International Cat Care - Practice Members
|
|
- Morris Gaines
- 6 years ago
- Views:
Transcription
1 International Cat Care - Practice Members Practice Name Cat Friendly Award Website City Country AdelaideVet - Trinity Gardens Gold Adelaide Australia AdelaideVet - Goodwood Road Silver Adelaide Australia Foothills Animal Hospital Silver Armadale Australia Eastwood Veterinary Clinic Ballarat Mail Centre Australia Bedford-Dianella Vet Centre Bedford Australia Canberra Cat Vet Gold Belconnen Australia Belgrave South Vet Belgrave South Australia Belmont Veterinary Centre - Belmont Gold Belmont Australia Bentleigh Veterinary Clinic Bentleigh Australia Rivapetz Pet Care Silver Berri Australia Brunswick Central Veterinary Clinic Silver Brunswick East Australia Pet Wellness Centre Gold Burleigh Heads Australia Valentine Charlton Cat Centre, University of Sydney Gold cilities/valentine.shtml Camperdown Australia Carlton Vet Clinic Carlton North Australia Cheltenham Veterinary Clinic Cheltenham Australia Collaroy Plateau Veterinary Clinic Collaroy Plateau Australia Greencross Vets - Hyde Park Gold Currajong Australia Vetwest Currambine Currambine Australia Companion Animal Veterinary Hospital Gold Dapto Australia Balwyn Veterinary Surgery Deepdene Australia Toowoomba Family Vets East Toowoomba Australia Essendon Vet Clinic Essendon Australia Melbourne Cat Vets Fitzroy Australia National Vet Care Group - Australia - HQ Fitzroy North Australia Fitzroy Veterinary Clinic Silver Fitzroy North Australia Gawler Animal Hospital Gold Gawler South Australia Midwest Veterinary Centre Gold Geraldton Australia Selwood House Veterinary Hospital Hazelbrook Australia Highton Veterinary Clinic Highton Australia The Cat Clinic - Hobart Silver Hobart Australia Kippax Veterinary Hospital Gold Holt Australia Greencross Kedron Veterinary Hospital Gold Location.aspx Kedron Australia Canberra Veterinary Hospital Lyneham Australia St Bernard's Road Veterinary Clinic Silver Magill Australia Pet Universe Veterinary Centre Gold Manningham Australia Mansfield Veterinary Clinic Mansfield Australia Veterinary Referral Hospital Melbourne Australia Pet Medical - Muswellbrook Silver Muswellbrook Australia 4 Paws Veterinary Clinic Silver Neutral Bay Australia Cats Protection Society of NSW Inc Newtown Australia North Hobart Veterinary Hospital Gold North Hobart Australia Lort Smith Animal Hospital North Melbourne Australia Small Animal Specialist Hospital Gold North Ryde, Australia Paddington Cat Hospital Paddington Australia Maroubra Veterinary Hospital Pagewood Australia East Fremantle Veterinary Clinic Gold Perth Australia Swanbourne Veterinary Centre Perth Australia Vogue Vets Perth Australia Port Kennedy Veterinary Hospital Silver Port Kennedy Australia Prahran Toorak Veterinary Hospital Gold Prahran East Australia Veterinary Happiness - Redland Bay Silver Redland Bay Australia Swan Street Veterinary and Wellness Centre Gold Richmond Australia Dr Kim Kendall Cat Vet Roseville Australia Doubleview Veterinary Centre Gold Scarborough Australia Pet Medical - Scone Silver Scone Australia Concord Veterinary Hospital Silver Sydney Australia Potts Point Veterinary Hospital Gold Sydney Australia Boehringer Ingelheim - Australia Sydney Australia Greencross Vets Ku-Ring-Gai Gold Sydney Australia Eastside Veterinary Emergency and Specialists Sydney Australia Torquay Animal House Veterinary Clinic & Hospital torquayvets.com.au Torquay Australia Hammett Street Veterinary Surgery Townsville Australia Tropical Qld Cat Clinic Gold Townsville City Australia Treendale Pet Medical Treendale Australia AdelaideVet - Support Centre HQ Trinity Gardens Australia Veterinary Specialist Services PTY Ltd Gold Underwood Australia Patterson River Veterinary Centre Silver Victoria Australia Manningham Veterinary Hospital Silver Victoria Australia International Cat Care - Practice Members Published 23/10/2017 1
2 Dr Paws Wangaratta Wangaratta Australia Drovers Vet Hospital Pty Ltd Silver Wanneroo Australia Weston Creek Veterinary Hospital Waramanga Australia Warwick Vet Hospital Warwick Australia University of Melbourne - U Vet Gold Werribee Australia Wyndham Veterinary Clinic Werribee Australia Perth Cat Hospital Gold West Leederville Australia Sugarloaf Animal Hospital Gold West Wallsend Australia Gawler Veterinary Services gawlervet.com.au Willaston Australia Double Bay Veterinary Clinic Wollahra Australia Perth Veterinary Specialists Bronze Australia KUFvets Tieraerzte Gold Kufstein Austria Fachtierarzt Leonding Leonding Austria Tierklinik Wien Süd Niederösterreich Austria Katzenpraxis Dr Garzik & Dr Hoyer OG Gold Wien Austria Dr Nonie Coutts Veterinary Surgery Adliya Bahrain Cabinet Vétérinaire de Fumal Fumal Belgium Dierenartsenpraktijk De Linde Herk-De-Stad Belgium AnimaLier Koningshooikt Belgium Entre Chats et Moi Silver Liege Belgium Dap Sirius Mechelen Belgium Dierenartsenpraktijk Clos Fleuri Silver Merelbeke Belgium De Dommel Waasmunster Belgium Waldemar Tavares Machado Neto Ipanema Brazil Gatos & Só Mosela Brazil Naja Lecheng Animal Hospital Beijing China Mei Lian Zhong He Ai Mao Animal Hospital Gold Beijing China West China Animal Hospital Gold Chengdu China West China Animal Hospital - WuHou Branch Gold Chengdu China Mingwang Banlv Animal Hospital Gold Chongqing China Meilianzhonghe Veterinary Hospital Silver Cross Hexi District China Puppy Town Animal Hospital Gold Guangdong China Bastet Exclusively Cats Veterinary Hospital Gold Guangzhou China Blessing Veterinary Hospital Gold Guangzhou China CBL Pet Hospital Gold Kunming City China Mianyang Youhao Animal Hospital Gold Mianyang China Nangjing Kate Pet Clinic Gold Nangjing City China Yang Yang Animal Hospital Silver Nanning China Fuhua Cat Hospital Shenzhen China Lian He Pet Clinic Shenzhen China Jiaheng Feline Hospital Shijiazhuang China Pet Friend Animal Hospital Gold Sichuan China Puppy Town Animal Hospital of Xi'an Branch Silver http// Xi'An China Yubei Mingwang Animal Hospital Gold Yubei District China Pet Elements Animal Hospital Yuen Long Hog Kong China Veterinární Klinika AlfaVet Silver Frýdek-Místek Czech Republic Veterinarni Centrum Viva Silver Hradec Králové Czech Republic Veterinární klinika Na Weilovně Silver Příbram Czech Republic Bygholm Dyrehospital Silver 8700 Horsens Denmark Aalborg Dyrehospital A/S Aalborg Sv Denmark Abyhoj Dyreklinik Åbyhøj Denmark Husum Dyreklinik Broenshoej Denmark Katteklinikken Kattens Værn Bronze Brøndby Denmark AniCura Københavns Dyrehospital Gold Copenhagen Denmark Centrum Dyreklinik Copenhagen Copenhagen V Denmark Strib Dyreklinik Silver Fyn Denmark Katdoktor Gandrup Denmark Haderslev Dyrehospital Haderslev Denmark Herning Dyrehospital Herning Denmark Dyrlaegehuset Kolding Silver Kolding Denmark Nordkystens Dyrehospital Nordsjaelland Denmark Nyborg Dyrehospital ApS Silver Nyborg Denmark Anicura Rosengårdcenterets Dyreklinik Silver Odense Sø Denmark Rynkeby Dyreklinik Gold Rynkeby Denmark Dyrehospitalet Sønderborg Silver Sønderborg Denmark DyrlægeRingen, Tommerup Dyreklinik Bronze Tommerup Denmark Falkland Island Government Veterinary Service Stanley Falkland Islands Alfapet Eläinlääkärit Espoo Finland CatVet Kissaklinikka Oy Silver Helsinki Finland Omaeläinklinikka Helsinki 4k%C3%A4riasemat/helsinki/ Helsinki Finland Eläinlääkäriasema Taikatassu Bronze Klaukkala Finland Loviisan Elainklinikka Lovet Loviisa Finland Elainklinikka Hakametsa Silver Tampere Finland Elainlaakarinasema Helmi Oy Tetvakoski Finland Euromedivet Oy Tornio Finland Koira-Kisssaklinikka - Dog-Cat Clinic Ltd Gold Turku Finland Omaeläinklinikka Turku Keskusta Turku Finland International Cat Care - Practice Members Published 23/10/2017 2
