Genetics of Antimicrobial Resistance Antimicrobial Resistance Molecular Genetics of Antimicrobial Resistance Micro evolutionary change - point mutations Beta-lactamase mutation extends spectrum of the enzyme rpob gene (RNA polymerase) mutation

More information

Determination, Confirmation and Quantitation of Multi-Class Antibiotic Residues in Milk by UHPLC MS/MS

Determination, Confirmation and Quantitation of Multi-Class Antibiotic Residues in Milk by UHPLC MS/MS APPLICATION NOTE Liquid Chromatography/ Mass Spectrometry Authors: Avinash Dalmia PerkinElmer, Inc. Shelton, CT Determination, Confirmation and Quantitation of Multi-Class Antibiotic Residues in Milk by

More information

Antimicrobial Resistance

Antimicrobial Resistance Antimicrobial Resistance Consequences of Antimicrobial Resistant Bacteria Change in the approach to the administration of empiric antimicrobial therapy Increased number of hospitalizations Increased length

More information

Antimicrobial Resistance Acquisition of Foreign DNA

Antimicrobial Resistance Acquisition of Foreign DNA Antimicrobial Resistance Acquisition of Foreign DNA Levy, Scientific American Horizontal gene transfer is common, even between Gram positive and negative bacteria Plasmid - transfer of single or multiple

More information

Objectives. Antibiotics uses in food animals 3/25/2018. California Dairy Productions. Antimicrobial Resistance in the Animal Production Environment

Objectives. Antibiotics uses in food animals 3/25/2018. California Dairy Productions. Antimicrobial Resistance in the Animal Production Environment Antimicrobial Resistance in the Animal Production Environment Xunde Li Western Institute for Food Safety and Security Department of Population Health and Reproduction University of California Davis Objectives

More information

Environment and Natural Resources Trust Fund (ENRTF) M.L Work Plan

Environment and Natural Resources Trust Fund (ENRTF) M.L Work Plan Environment and Natural Resources Trust Fund (ENRTF) M.L. 2013 Wk Plan Date of Status Update Rept: October 2, 2012 Date of Next Status Update Rept: January 31, 2014 Date of Wk Plan Approval: Project Completion

More information

Selective toxicity. Antimicrobial Drugs. Alexander Fleming 10/17/2016

Selective toxicity. Antimicrobial Drugs. Alexander Fleming 10/17/2016 Selective toxicity Antimicrobial Drugs Chapter 20 BIO 220 Drugs must work inside the host and harm the infective pathogens, but not the host Antibiotics are compounds produced by fungi or bacteria that

More information

What is antimicrobial resistance?

What is antimicrobial resistance? What is antimicrobial resistance? Gérard MOULIN gerard.moulin@anses.fr French agency for food, environmental and occupationnal safety National agency for veterinary Medicinal Products BP 90203-35302 FOUGERES

More information

ANTIBIOTICS AND ANTIMICROBIAL RESISTANCE: CAUSES AND POSSIBLE SOLUTIONS

ANTIBIOTICS AND ANTIMICROBIAL RESISTANCE: CAUSES AND POSSIBLE SOLUTIONS 10TH EUROPEAN CONFERENCE ON PESTICIDES AND RELATED ORGANIC MICROPOLLUTANTS IN THE ENVIRONMENT & 16TH SYMPOSIUM ON CHEMISTRY AND FATE OF MODERN PESTICIDES joined to 10TH MGPR INTERNATIONAL SYMPOSIUM OF

More information

Changing Practices to Reduce Antibiotic Resistance

Changing Practices to Reduce Antibiotic Resistance Changing Practices to Reduce Antibiotic Resistance Jean E. McLain, Research Scientist and Assistant Dean University of Arizona College of Agriculture and Life Sciences and Department of Soil, Water and

More information

Mechanisms and Pathways of AMR in the environment

Mechanisms and Pathways of AMR in the environment FMM/RAS/298: Strengthening capacities, policies and national action plans on prudent and responsible use of antimicrobials in fisheries Final Workshop in cooperation with AVA Singapore and INFOFISH 12-14

More information

ANTIBIOTIC POLLUTION FROM MANUFACTURING

ANTIBIOTIC POLLUTION FROM MANUFACTURING ANTIBIOTIC POLLUTION FROM MANUFACTURING JOHAN BENGTSSON-PALME JOHAN BENGTSSON-PALME Patancheru, India Patancheru* Active ingredient Type of drug Range (µg/l) Ciprofloxacin antibiotic-fluoroquinolone 28,000-31,000

