Department of Bacteriology and Virology, School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran; 2

Transcription

1 Le Infezioni in Medicina, n. 1, 67-76, 2018 ORIGINAL ARTICLE 67 Molecular characteristics of multiple and extensive drug-resistant Acinetobacter baumannii isolates obtained from hospitalized patients in Southwestern Iran Behnaz Soltani 1, Hamid Heidari 1, Hadi Sedigh Ebrahim-Saraie 1, Nahal Hadi 1,2, Jalal Mardaneh 3, Mohammad Motamedifar 1,4 1 Department of Bacteriology and Virology, School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran; 2 Bioinformatics and Computational Biology Research Center, Shiraz University of Medical Sciences, Shiraz, Iran; 3 Department of Microbiology, School of Medicine, Gonabad University of Medical Sciences, Gonabad, Iran; 4 Shiraz HIV/AIDS Research Center, Institute of Health, Shiraz University of Medical Sciences, Shiraz, Iran SUMMARY The emergence of multiple drug-resistant (MDR) Acinetobacter baumannii strains has become a global problem. This study aimed to evaluate the occurrence of antibiotic resistance and to investigate the presence of antibiotic resistance determinants among A. baumannii isolates obtained from hospitalized patients in Iran. This cross-sectional study was performed on 92 A. baumannii isolates in the years Antimicrobial susceptibility testing was carried out by the disk diffusion method. The presence of antibiotic resistance determinants was detected by the PCR method. All the A. baumannii isolates were resistant to tested carbapenems, fluoroquinolones and sulfonamide agents, and susceptible to polymixins. Of the isolates 92.4% were extensive drug-resistant (XDR) and 7.6% were MDR. PCR screening for the pres- ence of integron genes revealed that class 1 integron presented in 46.7% of isolates and class 2 in 18.5% isolates. Of the investigated antibiotic resistance genes, bla, bla, bla, sul1 and sul2 were positive in 75%, VIM IMP SPM 12%, 12%, 47.8%, and 67.4% of isolates, respectively. The high prevalence of metallo-beta-lactamase (MBL) and sul genes in our results may indicate the importance of these genes in the dissemination of carbapenem- and sulfonamide-resistant A. baumannii isolates. Rational and restricted prescription of carbapenems may be an effective way to minimize the emergence and spread of MBL-harboring strains. Keywords: Acinetobacter baumannii, extensive drug-resistant (XDR), integrons, metallo-beta-lactamase (MBL). n INTRODUCTION Acinetobacter is a ubiquitous non-fermenting Gram-negative rod which is frequently isolated as an opportunistic pathogen in the hospital environments [1]. Acinetobacter baumannii accounts for the majority of nosocomial infections Corresponding author Mohammad Motamedifar motamedm@yahoo.com caused by Acinetobacter spp. in intensive care units (ICUs) [2]. A. baumannii is associated with a wide range of infections including pneumonia, burn wound infections, bacteremia, surgical site infections, meningitis, and urinary tract infections [1]. The emergence of multiple drug resistant (MDR) A. baumannii strains is a global challenge for clinicians [3]. Carbapenems are the drugs of choice for treatment of severe infections caused by MDR A. baumannii strains [4,5]. However, over the last decades the number of carbapenem-resistant strains