3 Clinique Mazetier Argenteuil France Clinique Vétérinaire de la Cigogne Barbezieuz France Clinique Vétérinaire Sainte Croix Chateaugiron France Cabinet Veterinaire Carnegie Fargniers France Clinique Veterinaire Baltzer Le Pouliguen France Vétérinaires Entrechats Lyon France Proxivet Mondeville France Clinique Vétérinaire Du Corum Silver Montpellier France Monchatetmoi Silver Orvault France Clinique vétérinaire de la Pierre Bleue Pipriac France Clinique Veterinaire du Toulon Silver Privas France Clinique Veterinaire Seinevet Place Cauchoise p Rouen France Clinique du Boulingrin Silver Rouen France Vetodefamille Saint Bonnet De Mure France Clinique Vétérinaire des Faluns Saint Gregoire France Clinique Veterinaire Cite Des Arts Silver Vence France Tierarztpraxen im Chiemgau Amerang Germany Tierarztpraxis Michael Knietsch Baden-Wurttemberg Germany Tieraerztliche Praxis am Muehlburger Tor Baden-Württemberg Germany Neko Tiergesundheit Berlin Germany Vets for Cats Berlin Germany Tierarztpraxis in Delbrück Delbruck Germany Dr. Marietta Bartels Duesseldorf Germany Beyer Katja Dr Kleintierpraxis katzenvet.de Dusseldorf Germany Kleintierpraxis am Muehlendamm Gold wwwtierklinik-elmshorn.de Elmshorn Germany Tierarzt Volz Eschborn Germany Tierärztliche Praxis Marcus Sand Fürth Germany Tierklinik Neandertal GbR Dr. Hess/Dr. Engelhardt Silver Haan Germany Kleintierpraxis Urte Elvers Hanover Germany Kleintierklinik am Landratsamt Heilbronn Germany Tierklinik Hofheim Gold Hofheim Germany Tierklinik Kaufungen Silver Kaufungen Germany Tierklinik Hanauerland Kehl Germany Tierklinik Kempten Kempten Germany VetSpezial TGZ Ahlten Lehrte Germany Kleintierklinik Lüdinghausen Gold Lüdinghausen Germany Tierarztpraxis Alte Feuerwache Silver Mülheim Germany Tierarztpraxis Reiners Nordrhein Germany Tierklinik am Nordring Evidensia Nürnberg GmbH Nuernberg Germany Tierklinik Oberhaching PartG Gold Oberhaching Germany Tierarztpraxis Dr. Tanja Frey Rosenheim Germany Tierklinik Rostock Gold Rostock Germany Tierarztpraxis Schwed Schmelz Germany Praxis 7 Leben Schriesheim Germany Dachswald-Klinik Stuttgart Germany Gemeinschaftspraxis Dr. Mechthilde Einwald-Ernst und Dr. Theresa Ernst Stuttgart Germany Kleintierpraxis Obenstrohe Varel Germany Tierarztpraxis Wetter Wetter Germany Dres. Kremendahl & Bewerunge Tierärzte GmbH Gold Wuppertal Germany Tierarztpraxis in Karlshorst Germany Animal Medical Center EE - Athens Silver Athens Greece Happy Valley Veterinary Clinic Gold Happy Valley Hong Kong Victory Animal Hospital Bronze Ho Man Tin Hong Kong ivet Animal Clinic Hung Hom Hong Kong Hung Hom Veterinary Clinic http// Hung Hom Hong Kong Kowloon Cat Hospital Kowloon Hong Kong Sai Kung Animal Hospital Sai Kung Hong Kong Tai Hang Veterinary Clinic Tai Hang Hong Kong Pet Cares Professional Veterinary Services Gold Tai Po Hong Kong Shatin Animal Hospital Tai Wai Hong Kong Phoenix Animal Clinic Wanchai Hong Kong Hong Kong Vet Services Ltd - HQ Wanchai Hong Kong Wanchai Animal Hospital Wanchai Hong Kong Casula Veterinary Hospital Gold Yuen Long Hong Kong SAA Veterinary Centre Yuen Long Hong Kong Dora Urban Person Budapest Hungary PDHB drh. Cucu K. Sajuthi, dkk Jakarta Indonesia My Vets Animal Clinic Jakarta Selatan Indonesia Skinvet Ltd hello@skinvet.ie Adare Ireland Briarhill Veterinary Clinic Ballybrit Ireland Just Cats Veterinary Clinic - Dublin Gold Dublin 15 Ireland DSPCA Veterinary Hospital Dublin 16 Ireland The Cat Hospital - Cork Gold Glanmire Ireland Carton Veterinary Clinic Maynooth Ireland International Cat Care - Practice Members Published 23/10/2017 3
4 Cottage Veterinary Clinic Newbridge Ireland O'Shea and Bramley Veterinary Hospital Wexford Ireland CatVet Sharon Regev s Cats Only Hospital Silver Rama Gan Israel Centro Medico Veterinario BMVet Silver buonomestoveterinaribari.blogspot.it Bari Italy PetLife Clinica Veterinaria Basiglio Gold Basiglio Italy Ospedale Veterinario Santa Fara Gold Bis Italy Vetclinic Dott. G Moser Dott. S Kirchier Silver Bolzano Italy Clinica Veterinaria Citta' Di Codogno Silver Codogno Italy Clinica Veterinaria Zenit Gold Endine Gaiano - Bg Italy L'Ospedale Degli Animali Gold Ferrara Italy Clinica Veterinaria ANUBIS Gold Milan Italy Clinica Veterinaria Cusago Silver http// Milano Italy Clinica Veterinaria Borghesiana Roma Italy Ambulatorio Veterinario"f.bonsi" Santarcangelo Di Romagna Italy Clinica Veterinaria San Giovanni Silver giovanna.fiorillo@clinicasangiovanni.it Snc Alife Italy Ambulatorio Casale Dr.Remo Gold Torino Italy Clinica Veterinaria Bemavet Silver Torre Boldone Italy Clinica Veterinaria Dr. Borgarello Gold Turin Italy Belmo Animal Clinic Adachi Ward Japan Shimizu Animal Hospital Gold Aguicyo Japan Aniwel Dog & Cat Clinic Gold Aich Japan Chosa Stella Veterinary Hospital Gold Aira-Shi, Japan Ama Animal Hospital Silver Ama Japan Apple Tree Animal Hospital Anjyo Japan Midori no mori Animal Hospital Group Kyokushin Center Hospital Gold Asahikawa Japan Asakadai Animal Medical Center Gold Asaka-City Japan Marl Animal Clinic Ashiya Japan Next Animal Medical Center Asiya City Japan Makuhari Beans Pet Clinic Chiba Japan Mimura Animal Hospital Silver Chiba City Midori-Ku Japan Kururi Animal Hospital Nitona Chibashi Chuoku Japan Bastet Cat Clinic Gold Chikusa Japan Nanasumi Animal Clinic http//nanasumi.sakura.ne.jp Chuou Japan Link Pet Clinic Silver Ebina Japan Animal Clinic ist Silver Ebina Japan Fuchu William Animal Clinic Gold Fuchu Japan Sakura Animal Hospital Gold Fujimino Japan Alice Animal Hospital Silver Fujisawa Japan Kan Animal Hospital Fujisawa Japan Mana Animal Hospital Fujisawa-Shi Japan Kurumi Animal Hospital Silver Fukuoka Japan Fukuoka Neko No Byouin Silver Fukuoka-Shi Japan Minato Ohori Animal Hospital Silver Fukuokacity Japan Aso Animal Hospital Silver Fukuyama Japan Animal Medical Center Aloha Gold Fukuyama Japan You Animal Hospital Gold Gotembashi Japan Hello Animal Hospital Gold Gunma Japan Minami Osawa Animal Hospital Gold Hachioji Japan Mikan Animal Hospital Hadano Japan Tachikawa Animal Hospital Hadano Japan Kamijima Animal Hospital Gold Hamamatsu-Shi Japan Yagura Animal Hospital Gold Hashimoto-Shi Japan Yamamoto Animal Hospital Hirakata-Shi Japan Gori Veterinary Clinic Hirosaki Japan Maru Pet Clinic Hiroshima Japan Yotsuba Animal Hospital Silver Hiroshima-Shi Japan Nozomino Animal Hospital Silver Hokkaido Japan Nekonobyouin Silver Hokkkaido Japan Tsukuba Gakuen Pet Clinic Ibaraki Japan Kasugaoka Animal Hospital Gold Ibaraki Japan Ibaraki Motomachi Animal Hospital Ibaraki Japan AC Plaza Kariya Animal Hospital - Ichikawabasi Hospital Ichikawa Japan Family Animal Hospital Inage-Ku,Chiba Japan Inuyama Westside Veterinary Clinic Gold Inuyama Japan Sagami Chyuou Veterinary Medical Centre Gold Isehara-Shi Japan Inaniwa Animal Clinic Isesaki Japan Marble Veterinary Medical Center Gold Kanagawa Japan Hayama Animal Hospital Gold Kanagawa Japan SEISHO Animal Hospital Kanagawa Japan Kannai Animal Clinic Gold Kanagawa Japan Suzuki Animal Hospital Gold Kanuma-Shi Japan Athena Animal Clinic LaLa Garden Kasukabe Gold Kasukabe(-Shi) Japan Knight Veterinary Clinic Kawachinagano-Shi Japan Mei Animal Hospital Kawasaki City Japan Torea Animal Hospital Gold Kawasaki-Shi Japan Ozenji Pet Clinic Gold Kawasaki-Shi Japan Kurata Animal Hospital Kawasaki-Si Japan International Cat Care - Practice Members Published 23/10/2017 4