More information

Draft agreed by the Environmental Risk Assessment Working Party (ERAWP) 30 April 2018

Draft agreed by the Environmental Risk Assessment Working Party (ERAWP) 30 April 2018 1 2 3 8 November 2018 EMA/CVMP/ERA/632109/2014 Committee for Medicinal Products for Veterinary Use (CVMP) 4 5 6 7 Reflection paper on antimicrobial resistance in the environment: considerations for current

More information

Overview of NARMS Program and Detecting Emerging/Novel Antimicrobial Resistance Genes Using WGS

Overview of NARMS Program and Detecting Emerging/Novel Antimicrobial Resistance Genes Using WGS Overview of NARMS Program and Detecting Emerging/Novel Antimicrobial Resistance Genes Using WGS Shaohua Zhao DVM, MPVM, PhD U.S. Food and Drug Administration Center for Veterinary Medicine Office of Research

More information

Preventing Sulfa Residues in Pork

Preventing Sulfa Residues in Pork 1 of 7 4/29/2010 8:43 AM University of Missouri Extension G2358, Reviewed October 1993 Preventing Sulfa Residues in Pork John C. Rea Department of Animal Sciences Sulfa products and other antibiotics have

More information

Effect of Subtherapeutic Administration of Antibiotics on the Prevalence of Antibiotic-Resistant Escherichia coli Bacteria in Feedlot Cattle

Effect of Subtherapeutic Administration of Antibiotics on the Prevalence of Antibiotic-Resistant Escherichia coli Bacteria in Feedlot Cattle APPLIED AND ENVIRONMENTAL MICROBIOLOGY, July 2008, p. 4405 4416 Vol. 74, No. 14 0099-2240/08/$08.00 0 doi:10.1128/aem.00489-08 Copyright 2008, American Society for Microbiology. All Rights Reserved. Effect

More information

2017 NAMI Meat Industry Summit, San Diego, CA April 3-5, Keith E. Belk

2017 NAMI Meat Industry Summit, San Diego, CA April 3-5, Keith E. Belk 2017 NAMI Meat Industry Summit, San Diego, CA April 3-5, 2017 Keith E. Belk Professor & Monfort Chair Center for Meat Safety & Quality Department of Animal Sciences Colorado State University Fort Collins

More information

Martin Chénier, Ph.D. Microbiology. Antibiotics in Animal Production: Resistance and Alternative Solutions

Martin Chénier, Ph.D. Microbiology. Antibiotics in Animal Production: Resistance and Alternative Solutions Faculty of Agricultural and Environmental Sciences Department of Food Science, Department of Animal Science Martin Chénier, Ph.D. Microbiology Antibiotics in Animal Production: Resistance and Alternative

More information

Antibiotic Residues in Animal Waste: Occurrence and Degradation in Conventional Agricultural Waste Management Practices

Antibiotic Residues in Animal Waste: Occurrence and Degradation in Conventional Agricultural Waste Management Practices Curr Pollution Rep (2016) 2:135 155 DOI 10.1007/s40726-016-0037-1 WATER POLLUTION (S SENGUPTA, SECTION EDITOR) Antibiotic Residues in Animal Waste: Occurrence and Degradation in Conventional Agricultural

More information

CAT LITTER and DOG FECES: COMPOST or WASTE?

CAT LITTER and DOG FECES: COMPOST or WASTE? CAT LITTER and DOG FECES: COMPOST or WASTE? Some Background Nova Scotia has set a solid waste disposal rate goal of 300 kg per person per year by 2015. > 500 kg in 1997 350 kg in 2000 ~ 500 kg in 2006

More information

Burton's Microbiology for the Health Sciences. Chapter 9. Controlling Microbial Growth in Vivo Using Antimicrobial Agents

Burton's Microbiology for the Health Sciences. Chapter 9. Controlling Microbial Growth in Vivo Using Antimicrobial Agents Burton's Microbiology for the Health Sciences Chapter 9. Controlling Microbial Growth in Vivo Using Antimicrobial Agents Chapter 9 Outline Introduction Characteristics of an Ideal Antimicrobial Agent How