5 Hatazawa Animal Hospital Kisarazu Japan Lapaz Animal Hospital Kitahiroshima Japan Chelsea Veterinary Clinic Kobe Japan Kirin Animal Hospital Silver Kobe Japan Hamada Animal Hospital Gold Kochi Japan Musashikoganei Cat Clinic Gold Koganei-City Japan Koshigaya Veterinary Clinic Silver Koshigaya Japan Animal Hospital - Kyoto Gold Kyoto Japan Okatuni Animal Hospital Gold Kyoto Japan Therapist Animal Hospital Gold Machida Japan Tokyo Cat Specialists Minato-Ku Japan Yu Animal Clinic Silver Misato Japan MITO Animal Hospital Silver Mito Japan Okaniwa Animal Group - Japan - HQ Gold Mito Japan Okaniwa Animal Clinic - Mito Mito Japan Sagara Doubts Byouin Gold Miyakonojyou Japan SETON ANIMAL HOSPITAL Gold Nagaoka Japan Terakdo Animal Hospital Gold Nagoya Japan Mizuho Animal Hospital Gold Nagoya Japan Kasa Animal Hospital Nagoya Japan Tsutsujigaoka Animal Clinic Nagoya Japan Moriyama Animal Hospital Gold Nagoya-City Japan Shikatani Animal Hospital Naka-Ku Hamamatu-Shi Japan Hamamatsu Animal Hospital Nakaku Japan Coconiiru Animal Hospital Gold Nakano Japan Kibou-no-oka Animal Clinic Silver Nanao Japan Hayashi Animal Hospital Gold Narita-Shi Japan Take Pet Clinic Niigata-Shi Japan Mukogawa Animal Hospital Nishinomiya-Shi Japan Daktari Animal Hospital Kyouto Medical Centre Gold Nisikyoku Japan Adachi Animal Hospital Odawara Japan Yasaka Animal Care Center Okayamasi Kitaku Japan Mori Animal Hospital Gold Omihachiman City Japan Kuwahara Animal Hospital Silver Osaka Japan Lark Animal Hospital Gold Osaka Japan Yuunagi Animal Hospital Gold Osaka Japan Queue Animal Hospital Osaka Japan Shirokita Koen-Dori Animal Hospital Osaka Japan Kawashima Animal Hospital Silver Osaka Japan Fukatsu Animal Hospital Gold Osaka Japan Ao Animai Hospital Gold Osaka Yodogawa-Ku Japan Izumi Animal Hospital Silver Osaka-Fu Japan Mew Animal Hospital Gold Osaka-Shi Japan Amu Animal Hospital Silver Sagamihara Japan Sagamihara Cat Clinic Gold Sagamihara Japan Mizuhodai Animal Hospital Silver Saitama Japan Pia Animal Hospital Gold Saitama Japan Animal Clinic Next Gold Saitama Japan Dolphin Animal Hospital Saitama City Japan Misono Animal Hospital Saitama City Japan Aozoraveterinary Clinic Sakushi Japan Sena Animai Hospital Sakyoukukyoutoshi Japan Minamigaoka Animal Hospital Bronze Sanda-Shi Japan Hirota Animal Hospital Silver Sapporo Japan MAU Pet Clinic Silver Sapporo-Shi Japan Garden Animal Hospital - Hokkaido Gold Sapporo-Shi Japan Sendai Animal Medical Center Gold Sendai Japan Yoshiike Veterinary Hospital Setagayaku Japan Allieys Animal Hospital Gold Shibuya Japan Watanabe Animal Hospital Shimada-Shi Japan Momo Cat Clinic Gold Shinagawa-Ku Japan Suruga Animal Hospital Shizuoka Japan Iruka Animal Hospital Silver Shizuoka-Shi Japan Shiranaga Animal Hospital Shunan Japan Animal Hospital Umitosora Gold Suginami Japan Tokyo Animal Medical Center Suriname-Ku Japan Yotsuya Animal Hospital Takaoka Japan Sawamura Veterinary Hospital Gold Togane Japan Igusa Animal Hospital Silver Tokyo Japan Higasahiyama Animal Hospital Silver Tokyo Japan Kimura Animal Hospital Gold Tokyo Japan Sugawara Veterinary Clinic Tokyo Japan Minato Animal Hospital Tokyo Japan Akasaka Animal Hospital Gold Tokyo Japan Tanaka Pet Clinic Tokyo Japan Hanegi Animal Hospital Tokyo Japan Panda Animal Clinic Tokyo Japan Nanairo Animal Hospital Silver Tokyo Japan International Cat Care - Practice Members Published 23/10/2017 5
6 Azabu-Juban Dog & Cat Clinic Tokyo Japan Ikebukuro Heartone Animal Hospital Tokyo Japan Daktari Animal Hospital Shinagawa Wellness Center Tokyo Japan Tokyo-West Animal Hospital/Eye Care Centre Gold Tokyo Japan AC Plaza Kariya Animal Hospital - Mitsumedori Hospital Tokyo Japan AC Plaza Kariya Animal Hospital - Meijidori Hospital Tokyo Japan AC Plaza Kariya Animal Hospital - Nikkokaido Hospital Tokyo Japan AC Plaza Kariya Animal Hospital - Kasaibashidori Hospital Tokyo Japan Fennel Animal Hospital Sasazuka Tokyo Japan Japan Animal Medical Center Gold Tokyo Japan Takei Animal Clinic Tokyo Japan Kougo Animal Hospital Gold Tokyo Japan Maeda Veterinary Hospital Gold Tomakomai Japan Ryukyu Animal Medical Center Silver Tomigusuku Japan Kitasato University Veterinary Teaching Hospital Towada-City Japan NOAH Animal Hospital Gold Toyonaka Japan Oguri Pet Clinic Tsurumi-Ku Japan Kobayashi Animal Hospital Silver Warabishi Japan NOAH Veterinary Clinic Gold Yamanashi Japan Family Animal Hospital Takahashi Animal Hospital Gold Yamato Japan Ohisama Animal Hospital Gold Yao-Shi Japan Petclinic Clover Yashio Japan Kusano Animal Hospital Yashio-Shi Japan Okuyama Animal Clinic Silver Yashiyo Japan Izumi Dog and Cat Clinic Silver Yokohama Japan DVMs Animal Medical Center Gold Yokohama Japan Kato Veterinary Clinic Yokohama Japan Youkoudai Pet Clinic Silver Yokohama Japan West Animal Hospital Gold Yokohama Japan Nishishiba Animal Hospital Gold Yokohama Japan Yokohama Cat Clinic Silver Yokohama Japan Marutsuka Doubutubyouin Silver Yokohama-Shi Japan Shirasagi Animal Hospital Japan Little Brother's Hospital Rīga Latvia VetClnic 24h Ampandrianomby Madagascar Vets for Pets Solaris Mont Kiara Bronze Kuala Lumpur Malaysia Jawhari Cat Medical Centre Pahang Malaysia Petcare Veterinary Clinic Wilayah Persekutuan Kuala Malaysia Animal Aid Veterinary Clinic Msida Malta Ocicat Clínica Felina Guadalajara Mexico Dierenkliniek Buiten-Mere Gold Almere Netherlands Dierenkliniek Rijnoever Silver Alphen Aan Den Rijn Netherlands Sterkliniek Alphen aan den Rijn Gold Alphen Aan Den Rijn Netherlands Het Dierenpunt Amsterdam Netherlands Dierenkliniek Vondelpark Silver Amsterdam Netherlands Kattenkliniek Amsterdam Amsterdam Netherlands Dierenkliniek Rivierenbuurt Amsterdam Netherlands Dierenartsenpraktijk Deurze-Smilde-Assen Bronze http// Assen Netherlands Spoed & Verwijskliniek Barendrecht Netherlands Dierenkliniek Bloemendaal Bloemendaal Netherlands Dierenartsenpraktijk Breukelen Gold Breukelen Ut Netherlands De Kattenpraktijk Gold Capelle Aan Den Ijssel Netherlands Dierenkliniek Maaspoort Dan Bosch Netherlands Anicura Diergeneeskundig Verwijscentrum Dordrecht Gold Dordrecht Netherlands Dierenartspraktijk 't Holland Silver Duiven Netherlands Dierenkliniek Dennenoord Gold Duizel Netherlands Dierenkliniek Hoogveld Gold Echt Netherlands Dierenkliniek Enschede Gold Enschede Netherlands Dier Medisch Centrum Hof van Twente Silver Goor Netherlands DAC Gorredijk Silver Gorredijk Netherlands De Kattenkliniek van Groningen Gold Groningen Netherlands Dierenkliniek Marnixstraat Gold Haarlem Netherlands Dierenzierkenhuis Haarlem Silver Haarlem Netherlands Diergezondheidscentrum De Limes Gold Harmelen Netherlands Dierenkliniek Hattem Silver Hattem Netherlands Dierenkliniek Parkstad Dierenzorg Heerlen Netherlands Sterkliniek Dierenartsen Hillegom/Nieuw-Vennep Silver Hillegom Netherlands Veterinair Centrum Honselersdijk Netherlands Elke Dierenarts Leeuwarden Silver Leeuwarden Netherlands DAP Horst Silver Limburg Netherlands Dierenkliniek Lochem EO Lochem Netherlands Dierenartsenpraktijk Maarssen Maarssen Netherlands Dierenartsenpraktijk West-Betuwe Meteren Netherlands Dier en Dokter Silver Mierlo Netherlands Dierenkliniek De Arker Gold Nijkerk Netherlands Dierenkliniek de Waalsprong Silver Nijmegen Netherlands Dierenkliniek Sint Anna 404 Bronze Nijmegen Netherlands Dierenkliniek Schaijk Gold Noord Brabant Netherlands International Cat Care - Practice Members Published 23/10/2017 6
7 Dierenkliniek Dommelen Gold Noord-Brabant Netherlands Dierenkliniek Nuland Silver Nuland Netherlands DGC Nunspeet Gold Nunspeet Netherlands DGC Nunspeet Gold Nunspeet Netherlands Dierenziekenhuis Oldenzaal Gold Oldenzaal Netherlands Dierenarts Aan de Amstel Ouderkerk Aan De Amstel Netherlands Dap de Dorskamp Silver Renkum Netherlands Dierenkliniek Ridderkerk B.V. Ridderkerk Netherlands Dierenkliniek Riethoven Gold Riethoven Netherlands Gezelschapsdierenkliniek Roosendaal Silver Roosendaal Netherlands Dierenkliniek Zuiderkaag Schagen Netherlands Kattenkliniek Felicare Gold Soest Netherlands Dierenkliniek de Woldberg Silver Steenwijk Netherlands Anicura Dierenziekenhuis Zeeuws-Vlaanderen Terneuzen Netherlands Dierenkliniek Wilhelminapark Utrecht Netherlands Dierendokters Utrecht Utrecht Netherlands Dierenkliniek Veenendaal Gold Veenendaal Netherlands Dierenkliniek Vianen Gold Vianen Netherlands DAP Kindermans Vlaardingen Netherlands Dierenkliniek Van Montfoort Voorburg Netherlands Dierenkliniek Kortenoord Gold Wageningen Netherlands DGC Twente Gold Wierden Netherlands Diergeneeskundig Centrum Winterswijk Silver Winterswijk Netherlands Dierenkliniek Axel Silver Zeeland Netherlands Dierenkliniek Wateringse Veld (Sterkliniek Dierenartsen Den Haag) Silver Zuid Holland Netherlands Dierenartsenpraktijk Zuidhorn Silver Zuidhorn Netherlands Dierenartsenpraktijk Barendrecht Silver Zutphen Netherlands Kattenkliniek van Zwolle Zwolle Netherlands Ellerslie Veterinary Clinic & Cattery Gold Auckland New Zealand Onewa Road Veterinary Hospital Gold Auckland New Zealand Forrest Hill Veterinary Clinic Silver Auckland New Zealand East Coast Bays Vet Clinic Browns Bay New Zealand At The Vets Christchurch New Zealand Humanimals Silver Dunedin New Zealand Manukau After Hours Veterinary Clinic Silver Manuku New Zealand Millwater Veterinary Hospital Silver Millwater New Zealand Franklin Vets - Pukekohe Pukekohe New Zealand VetEnt Queenstown Queenstown New Zealand Rangiora Veterinary Centre Gold Rangiora New Zealand 3 Stone Veterinary Services Ltd info@3stonevets.co.nz Te Awamutu New Zealand Central Vet Hospital Wellington New Zealand Tasman Street Vet Centre Wellington New Zealand Mill Road Vet Clinic Whangarei New Zealand Kjæledeggen Dyreklinikk AS Gold Ålesund Norway Anicura Dyreklinikk Grimstad Grimstad Norway Hønefoss Dyrehospital Gold Hønefoss Norway AniCura Kongsvinger Veterinaerklinikk - HQ Gold Kongsvinger Norway AniCura Kongsvinger Veterinaerklinikk - HQ Gold Kongsvinger Norway Mo Dyreklinikk Gold Mo I Rana Norway Kalbakken Dyreklinikk Silver Oslo Norway Anicura Dyreklinikk Ekeberg Silver Oslo Norway Anicura Dyresykehuset Bergen Sor Gold Rådal Norway Anicura Rising Dyreklinikk Gold Skien Norway AniCura Dyresykehus Stavenger Stavanger Norway Przychodnia Weterynaryjna Nasza Silver Krakow Poland Klinika Weterynaryjna Arka Gold Malopolska Poland Vetalmada Almada Portugal Clinica Veterinaria Canham Almancil Portugal CVMI Clinica Veterinaria de Medicina Integrada De Carcavelos Carcavelos Portugal HOSPITAL VETERINÁRIO MURALHA DE ÉVORA Silver Évora Portugal Hospital Veterinário Arco do Cego Silver Lisboa Portugal Hospital Veterinario do Restelo Gold Lisboa Portugal Hospital Veterinario De Loule Loule Portugal Hospital Veterinario da Marinha Grande Silver Marinha Grande Portugal Clinica Veterinária do Shopping, L.da Silver Marinha Grande Portugal MyVet Centro Veterinário - Advancevet Medicina Veterinária Lda Oeiras Portugal Zoosaúde Serviços Veterinários Penela Portugal Clínica Dos Gatos Gold Porto Portugal Clínica Veterinária Dr Carlos Paulos LDA Silver Porto Portugal O MEU VET - Clinica Veterinaria Res/Chao Dto Portugal Vetgilao Silver Tavira Portugal Torres Pet Torres Novas Portugal Mount Pleasant Veterinary Centre Singapore Singapore AMK Veterinary Surgery (2009) Pte Ltd Singapore Singapore Amber Veterinary Practice Pte Gold Singapore Singapore The Cat Clinic - Singapore Silver Singapore Singapore International Cat Care - Practice Members Published 23/10/2017 7
8 Sibra Centrum Gold Bratislava Slovakia Veterinarna Klinika Zverland Piestany Slovakia Veterina MH Silver Ljubljana Slovenia FM AMC Gold Goyang-Si South Korea 24h Onnuri Animal Medical Center Gold Ansan-Si South Korea Animal is My Friend Hospital Silver Ansan-Si South Korea 24hr Maumdeunduen Animal Hospital Gold Anyang-Si South Korea Yi Hyang Choi Anyang-Si South Korea Nel Animal Medical Center Silver Anyang-Si South Korea Asan Animal Mecial Center Gold Asan-Si South Korea Dasom Feline Medical Center Gold Busan South Korea Centrum Animal Medical Center Busan South Korea Now Animal Medical Center Gold Cheonan-Si South Korea Korea Animal Medical Centre Gold Cheung-Ju South Korea Cheongju I Animal Hospital Chungcheongbuk-Do South Korea Daegu Animal Medical Center Daegu South Korea Soo Hyang Lee Dalseo-Gu South Korea Baeksan Cat only hospital Gold Gangnam-Gu South Korea Glory Vet Clinic Geumcheon-Gu South Korea Classic Animal Medical Center Goyang South Korea Yewon Kim Guri-Si South Korea Bitgoeul Animal Medical Center Gold Gwang-Ju South Korea Gong Gam Animal Hospital Gwangju South Korea Barun-amc Gold Gwangju South Korea Kim Min Gyeonggi-Do South Korea Oullim Animal Hospital Silver Gyeonsangbuk-Do South Korea CNP Animal Hospital Silver Haeundae-Gu South Korea Misa Animal Hospital Silver Hanam-Si South Korea Misa Forest Aminal Medical Center Hanam-Si South Korea MonPyeonHan Animal Clinic Silver Jeonju South Korea Well Animal Hospital Jeonju-Si South Korea Kwon O-Serng Jungang-Ro South Korea LK Animal Medical Center Silver Junggogae-Ro Cheongju-Si South Korea Woori Animal Medical Centre Silver http// Keumcheon-Gu South Korea Mycatclinic Silver Nam-Gu South Korea Ik Hyun Sung Paju-Si South Korea Medipet Veterinary Hospital Seocho-Gu South Korea VIP Animal Medical Center Gold Seongbuk-Gu South Korea Kirin Veterinary Clinic Silver Seongdong South Korea Bundang L Animal Medical Center Gold Seongnam South Korea Dr Lee Jin Soo Animal Hospital Gold Seongnam-Si South Korea Great Animal Hospital Seongnam-Si South Korea Seguero Cat Clinic Silver Seoul South Korea CH Animal Clinic Seoul South Korea Evichi Animal Dental Clinic Seoul South Korea Dream Cat Clinic Gold Seoul South Korea Gyeongin Animal Medical Center Gold Seoul South Korea SNC Animal Medical Center Gold Seoul South Korea Liebe Animal Medical Center Seoul South Korea Jiman Yoon Person Seoul South Korea Mate Animal Hospital Gold Seoul South Korea Seoul Top Animal Hospital Silver Seoul South Korea Royal Animal Medical Center Gold Seoul South Korea Bomnal Animal Medical Center Silver Vision Dong South Korea Shinsegae Animal Medical Centre Gold Yangsan City South Korea Yong Gang Animal Hospital Silver South Korea Centro Veterinario Galápago 121 Granada Spain Animal House Centro Veterinario Albacete Spain Clinica Veterinaria Colon Albacete Spain Ervet Urgencias Veterinarias Alcorcon Spain Clinica Veterinaria Campo de Gibraltar Algeciras Spain Centro Veterinario La Villa Asturias Spain Centre Veterinari de Cornella Silver Barcelona Spain Neomi Estrela Person Barcelona Spain Hospital Veterinari Glòries Silver Barcelona Spain Clinica Veterinaria del Mar Silver Barcelona Spain Clinica Veterinaria Parque Central Benetuser Spain BRIS Clinica Veterinaria - Albaitari Klinika Silver Bilbao (Bizkaia) Spain Clínica Veterinaria Fociños Silver Bueu Spain Clinica Veterinaria La Granja Gold Burjassot Spain Vetamic Veterinaris Cambrils Spain Alfa Veterinaria Castelló De La Plana Spain Centro Veterinario Trivet Cuenca Spain Clinica Veterinaria Somaza-Perez Silver Ferrol Spain Pilar Galdakao Spain Tartanga Hospital Clinica Veterinaria Getxo Spain Hospital Veterinario Nacho Menes Gold Gijon Spain Clínica Veterinaria Escaleritas Silver Las Palmas Spain International Cat Care - Practice Members Published 23/10/2017 8