More information

One Analysis, One Column, Less than 9 Minutes for Over 60 Multiclass Antibiotics

One Analysis, One Column, Less than 9 Minutes for Over 60 Multiclass Antibiotics Featured Application: Multiclass Veterinary Antibiotics on Raptor C8 by LC- One Analysis, One Column, Less than 9 Minutes for Over 0 Multiclass Antibiotics Highly efficient peak separation and fast analysis

More information

Project Summary. Impact of Feeding Neomycin on the Emergence of Antibiotic Resistance in E. coli O157:H7 and Commensal Organisms

Project Summary. Impact of Feeding Neomycin on the Emergence of Antibiotic Resistance in E. coli O157:H7 and Commensal Organisms Project Summary Impact of Feeding Neomycin on the Emergence of Antibiotic Resistance in E. coli O157:H7 and Commensal Organisms Principal Investigators: Mindy Brashears, Ph.D., Texas Tech University Guy

More information

Antimicrobial Resistance

Antimicrobial Resistance Antimicrobial Resistance Consequences of Antimicrobial Resistant Bacteria Change in the approach to the administration of Change in the approach to the administration of empiric antimicrobial therapy Increased

More information

Antibiotics. Antimicrobial Drugs. Alexander Fleming 10/18/2017

Antibiotics. Antimicrobial Drugs. Alexander Fleming 10/18/2017 Antibiotics Antimicrobial Drugs Chapter 20 BIO 220 Antibiotics are compounds produced by fungi or bacteria that inhibit or kill competing microbial species Antimicrobial drugs must display selective toxicity,

More information

The Microbiome of Food Animals and the Effects of Antimicrobial Drugs

The Microbiome of Food Animals and the Effects of Antimicrobial Drugs Microbial Ecology Group The Microbiome of Food Animals and the Effects of Antimicrobial Drugs Paul S. Morley DVM, PhD, DACVIM Professor of Epidemiology and Infection Control / Colorado State University

More information

An#bio#cs and challenges in the wake of superbugs

An#bio#cs and challenges in the wake of superbugs An#bio#cs and challenges in the wake of superbugs www.biochemj.org/bj/330/0581/bj3300581.htm ciss.blog.olemiss.edu Dr. Vassie Ware Bioscience in the 21 st Century November 14, 2014 Who said this and what

More information

Occurrence of Antibiotics in Drinking Water

Occurrence of Antibiotics in Drinking Water Occurrence of Antibiotics in Drinking Water Zhengqi Ye, Howard S. Weinberg Michael T. Meyer U. S. Geological Survey, Kansas Abstract The occurrence of antibiotics in the aquatic environment has raised

More information

Key Lecture: Entry, occurrence, behavior and effects of pharmaceuticals in the environment

Key Lecture: Entry, occurrence, behavior and effects of pharmaceuticals in the environment Workshop Pharmaceuticals in Soil, Sludge and Slurry (Dessau, 18 th June to 19 th June 2013) Key Lecture: Entry, occurrence, behavior and effects of pharmaceuticals in the environment Gerd Hamscher Faculty

More information

Aabo, Søren; Ricci, Antonia; Denis, Martine; Bengtsson, Björn; Dalsgaard, Anders; Rychlik, Ivan; Jensen, Annette Nygaard

Aabo, Søren; Ricci, Antonia; Denis, Martine; Bengtsson, Björn; Dalsgaard, Anders; Rychlik, Ivan; Jensen, Annette Nygaard Downloaded from orbit.dtu.dk on: Sep 04, 2018 SafeOrganic - Restrictive use of antibiotics in organic animal farming a potential for safer, high quality products with less antibiotic resistant bacteria

More information

Antibiotic Residues in Meat and Meat Products, Implications on Human Health

Antibiotic Residues in Meat and Meat Products, Implications on Human Health Antibiotic Residues in Meat and Meat Products, Implications on Human Health Loinda Rugay Baldrias, DVM, MVS, PhD Dean, Professor College of Veterinary Medicine University of the Philippines Los Banos National

More information

Microbiology : antimicrobial drugs. Sheet 11. Ali abualhija

Microbiology : antimicrobial drugs. Sheet 11. Ali abualhija Microbiology : antimicrobial drugs Sheet 11 Ali abualhija return to our topic antimicrobial drugs, we have finished major group of antimicrobial drugs which associated with inhibition of protein synthesis

More information

Antibiotic resistance a mechanistic overview Neil Woodford

Antibiotic resistance a mechanistic overview Neil Woodford Antibiotic Resistance a Mechanistic verview BSc PhD FRCPath Consultant Clinical Scientist 1 Polymyxin Colistin Daptomycin Mechanisms of antibiotic action Quinolones Mupirocin Nitrofurans Nitroimidazoles

More information

Introduction to Chemotherapeutic Agents. Munir Gharaibeh MD, PhD, MHPE School of Medicine, The university of Jordan November 2018

Introduction to Chemotherapeutic Agents. Munir Gharaibeh MD, PhD, MHPE School of Medicine, The university of Jordan November 2018 Introduction to Chemotherapeutic Agents Munir Gharaibeh MD, PhD, MHPE School of Medicine, The university of Jordan November 2018 Antimicrobial Agents Substances that kill bacteria without harming the host.

More information

Antibiotic resistance and the environment there and back again

Antibiotic resistance and the environment there and back again Science & Society Antibiotic resistance and the environment there and back again Science & Society series on Science and Drugs Silvia Berkner, Sabine Konradi & Jens Schönfeld Today, it is difficult to

More information

Risk analysis of antimicrobial use in aquaculture Peter Smith

Risk analysis of antimicrobial use in aquaculture Peter Smith FMM/RAS/298: Strengthening capacities, policies and national action plans on prudent and responsible use of antimicrobials in fisheries Risk analysis of antimicrobial use in aquaculture Peter Smith peter.smith@nuigalway.ie

More information

Agricultural Research Division, American Cyanamid Company, Princeton, NJ 08540

Agricultural Research Division, American Cyanamid Company, Princeton, NJ 08540 1 Antibiotics Use in Agriculture: An Overview Richard H. Gustafson Downloaded via 148.251.232.83 on October 16, 2018 at 00:12:00 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to

More information

The role of the environment in the selection and spread of antimicrobial resistance

The role of the environment in the selection and spread of antimicrobial resistance Priority Topic E - Environment The role of the environment in the selection and spread of antimicrobial resistance The overarching goal of this priority topic is to investigate the role of the environment

More information

Alejandro H. Buschmann Centro i-mar & CeBiB Universidad de Los Lagos Puerto Montt - Chile

Alejandro H. Buschmann Centro i-mar & CeBiB Universidad de Los Lagos Puerto Montt - Chile Alejandro H. Buschmann Centro i-mar & CeBiB Universidad de Los Lagos Puerto Montt - Chile Seafood Summit- New Orleans - 2015 Antibiotic use context Antibiotic use and their environmental consequences Conclusions

More information

Combating Antimicrobial Resistance: A Manufacturing Perspective

Combating Antimicrobial Resistance: A Manufacturing Perspective Combating Antimicrobial Resistance: A Manufacturing Perspective Steve Brooks VP, EHS Pfizer Inc & Chair, Environmental Work Group of the AMR Industry Alliance June 20 th 2017 AMR - Environmental Matters

More information

Risk management approaches to antimicrobial resistance in the U.S. and abroad

Risk management approaches to antimicrobial resistance in the U.S. and abroad Risk management approaches to antimicrobial resistance in the U.S. and abroad Expectations, results and conundrums H. Morgan Scott DVM, PhD E.J. Frick Professor of Veterinary Medicine Department of Diagnostic

More information

Chapter 12. Antimicrobial Therapy. Antibiotics 3/31/2010. Spectrum of antibiotics and targets

Chapter 12. Antimicrobial Therapy. Antibiotics 3/31/2010. Spectrum of antibiotics and targets Chapter 12 Topics: - Antimicrobial Therapy - Selective Toxicity - Survey of Antimicrobial Drug - Microbial Drug Resistance - Drug and Host Interaction Antimicrobial Therapy Ehrlich (1900 s) compound 606

More information

Antimicrobials & Resistance

Antimicrobials & Resistance Antimicrobials & Resistance History 1908, Paul Ehrlich - Arsenic compound Arsphenamine 1929, Alexander Fleming - Discovery of Penicillin 1935, Gerhard Domag - Discovery of the red dye Prontosil (sulfonamide)

More information

ESCHERICHIA COLI RESISTANCE AND GUT MICROBIOTA PROFILE IN PIGS RAISED WITH DIFFERENT ANTIMICROBIAL ADMINISTRATION IN FEED