9 Albea Veterinarios SL Gold Las Palmas De Gran Canaria Spain Clinica Veterinaria Nova Albeiteria Leon Spain Hospital Veterinario Ciudad de Lugo Gold Lugo Spain Hospital Felino Ventas Gold Madrid Spain Clínica Veterinaria Quevedog Madrid Spain Hospital Veterinario Fuente El Saz Gold Madrid Spain Clinica Veterinario El Perro Verde Gold Madrid SPAIN Gattos Centro Clinico Felino Madrid Spain Clinica Veterinaria Bichos Ourense Spain Onlycats Oviedo Spain ARAGÓ HOSPITAL VETERINARI Gold Palma De Mallorca Spain Mascotas Palma De Mallorca Spain CalviaVet Silver Santa Ponsa Spain Clínica Veterinaria - Santander Bronze Santander Spain Kato Clinica Felina Sevilla Spain Clinica Veterinaria Amics Soller Soller Spain Hospital Veterinario Cruz de Piedra Gold Tenerife Spain Centro Veterinario Teruel Teruel Spain Clínica Veterinaria Sevilla Silver Torreperogil Spain Centro Veterinario Vetnatura Gold Valencia Spain Clínica Veterinaria Ars Canis Silver Vigo Spain Clinica Veterinaria Coso Zaragoza Spain AV Veterinarios Silver Zaragoza Spain Clínica Veterinaria Albéitar Zaragoza Spain Clínica Veterinaria Artemisa Zaragoza Spain Arvidsjaur Djurklinik AB Arvidsjaur Sweden Anicura Djursjukhuset Albano Silver Danderyd Sweden Blå Stjärnans Djursjukhus Gold Göteborg Sweden Evidensia Djursjukhuset Göteborg Göteborg Sweden Mälarhöjdens Veterinärpraktik Silver Hägersten Sweden Anivet Djurklinik Haninge Sweden Smådjurskliniken Din Veterinär Helsingborg Sweden Halsinge Smådjursklinik Silver Hudiksvall Sweden Citykattens Veterinärklinik Jönköping Sweden Evidensia Djursjukhuset Karlstad Gold Karlstad Sweden Kattens Veterinar i Karlinge AB Kävlinge Sweden Evidensia Södra Djursjukhuset Gold Kungens Kurva Sweden Ljungby Smådjursklinik AB Silver Ljungby Sweden Mölnlycke Djurklinik Mölnlycke Sweden Roslagens Smådjursklinik Gold Norrtälje Sweden Djurkliniken Anima Örebro Sweden Östersunds Djursjukhus Gold Östersund Sweden Sollentuna Djurklinik Gold Sollentuna Sweden Specialistdjursjukhuset Strömsholm Gold Stromsholm Sweden Djursjukhuset Sundsvall Gold Sundsvall Sweden Djursjukhuset Sundsvall - HQ Sundsvall Sweden Torslanda Djurklinik Torslanda Sweden Veterinargruppen I Tygelsjo http// Tygelsjo Sweden University Veterinary Hospital Gold Uppsala Sweden Vallentuna Djurklinik Vallentuna Sweden ReDog Veterinärklinik och Hundrehabilitering Västerås Sweden Bohusläns Smådjursklinik Gold Västra Sweden Vaxtorps Djurklinik Vaxtorp Sweden Smådjurskliniken i Knivsta Silver Sweden Tiergesundheitszentrum Am Blauen AG Silver Laufen Switzerland Kleintierpraxis Pfotenwohl Zürich Switzerland - The Cat Clinic /?locale2=zh_TW Da-An District Taiwan Jong-Shing Animal Hospital Kaohsiung Taiwan In-Shin Small Animal Clinic Kaohsiung Taiwan Jia Ching Animal Clinic Gold Songshan District Taiwan Sheng-Li Cat Hospital Silver Tainan City Taiwan Duma Animal Hospital Gold Taipei City Taiwan WeCare Animal Medical Center Taoyuan Taiwan Jinn Kuo Person Taoyuan City 330, Taiwan Chao Fah Andaman Pet Hospital (CFA) Gold Chalong Phuket Thailand Kasetsart University Veterinary Teaching Hospital Gold Jatujak Thailand Cat Hospital Hayvan Hastanesi Ankara Turkey Abu Dhabi Falcon Hospital Pet Care Center Gold Abu Dhabi United Arab Emirates Umm Suqeim Veterinary Centre Gold Dubai United Arab Emirates British Veterinary Hospital Jumeira 3 United Arab Emirates German Veterinary Clinic Gold Khalifa City A United Arab Emirates Ashgrove Veterinary Centre Ltd Aberdeen United Kingdom The Bridge Vet Clinic - Bridge of Don Aberdeen United Kingdom Ardene House Vet Practice Ltd Aberdeen United Kingdom Vets4Pets - Aberdeen Gold Aberdeen United Kingdom Boundary Veterinary Centre Silver Abingdon United Kingdom Vets4Pets - Abingdon Silver Abingdon United Kingdom International Cat Care - Practice Members Published 23/10/2017 9
10 Vets4Pets - Accrington Silver Accrington United Kingdom Willett House Vets Silver Addlestone United Kingdom Vets4Pets - Airdrie Airdrie United Kingdom Alfreton Park Veterinary Hospital Silver Alfreton United Kingdom Pennard Vets - Allington Allington United Kingdom Alsager Veterinary Centre Silver Alsager United Kingdom Cedar Veterinary Group - Alton Surgery Silver Alton United Kingdom Lumbry Park Veterinary Specialists Gold Alton United Kingdom Vets4Pets - Alton Alton United Kingdom Vets4Pets - Altrincham Altrincham United Kingdom The Wheelhouse Veterinary Group - Amersham Amersham United Kingdom Vets4Pets - Amesbury Silver Amesbury United Kingdom Anton Veterinary Clinic Gold Andover United Kingdom Strathmore Veterinary Clinic Gold Andover United Kingdom Companion Care Veterinary Surgery - Andover Silver Andover United Kingdom Vets4Pets - Andover Andover United Kingdom Pets 1st - Chobham Road Vet Centre Ascot United Kingdom Blenheim Veterinary Centre Ashbourne United Kingdom Cinque Ports Veterinary Group - Kingsnorth Gold Ashford United Kingdom Companion Care Veterinary Surgery - Ashford Ashford United Kingdom Ashtead Vets Ashtead United Kingdom The Vet - Ashton Ashton-Under-Lyne United Kingdom Oakfield Veterinary Group - Atherstone Atherstone United Kingdom Paul Jarman Veterinary Practice Ltd - Attleborough Attleborough United Kingdom Coombefield Veterinary Hospital Axminster United Kingdom Wendover Heights Veterinary Centre Aylesbury United Kingdom Hampden Veterinary Hospital Aylesbury United Kingdom Companion Care Veterinary Surgery - Aylesbury Aylesbury United Kingdom Vets4Pets - Ayr Ayr United Kingdom Moorview Vets Backworth United Kingdom Vets4Pets - Bagshot Bagshot United Kingdom Balby Veterinary Practice Silver Balby United Kingdom Fenaghy Veterinary Clinic - Ballymena Ballymena United Kingdom Vets4Pets - Ballymena Ballymena United Kingdom Hawthorne Lodge Veterinary Practice Ltd Silver Banbury United Kingdom Hook Norton Veterinary Group Silver Banbury United Kingdom West Bar Veterinary Hospital Banbury United Kingdom Vets4Pets - Banbury Banbury United Kingdom Cedarmount Veterinary Clinic Silver Bangor United Kingdom Glenn Veterinary Clinic Bangor United Kingdom Vets4Pets - Bangor - North Wales Bangor United Kingdom Vets4Pets - Bangor Bangor United Kingdom Priory Veterinary Surgeons - Banstead - North Surrey Cat Clinic Bronze Banstead United Kingdom Kriek and Gibson Veterinary Surgery Banstead United Kingdom Banstead Village Veterinary Surgery Silver Banstead United Kingdom Goddard Veterinary Group - Barking Barking United Kingdom Wood Street Veterinary Hospital Gold Barnet United Kingdom Vets4Pets - Barnsley Barnsley United Kingdom Vets4Pets - Barnsley - Cortonwood Barnsley United Kingdom Charter Veterinary Hospital Group - Barnstaple Silver Barnstaple United Kingdom Market Veterinary Centre - HQ Barnstaple United Kingdom Market Veterinary Centre - Barnstaple Silver Barnstaple United Kingdom Alexander Veterinary Centre Ltd Silver Barrow-In-Furness United Kingdom Grove Veterinary Centre Ltd Silver Barrow-In-Furness United Kingdom Vets4Pets - Barry Barry United Kingdom Boness Veterinary Enterprises Ltd Silver Barton-Le-Clay United Kingdom Boness Veterinary Enterprises Ltd Silver Barton-Le-Clay United Kingdom Companion Care Veterinary Surgery - Basildon Basildon United Kingdom Companion Care Veterinary Surgery - Basildon - Pipps Hill Basildon United Kingdom GP Vets Ltd - Basingstoke Basingstoke United Kingdom Companion Care Veterinary Surgery - Basingstoke Basingstoke United Kingdom Vets4Pets - Bath Bath United Kingdom Independent Vetcare Ltd - HQ Bath United Kingdom Senlac Veterinary Centre Battle United Kingdom Straid Veterinary Clinic Beaconsfield United Kingdom Three Rivers Veterinary Group Beccles United Kingdom Acorn House Veterinary Hospital Gold Bedford United Kingdom Scott Veterinary Clinic Bedford United Kingdom Companion Care Veterinary Surgery - Bedford Silver Bedford United Kingdom Vets4Pets - Bedford Bedford United Kingdom Vets4Pets - Bedlington Bedlington United Kingdom Vets4Pets - Bedminster Bedminster United Kingdom Feldon Veterinary Centre - Bedworth Silver Bedworth United Kingdom Feldon Veterinary Centre - Bedworth Silver Bedworth United Kingdom Vets4Pets - Chilwell Gold Beeston United Kingdom Earlswood Veterinary Referrals Ltd Belfast United Kingdom International Cat Care - Practice Members Published 23/10/
Chart showing the average height of males and females in various world countries.