ESCHERICHIA COLI RESISTANCE AND GUT MICROBIOTA PROFILE IN PIGS RAISED WITH DIFFERENT ANTIMICROBIAL ADMINISTRATION IN FEED ESCHERICHIA COLI RESISTANCE AND GUT MICROBIOTA PROFILE IN PIGS RAISED WITH DIFFERENT ANTIMICROBIAL ADMINISTRATION IN FEED Caroline Pissetti 1, Jalusa Deon Kich 2, Heather K. Allen 3, Claudia Navarrete

More information

Medically Important Antibiotics in Animal Agriculture

Medically Important Antibiotics in Animal Agriculture Medically Important Antibiotics in Animal Agriculture Craig Lewis, DVM MPH Office of the Director Center for Veterinary Medicine Farm Foundation Antimicrobial Stewardship Workshop Davis, California October,

More information

Avoiding residues and an FDA Inspection

Avoiding residues and an FDA Inspection Avoiding residues and an FDA Inspection James D. McKean, DVM, JD Extension Veterinarian Associate Director, Iowa Pork Industry Center Iowa State University x2mckean@iastate.edu USDA FSIS Residue Testing

More information

Antibacterial therapy 1. د. حامد الزعبي Dr Hamed Al-Zoubi

Antibacterial therapy 1. د. حامد الزعبي Dr Hamed Al-Zoubi Antibacterial therapy 1 د. حامد الزعبي Dr Hamed Al-Zoubi ILOs Principles and terms Different categories of antibiotics Spectrum of activity and mechanism of action Resistancs Antibacterial therapy What

More information

Dr. Amy Pruden, Ph.D. W. Thomas Rice Professor Department of Civil and Environmental Engineering. Global Change Center Virginia Tech

Dr. Amy Pruden, Ph.D. W. Thomas Rice Professor Department of Civil and Environmental Engineering. Global Change Center Virginia Tech March 15, 2018 Dr. Jennifer McQuiston, DVM, MS, (CAPT, USPHS) Deputy Director of the Division of High Consequence Pathogens and Pathology National Center for Emerging and Zoonotic Infectious Diseases Centers

More information

Policy Brief and Recommendations #4 Misuse of Antibiotics in Food Animal Production. Antibiotic Misuse in Food Animals Time for Change

Policy Brief and Recommendations #4 Misuse of Antibiotics in Food Animal Production. Antibiotic Misuse in Food Animals Time for Change Policy Brief and Recommendations #4 Misuse of Antibiotics in Food Animal Production Antibiotic Misuse in Food Animals Time for Change POLICY BRIEF AND RECOMMENDATIONS #4 MISUSE OF ANTIBIOTICS IN FOOD ANIMAL

More information

Antimicrobial Therapy

Antimicrobial Therapy Chapter 12 The Elements of Chemotherapy Topics - Antimicrobial Therapy - Selective Toxicity - Survey of Antimicrobial Drug - Microbial Drug Resistance - Drug and Host Interaction Antimicrobial Therapy

More information

Table 2 Structures and properties of the study compounds with full citations < (ectoparasiticide)

Table 2 Structures and properties of the study compounds with full citations < (ectoparasiticide) 1 Table 2 tructures and properties of the study compounds with full citations Compound CA Molecular Log Kow pka Log Koc 1 oil DT50 1 tructure weight (l/kg) (days) Amoxicillin 26787-78-0 365.4 0.87 2 2.8,

More information

IN VIVO TRANSFER OF ANTIBIOTIC RESISTANCE GENES BETWEEN THE RESIDENT INTESTINAL MICROFLORA OF BROILER CHICKENS AND SALMONELLA TYPHIMURIUM

IN VIVO TRANSFER OF ANTIBIOTIC RESISTANCE GENES BETWEEN THE RESIDENT INTESTINAL MICROFLORA OF BROILER CHICKENS AND SALMONELLA TYPHIMURIUM IN VIVO TRANSFER OF ANTIBIOTIC RESISTANCE GENES BETWEEN THE RESIDENT INTESTINAL MICROFLORA OF BROILER CHICKENS AND SALMONELLA TYPHIMURIUM by TAMEKA NICOLE BUFFINGTON (Under the Direction of John Maurer)

More information

EurEau s Contribution to the European Commission s Strategic Approach on Veterinary Pharmaceuticals in the Environment

EurEau s Contribution to the European Commission s Strategic Approach on Veterinary Pharmaceuticals in the Environment EurEau s Contribution to the European Commission s Strategic Approach on Veterinary Pharmaceuticals in the Environment Summary Globally, pharmaceutical products are regularly administered to both livestock