Chart showing the average height of males and females in various world countries. Country/Region Average male height Average female height Sampled Age Range Albania 174.0 cm (5 ft 8 1/2 in) 161.8 cm (5
More informationAppendix F: The Test-Curriculum Matching Analysis
Appendix F: The Test-Curriculum Matching Analysis TIMSS went to great lengths to ensure that comparisons of student achievement across countries would be as fair and equitable as possible. The TIMSS 2015
More informationAppendix F. The Test-Curriculum Matching Analysis Mathematics TIMSS 2011 INTERNATIONAL RESULTS IN MATHEMATICS APPENDIX F 465
Appendix F The Test-Curriculum Matching Analysis Mathematics TIMSS 2011 INTERNATIONAL RESULTS IN MATHEMATICS APPENDIX F 465 TIMSS went to great lengths to ensure that comparisons of student achievement
More informationThis document is available on the English-language website of the Banque de France
JANUARY 7 This document is available on the English-language website of the www.banque-france.fr Countries ISO code Date of entry into the euro area Fixed euro conversion rates France FR //999.97 Germany
More informationIntroduction ICAO PKD Higher Travel Security. ICAO TRIP Seminar 9 to 11th May 2016
Introduction ICAO PKD Higher Travel Security ICAO TRIP Seminar 9 to 11th May 2016 Who is Veridos? Joint venture heritage Veridos is the only company in its markets solely focused on serving government
More informationList of successful participants: EGFR analysis
EGFR analysis Laboratory of Pathology ASZ Ziekenhuis Aalst Aalst Belgium Biocartis R&D Assay Development Biocartis Mechelen Belgium MC Transhelix MC Transhelix Sofia Bulgaria Eastern Ontario Regional Laboratory
More informationEuropean poultry industry trends
European poultry industry trends November 5 th 2014, County Monaghan Dr. Aline Veauthier & Prof. Dr. H.-W. Windhorst (WING, University of Vechta) 1 Agenda The European Chicken Meat Market - The global
More informationAnnex 2 Climate Projections for ARC3.2 Cities
Annex 2 Climate Projections for ARC3.2 Cities Presented here are climate projections for the ARC3-2 cities. ARC3.2 Cities include Case Study Docking Station cities, UCCRN Regional Hub cities, UCCRN project
More informationEssayOnDeclawingCatsForStudents
EssayOnDeclawingCatsForStudents In the 1960s many people in America started keeping their cats strictly indoors because the world outside was becoming more dangerous. The only problem was that cats need
More informationEAEVE FVE Survey on the European Veterinary Faculties Curriculum. Laboratory Animal Medicine in European Veterinary Faculties Curriculum
EAEVE FVE Survey on the European Veterinary Faculties Curriculum 63 feedbacks by 25.02.2014 UPDATED incl. FVM & FVHE Brno Laboratory Animal Medicine in European Veterinary Faculties Curriculum 1. Is Laboratory
More informationRULES & REGULATIONS EUKANUBA WORLD CHALLENGE 2019 Birmingham March 7th
RULES & REGULATIONS EUKANUBA WORLD CHALLENGE 2019 Birmingham March 7th 1. About the event The Eukanuba World Challenge ( EWC ) is a dog competition taking place once a year. The event has been designed
More informationA web-based interactive tool to explore antibiotic resistance and consumption via maps and charts
http://resistancemap.cddep.org A web-based interactive tool to explore antibiotic resistance and consumption via maps and charts CDDEP first developed ResistanceMap in 21. The new ResistanceMap now includes
More informationProf. Otto Cars. We are overconsuming a global resource. It is a collective responsibility by governments, supranational organisatons
What are the consequences of rising antibiotic resistance for Sweden? Prof. Otto Cars Chairman The Swedish Strategic programme against antibiotic resistance (Strama) We are overconsuming a global resource
More informationSpecial Timetable of Lufthansa German Airlines for 20APR10 Sonderflugplan der Deutschen Lufthansa für 20APR10
Special Timetable of Lufthansa German Airlines for 20APR10 Sonderflugplan der Deutschen Lufthansa für 20APR10 All flights listed here are most likely to be operated - short time cancellations might still
More informationEU Health Priorities. Jurate Svarcaite Secretary General PGEU
EU Health Priorities Jurate Svarcaite Secretary General PGEU Members: Professional Bodies & Pharmacists Associations 2016: 33 Countries Austria Belgium Bulgaria Croatia Cyprus Czech Rep Denmark Estonia
More informationThe Pet Travel Scheme (PETS) Advice to veterinary surgeons in GB: ferrets
Introduction The Pet Travel Scheme (PETS) Advice to veterinary surgeons in GB: ferrets October 2005 European Regulation 998/2003 took effect on 3 July 2004. It sets out the rules for pet animals travelling
More informationThe challenge of growing resistance
EXECUTIVE SUMMARY Around 2.4 million people could die in Europe, North America and Australia between 2015-2050 due to superbug infections unless more is done to stem antibiotic resistance. However, three
More informationAntibiotic resistance: the rise of the superbugs
Antibiotic resistance: the rise of the superbugs Allen Cheng Associate Professor of Infectious Diseases Epidemiology, Alfred Health; Monash University About me Specialist in infectious diseases Head, Infection
More informationFood & Veterinary Office
EUROPEAN COMMISSION HEALTH & CONSUMER PROTECTION DIRECTORATE-GENERAL Directorate F - Food and Veterinary Office DG(SANCO)D(2005)660066 Food & Veterinary Office Programme of Inspections 2005 July - December
More informationGlobal Monthly October 2016
Jan- Feb- Mar- Apr- May- Jun- Jul- Aug- Sep- Global Monthly Index, >5 = expansion 5 Output Export orders 5 9 http://www.worldbank.org/en/research/brief/economic-monitoring Sept ' Dec '5 Sept ' Sept ' Dec
More informationAnimal Law in Europe Progress and Challenges. Prof. Dr. Marita Giménez-Candela Master in Animal Law and Society Director
Animal Law in Europe Progress and Challenges Prof. Dr. Marita Giménez-Candela Master in Animal Law and Society Director TREATY OF LISBON (TFEU), Art. 13 In formulating and implementing the Union s agriculture,
More information2014 Bags, Cases & Boxes
2014 Bags, Cases & Boxes 2015.08. Catalog 1. 2014 China Bags, Cases & Boxes Industry Export Analysis... 3 1.1. China Bags, Cases & Boxes Exported Goods, from Jan. to Dec. 2014... 4 1.2. China Bags, Cases
More informationOfficial Journal of the European Union (2004/118/EC)
L 36/34 EN 7.2.2004 COMMISSION DECISION of 28 January 2004 amending Decisions 95/233/EC, 96/482/EC, and 2001/751/EC relating to the importation of live poultry and hatching eggs and live ratites and hatching
More informationMRSA in the United Kingdom status quo and future developments
MRSA in the United Kingdom status quo and future developments Dietrich Mack Chair of Medical Microbiology and Infectious Diseases The School of Medicine - University of Wales Swansea P R I F Y S G O L
More informationDr René A. Carlson President, World Veterinary Association. The Current and Future Role of the WVA in Continuing Education for Veterinarians
Dr René A. Carlson President, World Veterinary Association The Current and Future Role of the WVA in Continuing Education for Veterinarians CONTENT Introduction of the World Veterinary Association WVA
More informationMinisterial decision No. 348 of the year 2008 in relation to the health requirements for importing animal of companionship (Pets Animals) to the UAE
Ministerial decision No. 348 of the year 2008 in relation to the health requirements for importing animal of companionship (Pets Animals) to the UAE Minister for Environment and Water After studying the
More informationSummary of the latest data on antibiotic consumption in the European Union
Summary of the latest data on antibiotic consumption in the European Union November 2012 Highlights on antibiotic consumption Antibiotic use is one of the main factors responsible for the development and
More informationPew forum on religion & public life
90 Religious Restriction Index Scores by Region Scores in the table below express the levels of religious restrictions according to the Pew Forum s Government Restrictions Index (GRI) and Social Hostilities
More informationAppendix C: Religious restrictions index scores by region
51 Appendix C: Religious restrictions index scores by region Scores in the table below express the levels of religious restrictions according to Pew Research Center s Government Restrictions Index (GRI)
More informationICCA Asia Pacific Chapter Meeting
ICCA Asia Pacific Chapter Meeting No 22011 Hall 1, Level +1 Congress Center Leipzig Germany congressiccamobi Twitter: #ICCA11 1 Welcome Remarks Martin Winter Chairman ICCA Asia Pacific Chapter congressiccamobi
More informationImport Restrictions for Passengers
January 2008 Plants Import from the EU Member States A passenger is allowed to import small quantities of plants, parts thereof, and other plant products such as fruit, vegetables, and seeds for personal
More informationSummary of the latest data on antibiotic consumption in the European Union
Summary of the latest data on antibiotic consumption in the European Union ESAC-Net surveillance data November 2016 Provision of reliable and comparable national antimicrobial consumption data is a prerequisite
More informationSTATE OF THE GLOBAL PET FOOD RETAIL
STATE OF THE GLOBAL PET FOOD RETAIL CURRENT TRENDS AND GROWTH OPPORTUNITIES PFAC, VANCOUVER, NOVEMBER 8, 2012 GLOBAL UPDATE ON PET CARE: GROWTH IN 2012 AND BEYOND 2 FASTEST GROWING PRODUCT CATEGORIES AND
More informationConsumption of antibiotics in hospitals. Antimicrobial stewardship.
Consumption of antibiotics in hospitals. Antimicrobial stewardship. Inge C. Gyssens MD PhD Radboud university medical center, Nijmegen, The Netherlands Hasselt University, Belgium 1. Antibiotic use in
More informationMarine Mammal Protection Act Import Rule. Office of International Affairs and Seafood Inspection [IASI]
Marine Mammal Protection Act Import Rule Office of International Affairs and Seafood Inspection [IASI] Implementing Import Provisions Under the MMPA Driving Factors for U.S. Action Objectives Recognized
More informationWHO laboratory-based global survey on multidrug-resistant organisms (MDROs) in health care interim analysis
WHO laboratory-based global survey on multidrug-resistant organisms (MDROs) in health care interim analysis Aim: to estimate the burden of MDROs isolated among inpatients in a wide range of health-care
More informationEuropean trends in animal welfare policies and research and their potential implications for US Agriculture
European trends in animal welfare policies and research and their potential implications for US Agriculture Dr. Ed Pajor Associate Professor Director, Center for Animal Well-Being Department of Animal
More informationIMPORT HEALTH STANDARD FOR THE IMPORTATION INTO NEW ZEALAND OF RABBIT MEAT FOR HUMAN CONSUMPTION FROM THE EUROPEAN COMMUNITY
IMPORT HEALTH STANDARD FOR THE IMPORTATION INTO NEW ZEALAND OF RABBIT MEAT FOR HUMAN CONSUMPTION FROM THE EUROPEAN COMMUNITY ANNEX A ASSIGNED NUMBERS (AN): 4C.2, 4D.1, 5C.2, 5D.1, 6C.1, 6D.2, Issued pursuant
More informationAntimicrobial Resistance
Special Eurobarometer 338 Antimicrobial Resistance Fieldwork: November - December 2009 Publication: April 2010 Summary Eurobarometer 338/Wave 72.5 TNS Opinion & Social Survey commissioned by the Directorate-General
More informationFood & Veterinary Office
EUROPEAN COMMISSION HEALTH & CONSUMER PROTECTION DIRECTORATE-GENERAL Directorate F - Food and Veterinary Office DG(SANCO) F6(2004)D/660037 Food & Veterinary Office Programme of Inspections 2004 July -
More informationMINISTERIAL CONFERENCE ON AVIATION SECURITY AND FACILITATION IN AFRICA. WINDHOEK, NAMIBIA, 4-8 April 2016
MINISTERIAL CONFERENCE ON AVIATION SECURITY AND FACILITATION IN AFRICA WINDHOEK, NAMIBIA, 4-8 April 2016 Agenda item 1.6: Introduction to Public Key Directory (PKD) THE ICAO PUBLIC KEY DIRECTORY (PKD)
More informationThe evolutionary epidemiology of antibiotic resistance evolution
The evolutionary epidemiology of antibiotic resistance evolution François Blanquart, CNRS Stochastic Models for the Inference of Life Evolution CIRB Collège de France Quantitative Evolutionary Microbiology
More informationHealth Service Executive Parkgate St. Business Centre, Dublin 8 Tel:
Health Service Executive Parkgate St. Business Centre, Dublin 8 Tel: 01 635 2500 www.hse.ie Health Service Executive Oak House, Millennium Park, Naas, Co. Kildare Tel: 045 880 400 www.hse.ie The prevention
More informationWHO global and regional activities on AMR and collaboration with partner organisations
WHO global and regional activities on AMR and collaboration with partner organisations Dr Danilo Lo Fo Wong Programme Manager for Control of Antimicrobial Resistance Building the AMR momentum 2011 WHO/Europe
More informationThis document is a preview generated by EVS
EESTI STANDARD EVS-EN 1656:2000 Chemical disinfectants and antiseptics - Quantitative suspension test for the evaluation of bactericidal activity of chemical disinfectants and antiseptics used in veterinary
More informationCOUNTRY REPORTS ON AVIAN INFLUENZA FOR 2004 BASED ON RESPONSES TO THE QUESTIONNAIRE
COUNTRY REPORTS ON AVIAN INFLUENZA FOR 004 BASED ON RESPONSES TO THE QUESTIONNAIRE Dennis J. Alexander and Ruth J. Manvell Community Reference Laboratory for Avian Influenza Veterinary Laboratories Agency
More informationQuality of veterinary medicines
Quality of veterinary medicines Regional Seminar for OIE National Focal Points for Veterinary Products Tokyo, 2 March 2016 Dr. Yoshihiro Shimizu, DVM Executive Director, Asian Animal Health Association
More informationLAMPS CATALOGUE 2013 LAMPS CATALOGUE 2013
LAMPS CATALOGUE 213 LAMPS CATALOGUE 213 X ToLEDo Non-Directional LED X X X Hi-Spot RefLED RefLED LV SA111 RefLED 55Im AR111 X ToLEDo Hi-Pin / Pygmy X X Microlynx High Performance ToLEDo Tubes LED LED
More informationEU Market Situation for Eggs. Civil Dialogue Group. 17 February 2017
EU Market Situation for Eggs Civil Dialogue Group 17 February 217 Thousand Tons F O R E C A S T 8 7 Experts EU production forecast on Eggs (Missing or incomplete data (BE-EL-LT-AT-SE) - No expert (BG-EE-LV-MT-SK)
More informationAntimicrobial resistance (EARS-Net)
SURVEILLANCE REPORT Annual Epidemiological Report for 2014 Antimicrobial resistance (EARS-Net) Key facts Over the last four years (2011 to 2014), the percentages of Klebsiella pneumoniae resistant to fluoroquinolones,
More informationA Very Special Swan Cats
Presents in our Western Australian Region A Very Special Swan Cats A 3 ring Championship cat show. With three International Judges at the Guildford Town Hall James Street Guildford WA Sunday 22nd April
More informationWhat is the problem? Latest data on antibiotic resistance
European Antibiotic Awareness Day 2009 What is the problem? Latest data on antibiotic resistance Zsuzsanna Jakab, ECDC Director Launch Seminar for EAAD Stockholm, 18 November 2009 Fluoroquinolone-resistant
More informationPneumococcus: Antibiotic Resistance in the Region
Pneumococcus: Antibiotic Resistance in the Region Çiğdem Bal Kayacan Istanbul University Istanbul Faculty of Medicine Department of Microbiology & Clinical Microbiology Drug Resistance in S.pneumoniae
More informationThe Pet Travel Scheme (PETS) European Union countries - dogs and cats
2 nd April 2007 Fact sheet 3 The Pet Travel Scheme (PETS) European Union countries - dogs and cats This fact sheet replaces fact sheet 3 dated October 2005. European Regulation 998/2003 took effect on
More informationInternational Egg Market Annual Review
Artwork2010_Layout 1 25/08/2010 18:46 Page 2 International Egg Market Annual Review 10 A N A LY S I SONE Banning of cages in Germany and after First results of the largest economic field experiment in
More informationQuality. report Quality is always top of mind when meeting our patients KARIN KRISTRÖM, VETERINARIAN ANICURA DJURSJUKHUSET ALBANO, SWEDEN
Quality report 2017 Quality is always top of mind when meeting our patients KARIN KRISTRÖM, VETERINARIAN ANICURA DJURSJUKHUSET ALBANO, SWEDEN Through AniCura, we gained knowledge and support to improve
More informationOVERSEAS ACTIVITIES 28 RIKEN CORPORATION. From Left:
OVERSEAS ACTIVITIES!1 Isami Takahama, Director Overseas Operations Noritada Okano, Senior Managing Director Masahiro Sekimoto, GM Overseas Sales & Marketing!2 r u y t q e i w Junji Shirogane, Vice President
More informationTHE DEVELOPMENT OF A RISK BASED MEAT INSPECTION SYSTEM SANCO / 4403 / 2000
FEDERATION OF VETERINARIANS OF EUROPE FVE/01/034 Final THE DEVELOPMENT OF A RISK BASED MEAT INSPECTION SYSTEM SANCO / 4403 / 2000 Members FVE COMMENTS Austria Belgium Croatia Cyprus Czech Republic Denmark
More informationInternational Egg Market Annual Review
International Egg Market Annual Review 09 A N N U A L R E V I E W F O R T H E I N T E R N A T I O N A L E G G I N D U S T R Y 2 0 0 9 C O U N T R Y B Y C O U N T R Y D E T A I L E D S T A T I S T I C A
More informationHow do people obtain antibiotics in European countries: an overview
How do people obtain antibiotics in European countries: an overview Dominique L. Monnet, Programme Coordinator Senior Expert, Scientific Advice Unit & the National Antimicrobial Resistance Focal Points
More informationEuropean Medicines Agency role and experience on antimicrobial resistance
European Medicines Agency role and experience on antimicrobial resistance Regional Training Workshop on Antimicrobial Resistance (AMR) Responding to the global challenge of AMR threats: toward a one health
More informationAntimicrobial Resistance
Special Eurobarometer 338 "Antimicrobial Resistance Antimicrobial Resistance Fieldwork: November - December 2009 Publication: April 2010 Report Eurobarometer 338/Wave TNS Opinion & Social Survey commissioned
More informationUnited Kingdom Veterinary Medicines Directorate Woodham Lane New Haw Addlestone Surrey KT15 3LS DECENTRALISED PROCEDURE
United Kingdom Veterinary Medicines Directorate Woodham Lane New Haw Addlestone Surrey KT15 3LS DECENTRALISED PROCEDURE PUBLICLY AVAILABLE ASSESSMENT REPORT FOR A VETERINARY MEDICINAL PRODUCT (AT, BE,
More informationThe Animals in the Law
The Animals in the Law A Global Perspective update 2007 11th International Conference on Human-Animal Interactions Tokyo, 6th October 2007 Foundation for the Animal in the Law (Stiftung für das Tier im
More informationINDEPENDENT REVIEW OF DISPENSING
FEDERATION OF VETERINARIANS OF EUROPE FVE/00/050 INDEPENDENT REVIEW OF DISPENSING FVE CONTRIBUTION Members Austria Belgium Croatia Cyprus Czech Republic Denmark Estonia Finland France FYROM Germany Greece
More informationAn agency of the European Union
An agency of the European Union Human medicines in 23 Research and development 473 overall number of scientific advice and protocol assistance requests received in 23
More informationValeria Rickard (USA) Astrid Lundava (ES) Catrinel Pauna (RO)
Valeria Rickard (USA) Valeria's passion for dogs began during her youth in Europe where she started off in junior handling. There, she bred her first litter of Airedales - sired by her own champion male.