More information

Examining antibiotic resistance in the feedlot cattle industry using real-time, quantitative PCR (qpcr) and enterococci as an indicator bacterium

Examining antibiotic resistance in the feedlot cattle industry using real-time, quantitative PCR (qpcr) and enterococci as an indicator bacterium Examining antibiotic resistance in the feedlot cattle industry using real-time, quantitative PCR (qpcr) and enterococci as an indicator bacterium Alicia Grace Beukers A thesis submitted in fulfilment of

More information

Isolation and molecular identification of Moraxella ovis and Moraxella spp. from IKC in sheep in India

Isolation and molecular identification of Moraxella ovis and Moraxella spp. from IKC in sheep in India Isolation and molecular identification of Moraxella ovis and Moraxella spp. from IKC in sheep in India R K Vaid*, T Anand, B C Bera, B N Shukla, D K Nagar, Gagandeep Singh, N Virmani, S Barua, B K Singh

More information

Abundance of Antibiotic Resistance Genes in Feces Following Prophylactic and. Therapeutic Intramammary Antibiotic Infusion in Dairy Cattle

Abundance of Antibiotic Resistance Genes in Feces Following Prophylactic and. Therapeutic Intramammary Antibiotic Infusion in Dairy Cattle Abundance of Antibiotic Resistance Genes in Feces Following Prophylactic and Therapeutic Intramammary Antibiotic Infusion in Dairy Cattle Brittany Faith Willing Thesis submitted to the faculty of the Virginia

More information

SUMMARY OF PRODUCT CHARACTERISTICS. Vetmulin 450 mg/g granules for use in drinking water for pigs. (All MS except FR)

SUMMARY OF PRODUCT CHARACTERISTICS. Vetmulin 450 mg/g granules for use in drinking water for pigs. (All MS except FR) SUMMARY OF PRODUCT CHARACTERISTICS 1. NAME OF THE VETERINARY MEDICINAL PRODUCT Vetmulin 450 mg/g granules for use in drinking water for pigs. (All MS except FR) Vetmulin 364 mg/g granules for use in drinking

More information

The effects of ceftiofur and chlortetracycline treatment on antibiotic resistant Salmonella populations in feedlot cattle

The effects of ceftiofur and chlortetracycline treatment on antibiotic resistant Salmonella populations in feedlot cattle The effects of ceftiofur and chlortetracycline treatment on antibiotic resistant Salmonella populations in feedlot cattle Naomi Ohta Department of Veterinary Pathobiology, College of Veterinary Medicine

More information

Animal Antibiotic Use and Public Health

Animal Antibiotic Use and Public Health A data table from Nov 2017 Animal Antibiotic Use and Public Health The selected studies below were excerpted from Pew s peer-reviewed 2017 article Antimicrobial Drug Use in Food-Producing Animals and Associated

More information

Veterinary Feed Directive

Veterinary Feed Directive Veterinary Feed Directive Medically Important Antibiotics in Animal Agriculture Outline Questions to Be Addressed What changes are being made and why? What drugs are affected, which ones are not? What

More information

مادة االدوية المرحلة الثالثة م. غدير حاتم محمد

مادة االدوية المرحلة الثالثة م. غدير حاتم محمد م. مادة االدوية المرحلة الثالثة م. غدير حاتم محمد 2017-2016 ANTIMICROBIAL DRUGS Antimicrobial drugs Lecture 1 Antimicrobial Drugs Chemotherapy: The use of drugs to treat a disease. Antimicrobial drugs:

More information

Antibiotic resistance of bacteria along the food chain: A global challenge for food safety

Antibiotic resistance of bacteria along the food chain: A global challenge for food safety GREASE Annual Scientific Seminar. NIVR, 17-18th March 2014. Hanoi-Vietnam Antibiotic resistance of bacteria along the food chain: A global challenge for food safety Samira SARTER CIRAD-UMR Qualisud Le

More information

AMR risk assessment project

AMR risk assessment project AMR risk assessment project Project team: Colorado State University - Keith Belk & Paul Morley Kansas State University - Mike Apley & Katie Hope University of Nebraska-Lincoln - Bing Wang & Sapna Chitlapilly

More information

Nova Journal of Medical and Biological Sciences Page: 1

Nova Journal of Medical and Biological Sciences Page: 1 Nova Explore Publications Nova Journal of Medical and Biological Sciences Vol. 3(1), 2014:1-5 PII: S2292793X1400003-3 www.novaexplore.com Multidrug resistance of Enterobacter Aerogenes isolated from bovine

More information

Antibiotic and Disinfectant Resistant Bacteria in Rivers of the United States

Antibiotic and Disinfectant Resistant Bacteria in Rivers of the United States Abstract Antibiotic and Disinfectant Resistant Bacteria in Rivers of the United States Ronald J. Ash and Jamey L. Iverson Department of Biology, Washburn University,Topeka, KS We examined natural water

More information

Origins of Resistance and Resistance Transfer: Food-Producing Animals.