More informationSpecial Eurobarometer 478. Summary. Antimicrobial Resistance
Antimicrobial Resistance Survey requested by the European Commission, Directorate-General for Health and Food Safety and co-ordinated by the Directorate-General for Communication This document does not
More informationPunto di vista dell EFSA e raccolta dati Valentina Rizzi Unit on Biological Monitoring (BIOMO)
Committed since 2002 to ensuring that Europe s food is safe Punto di vista dell EFSA e raccolta dati Valentina Rizzi Unit on Biological Monitoring (BIOMO) Corso di formazione Gestione per il contenimento
More informationESCMID Online Lecture Library. by author
EUCAST and susceptibility testing Europe and beyond Gunnar Kahlmeter EUCAST, ESCMID Antimicrobial susceptibility testing To guide therapy and predict clinical outcome in individual patients (clinical breakpoints)
More informationSpecial Eurobarometer 445. Summary
Survey requested by the European Commission, Directorate-General for Health and Food Safety and co-ordinated by the Directorate-General for Communication This document does not represent the point of view
More informationSupplementary Table 1. Primers used in the study.
Supplementary Table 1. Primers used in the study. Primer Position (bp) Upstream primer (5 3 ) Downstream primer (5 3 ) Expected (bp) size 1 1 278 ACCAAACAGAGAATCTGTGAG CAGCAATCCGAAGGCAGAATAC 299 2 48 946
More informationFood & Veterinary Office
EUROPEAN COMMISSION HEALTH & CONSUMER PROTECTION DIRECTORATE-GENERAL Directorate F - Food and Veterinary Office DG(SANCO)/660108/2004 Food & Veterinary Office Programme of Inspections 2005 January - December
More informationBrilliant. This line of lighting fixtures, called Brilliant, bears its name to represent their most elemental
NEW 2012 NEW 2012 Brilliant This line of lighting fixtures, called Brilliant, bears its name to represent their most elemental identification feature tiny crystal chandelier trimmings. These machine-cut
More informationFoodborne Zoonotic Parasites
Foodborne Zoonotic Parasites Lucy J. Robertson, Norwegian University of Life Sciences, Oslo, Norway Norwegian University of Life Sciences 1 Foodborne pathogens increasing importance?? Increasing awareness
More informationActions for combatting Antimicrobial Resistance (AMR)
Symposium on the OIE s activities and Japan inviting Dr. Monique Eloit, Director General of OIE Date: 24 March 2017 Venue: Yayoi Auditorium Ichijo Hall, The University of Tokyo Actions for combatting Antimicrobial
More informationPrivate Sector Perspectives IFAH (worldwide)
OIE National Focal Points for Veterinary Products training Johannesburg, SouthAfrica, 23 26 November2010 Private Sector Perspectives IFAH (worldwide) Barbara Freischem IFAH, Executive Director Presentation
More informationSalmonella monitoring data, food-borne outbreaks and antimicrobial resistance data for 2014 in the European Union
Salmonella monitoring data, food-borne outbreaks and antimicrobial resistance data for 2014 in the European Union Valentina Rizzi BIOMO team, BIOCONTAM Unit, EFSA 21 st EURL-Salmonella workshop 9 June
More informationThis document is a preview generated by EVS
EESTI STANDARD EVS-EN 13532:2002 Üldnõuded in vitro diagnostilistele enesekontrolli meditsiiniseadmetele General requirements for in vitro diagnostic medical devices for self-testing EESTI STANDARDIKESKUS
More informationIWC Symposium and Workshop on the Mortality of Cetaceans in Passive Fishing Nets and Traps. Gillnets and Cetaceans
IWC 1990 Symposium and Workshop on the Mortality of Cetaceans in Passive Fishing Nets and Traps Gillnets and Cetaceans 1994 PARTICIPANTS Argentina Australia Belgium Brazil Canada Chile China Denmark France
More informationQuelle politique antibiotique pour l Europe? Dominique L. Monnet
Quelle politique antibiotique pour l Europe? Dominique L. Monnet National Center for Antimicrobials & Infection Control Statens Serum Institut, Copenhagen, Denmark Opinion of the Section for Protection
More informationJUDI PERCHARD ELFORD
BARBARA ARNDT Ontario, Canada - just 20 minutes from beautiful Niagara Falls is where I was born and the area in which I live. Growing up, my family has always had dogs and in 1972 I purchased my first
More informationGlobal animal production perspectives and correlated use of antimicrobial agents
Global animal production perspectives and correlated use of antimicrobial agents Barbara Freischem Executive Director, International Federation for Animal Health (IFAH) General Overview Presentation overview
More informationQuality of veterinary medicines
Quality of veterinary medicines Regional Seminar for OIE National Focal Points for Veterinary Products Entebbe, Uganda, 1-3 December 2015 Olivier Espeisse (Elanco), speaking on behalf of HealthforAnimals
More informationAnnual report of the Scientific Network on BSE-TSE 2015
TECHNICAL REPORT APPROVED: 10 December 2015 PUBLISHED: 11 December 2015 Annual report of the Scientific Network on BSE-TSE 2015 Abstract European Food Safety Authority The EFSA Scientific Network on bovine
More informationActividades. de verano º Ed. Primaria Inglés. Nombre y apellidos: Curso: Grupo:
Actividades de verano 2016 Nombre y apellidos: Curso: Grupo: 3º Ed. Primaria Inglés STARTER Count and circle Complete the sentences - 2 - - 3 - UNIT 1 Country Word Search EGYPT FINLAND NIGERIA UNITED STATES
More information1/20/2012. think of reasons the eggs may be different. Spent hens are hens that are no longer laying.
1 2 3 4 5 6 7 Animal, Plant & Soil Science Lesson C7-10 The Poultry Industry Interest Approach think of reasons the eggs may be different. What are the major birds classified as poultry? Poultry is the
More informationSCIENTIFIC REPORT. Analysis of the baseline survey on the prevalence of Salmonella in turkey flocks, in the EU,
The EFSA Journal / EFSA Scientific Report (28) 198, 1-224 SCIENTIFIC REPORT Analysis of the baseline survey on the prevalence of Salmonella in turkey flocks, in the EU, 26-27 Part B: factors related to
More informationOIE Collaborating Centres Reports Activities
OIE Collaborating Centres Reports Activities Activities in 2017 This report has been submitted : 2018-01-13 02:04:00 Title of collaborating centre: Diagnosis and Vaccine Evaluation in the Address of Collaborating
More information+ in the European Union
MARKET ACCESS SECRETARIAT Global Analysis Report Pet + Food in the European Union April 2016 EXECUTIVE SUMMARY CONTENTS In 2014, the European Union (EU) was the second-largest pet food market worldwide
More informationOIE Reference Laboratory Reports Activities
OIE Reference Laboratory Reports Activities Activities in 2017 This report has been submitted : 2018-01-24 10:31:11 Name of disease (or topic) for which you are a designated OIE Reference Laboratory: Classical
More informationPOLICY ACTIONS IDENTIFIED IN CALLISTO CYCLE 1 IN EU COUNTRIES AND DEALING WITH THE PARADIGMATIC DISEASES. Bacterial diseases
1 ANNEX 1 POLICY ACTIONS IDENTIFIED IN CALLISTO CYCLE 1 IN EU COUNTRIES AND DEALING WITH THE PARADIGMATIC DISEASES Bacterial s Multidrug resistance Bite wound infections Campylobacteriosis Bartonellosis
More informationChanging patterns of poultry production in the European Union
Chapter 2 Changing patterns of poultry production in the European Union H-W. Windhorst Abstract The EU (27) is one of the leading global regions in egg and poultry meat production. Production is, however,
More informationEjner B rsting, Chief Geneticist, Danish Fur Breeders Association, 60 Langagervej, DK-2600 Glostrup Denmark
F U R B R E E D I N G Ejner B rsting, Chief Geneticist, Danish Fur Breeders Association, 60 Langagervej, DK-2600 Glostrup Denmark S U M M A R Y. The fur industry is a young partner in animal production.
More informationTransmissible Diseases Handbook
Transmissible Diseases Handbook III. EUROPEAN UNION Jacques Kaandorp Past-President EAZWV, IDWG chairman, DFZVO chairman, EAZA veterinary committee chairman, member EAZA legislation committee 1. EUROPEAN
More informationVetoquinol/DOLPAC Small dogs/european Renewal June 2011 SUMMARY OF PRODUCT CHARACTERISTICS
SUMMARY OF PRODUCT CHARACTERISTICS 1. NAME OF THE VETERINARY MEDICINAL PRODUCT Austria Belgium Cyprus Malta Czech Republic Netherlands Greece Portugal Slovakia Hungary Slovenia Germany Finland France Luxembourg
More informationLOHMANN TIERZUCHT. The specialist for layer breeding BREEDING FOR SUCCESS TOGETHER
LOHMANN TIERZUCHT The specialist for layer breeding BREEDING FOR SUCCESS TOGETHER European lessons learned from moving an industry to cage- free Presented by: Prof. Dr. Rudolf Preisinger Chicago, April
More informationBIO // SUN CHOI. galerie dohyanglee
BIO // SUN CHOI 73-75 rue Quincampoix, 75003 Paris. Tél : +33 (0)1 42 77 05 97 Mardi au Samedi / 11h.13h - 14h.19h info@galeriedohyanglee.com SUN CHOI Né en 1973 à Séoul, Corée du Sud Vit et travaille
More informationLimited to 250 cats so get entries in early We look forward to you all exhibiting your beautiful cats Proudly sponsored by
South Australia Queensland Feline Association of SA Inc 2015 Annual Show South Australia s Cat Show Extravaganza 18-19 July 2015 2 Full Days and 6 Rings (St Paul s College, Gilles Plains) 2 INTERNATIONAL
More informationGLOBAL MARKETPLACE UPDATE: 2013 AND BEYOND PFAC ANNUAL CONFERENCE, MONTREAL, NOVEMBER 8, 2013
GLOBAL MARKETPLACE UPDATE: 2013 AND BEYOND PFAC ANNUAL CONFERENCE, MONTREAL, NOVEMBER 8, 2013 WORLD OF PET FOOD IN 2013 AREAS OF GROWTH PET POPULATION PRODUCT STRATEGIES GREEN PET FOOD TRENDS (FROM EUROMONITOR
More information