Origins of Resistance and Resistance Transfer: Food-Producing Animals. Origins of Resistance and Resistance Transfer: Food-Producing Animals. Chris Teale, AHVLA. Origins of Resistance. Mutation Brachyspira hyodysenteriae and macrolide and pleuromutilin resistance. Campylobacter

More information

Antimicrobial use in poultry: Emerging public health problem

Antimicrobial use in poultry: Emerging public health problem Antimicrobial use in poultry: Emerging public health problem Eric S. Mitema, BVM, MS, PhD CPD- Diagnosis and Treatment of Poultry Diseases FVM, CAVS, 6 th. August, 2014 AMR cont Antibiotics - Natural or

More information

Chemical Residue Testing and the Role of Proficiency Testing Material at the Centre for Veterinary Drug Residues

Chemical Residue Testing and the Role of Proficiency Testing Material at the Centre for Veterinary Drug Residues 2014/SCSC/WKSP2/003 Session: 5.1 Chemical Residue Testing and the Role of Proficiency Testing Material at the Centre for Veterinary Drug Residues Submitted by: Canada Food Safety Cooperation Forum Partnership

More information

DISSERTATION THE EPIDEMIOLOGY AND ECOLOGY OF ANTIMICROBIAL USE AND RESISTANCE IN NORTH AMERICAN BEEF PRODUCTION SYSTEMS.

DISSERTATION THE EPIDEMIOLOGY AND ECOLOGY OF ANTIMICROBIAL USE AND RESISTANCE IN NORTH AMERICAN BEEF PRODUCTION SYSTEMS. DISSERTATION THE EPIDEMIOLOGY AND ECOLOGY OF ANTIMICROBIAL USE AND RESISTANCE IN NORTH AMERICAN BEEF PRODUCTION SYSTEMS Submitted by Noelle Robertson Noyes Department of Clinical Sciences In partial fulfillment

More information

Impact of Antimicrobial Usage on Antimicrobial Resistance in Commensal Escherichia coli Strains Colonizing Broiler Chickens

Impact of Antimicrobial Usage on Antimicrobial Resistance in Commensal Escherichia coli Strains Colonizing Broiler Chickens APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Mar. 2007, p. 1404 1414 Vol. 73, No. 5 0099-2240/07/$08.00 0 doi:10.1128/aem.01193-06 Copyright 2007, American Society for Microbiology. All Rights Reserved. Impact

More information

Received 15 May 2007/Accepted 14 August 2007

Received 15 May 2007/Accepted 14 August 2007 APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Oct. 2007, p. 6566 6576 Vol. 73, No. 20 0099-2240/07/$08.00 0 doi:10.1128/aem.01086-07 Impact of Feed Supplementation with Antimicrobial Agents on Growth Performance

More information

Occurrence of Pharmaceuticals, Hormones, and Organic Wastewater Compounds in Pennsylvania Waters

Occurrence of Pharmaceuticals, Hormones, and Organic Wastewater Compounds in Pennsylvania Waters Occurrence of Pharmaceuticals, Hormones, and Organic Wastewater Compounds in Pennsylvania Waters U.S. Geological Survey Scientific Investigations Report 2012-5106 Background Pharmaceuticals, Hormones,

More information

Methods development to detect antibiotic activity in water samples

Methods development to detect antibiotic activity in water samples Methods development to detect antibiotic activity in water samples Stefan Kools (Grontmij AquaSense) Marta Wilgosz (Grontmij AquaSense, WUR) Evertjan van de Brandhof (RIVM) Gerard Stroomberg (Waterdienst)

More information

OUR BAY AND RIVERS ON DRUGS pharmaceuticals and illicit drugs as agents of ecological change

OUR BAY AND RIVERS ON DRUGS pharmaceuticals and illicit drugs as agents of ecological change OUR BAY AND RIVERS ON DRUGS pharmaceuticals and illicit drugs as agents of ecological change Emma J. Rosi, Senior Scientist and Director Baltimore Ecosystem Study LTER Baltimore Ecosystem Study Pharmaceuticals

More information

ANTIMICROBIAL USAGE IN AQUACULTURE

ANTIMICROBIAL USAGE IN AQUACULTURE FMM/RAS/298: Strengthening capacities, policies and national action plans on prudent and responsible use of antimicrobials in fisheries ANTIMICROBIAL USAGE IN AQUACULTURE Review of AMU in aquaculture based

More information

Protect your trees in the ground: What s new on the antimicrobial front?

Protect your trees in the ground: What s new on the antimicrobial front? June 12-14, 2013 Ninth Annual Florida Citrus Industry Annual Conference Protect your trees in the ground: What s new on the antimicrobial front? Hyatt Regency Coconut Point, Bonita Springs June 12-14,

More information

Impact of pharmaceuticals discharges on the receiving environment: a two years monitoring results

Impact of pharmaceuticals discharges on the receiving environment: a two years monitoring results Impact of pharmaceuticals discharges on the receiving environment: a two years monitoring results www.isa-lyon.fr TRACES Group Technology and Research in Analytical Chemistry for Environment, health and

More information

Approach to pediatric Antibiotics

Approach to pediatric Antibiotics Approach to pediatric Antibiotics Gassem Gohal FAAP FRCPC Assistant professor of Pediatrics objectives To be familiar with common pediatric antibiotics o Classification o Action o Adverse effect To discus

More information

ANTIBIOTIC SENSITIVITY PATTERN OF YERSINIA ENTEROCOLITICA ISOLATED FROM MILK AND DAIRY PRODUCTS*

ANTIBIOTIC SENSITIVITY PATTERN OF YERSINIA ENTEROCOLITICA ISOLATED FROM MILK AND DAIRY PRODUCTS* Short Communication ANTIBIOTIC SENSITIVITY PATTERN OF YERSINIA ENTEROCOLITICA ISOLATED FROM MILK AND DAIRY PRODUCTS* T.R.Pugazhenthi 1, A. Elango 2, C. Naresh Kumar 3, B. Dhanalakshmi 4 and A. Bharathidhasan

More information

number Done by Corrected by Doctor Dr Hamed Al-Zoubi

number Done by Corrected by Doctor Dr Hamed Al-Zoubi number 8 Done by Corrected by Doctor Dr Hamed Al-Zoubi 25 10/10/2017 Antibacterial therapy 2 د. حامد الزعبي Dr Hamed Al-Zoubi Antibacterial therapy Figure 2/ Antibiotics target Inhibition of microbial

More information

Antibiotics and antibiotic resistance from animal manures to soil: a review

Antibiotics and antibiotic resistance from animal manures to soil: a review European Journal of Soil Science, January 2018, 69, 181 195 doi: 10.1111/ejss.12494 Special issue article Antibiotics and antibiotic resistance from animal manures to soil: a review W.-Y. Xie, Q. Shen

More information

Urban Water Security Research Alliance

Urban Water Security Research Alliance Urban Water Security Research Alliance Antibiotic Resistant Bacteria in Hospital Wastewaters and Sewage Treatment Plants Mohammad Katouli Hospital Wastewater Science Forum, 19-20 June 2012 Antibiotic resistance

More information

Pharmaceutical Compounds, Antibiotics, Hormones, and Wastewater Compounds in Pennsylvania Waters

Pharmaceutical Compounds, Antibiotics, Hormones, and Wastewater Compounds in Pennsylvania Waters Pharmaceutical Compounds, Antibiotics, Hormones, and Wastewater Compounds in Pennsylvania Waters Kent Crawford U.S. Geological Survey Pennsylvania Water Science Center PaDEP Emerging Contaminant Forum

More information

Antimicrobial agents

Antimicrobial agents Bacteriology Antimicrobial agents Learning Outcomes: At the end of this lecture, the students should be able to: Identify mechanisms of action of antimicrobial Drugs Know and understand key concepts about

More information

PCR detection of Leptospira in. stray cat and

PCR detection of Leptospira in. stray cat and PCR detection of Leptospira in 1 Department of Pathology, School of Veterinary Medicine, Islamic Azad University, Shahrekord Branch, Shahrekord, Iran 2 Department of Microbiology, School of Veterinary

More information