2 68 B. Soltani, et al. increased throughout the world [4]. Previous studies have reported an increasing prevalence of MDR A. baumannii strains in Iranian healthcare settings [6]. The antibiotic resistance normally transfer among bacterial species by different horizontal gene transfer (HGT) mechanisms such as plasmids or transposons [7, 8]. Integrons as antibiotic resistance determinants called gene cassettes are partially responsible for the integration and rearrangements of resistance genes among bacteria [7]. To date, several classes of integrons have been described, which are mainly composed of an integrase gene (inti) and recombination site called atti, class 1 and 2 integrons being the most common and broadly spread types among Gram-negative bacteria [7]. The presence of gene cassettes located within the variable region of integrons may confer resistance to a wide range of antibiotics and antiseptic agents [7, 8]. Integrons have been described in clinical isolates of Acinetobacter spp. and usually associated with increasing risk of antibiotic resistance dissemination to other pathogens in hospital environments [8]. One of the most important antibiotic resistance determinants which can be found frequently in some of these integrons are metallo-β-lactamase (MBL) genes [9]. During the recent decades, the emergence and spread of carbapenem-resistant strains are risen due to production of MBLs [10]. Several reports indicate the presence of bla IMP and bla VIM genes as a main cause of carbapenems resistance in A. baumannii strains [11]. Therefore, understanding the genetic characteristics of carbapenems resistance is an important step in preventing their dissemination. Another antibiotic resistance factor linked with the insertion on integrons cassettes are sul genes conferring sulfonamide resistance [12]. The two genes sul1 and sul2 introduce the acquired sulfonamides resistance in Gram-negative bacilli, of which sul1 gene is normally found in association with integrons, while sul2 is usually plasmid-borne [12]. Due to the emergence of MDR isolates in our region, the aims of this study was to evaluate the occurrence of antibiotic resistance and investigate the presence of antibiotic resistance determinants among A. baumannii isolates obtained from hospitalized Iranian patients. n MATERIALS AND METHODS Study design and bacterial identification This cross-sectional study performed on a total of 92 non-duplicate A. baumannii isolates which were obtained from different clinical specimens from August 2015 to February 2016 in Nemazee hospital. Nemazee hospital with 1000 beds is a major tertiary care hospital in the South-Western Iran. This study was conducted in accordance with the declaration of Helsinki and approved by the Ethics Committee of Shiraz University of Medical Sciences. The suspected non-glucose fermenting Gram-negative rods were identified as Acinetobacter spp. by standard microbiology procedures, and were further confirmed as A. baumannii by the amplification of bla OXA-51 -like gene as described by Turton et al. previously [13]. The confirmed isolates were stored at -80 C for a longterm preservation. Antimicrobial susceptibility testing Antimicrobial susceptibility testing was carried out on all isolates by standard disk diffusion method on Mueller-Hinton agar medium (Merck Co., Darmstadt, Germany) as described by the Clinical and Laboratory Standards Institute (CLSI) guidelines [14]. The used antibiotics disks (MAST, Merseyside, UK) were ampicillin-sulbactam (SAM), piperacillin-tazobactam (PTZ), ceftazidime (CAZ), gentamicin (GM), tobramycin (TN), doxycycline (DXT), levofloxacin (LEV), ciprofloxacin (CIP), minocycline (MN), colistin (CO), co-trimoxazole (SXT), amikacin (AK), ticarcillin-clavulanate (TIM), polymyxin B (PB), meropenem (MEM), and imipenem (IMI). CLSI interpretive criteria were used for each antibacterial agent. The CLSI interpretive criteria for Pseudomonas aeruginosa were applied to determine the susceptibility to polymyxin B and colistin. Control strain for susceptibility testing was P. aeruginosa ATCC MDR and extensive drug-resistant (XDR) was estimated according to previously described definitions [15]. DNA extraction and PCR assay The used template DNA was extracted from fresh grown colonies by boiling method as described previously [16]. All A. baumannii isolates were screened for the presence of classes 1-3 integrons

3 Characteristics of MDR and XDR A. baumannii 69 by detection of integrase genes inti1, inti2 and inti3 using the previously described primers by Machado et al. [17]. Subsequently the presence of carbapenems resistance genes, bla IMP, bla VIM and bla SPM were determined by set of primers described by Poirel et al. [18]. In order to assess the presence of sulfonamide resistance genes, specific primers were applied for determination of sul1 and sul2 genes [19]. All used primers in the present study are listed in Table 1. PCR amplifications for studied genes were carried out in following condition: initial denaturation at 95 C for 5 min, followed by 30 cycles of denaturation at 95 C for 60 sec, annealing for 45 sec (temperature was depending on the sequence of primers), extension at 72 C for 50 sec and final extension at 72 C for 5 min. PCR amplifications for studied genes was carried out on a T100 thermal cycler (Bio-Rad, Hercules, CA, USA). The purified PCR products of positive isolates were sequenced, and sequences were compared using online BLAST software ( nlm. nih.gov/blast/). Statistical analysis Analysis was performed by using SPSS TM software, version 21.0 (IBM Corp., USA). The results are presented as descriptive statistics in terms of relative frequency. Values were expressed as the percentages of the group (categorical variables). Chi-square or Fisher s exact tests were used to determine the significance of differences. A difference was considered statistically significant if the p value was less than n RESULTS Out of a total of 92 MDR and XDR confirmed A. baumannii isolates were included in the study, 49 (53.3%) isolates were obtained from male and 43 (46.7%) from female patients. Sixty four (69.6%) isolates of studied A. baumannii were from the intensive care units (ICUs), 17 (18.5%) were from the internal medicine wards, 8 (8.7%) were from the surgery ward, and 3 from transplantation ward. The main sites of infections were: 61 (66.3%) from respiratory tract, followed by 11 Table 1 - List of used primers in the present study. Primer Oligonucleotide sequence (5 to 3 ) Gene Reference OXA-51-like-F TAATGCTTTGATCGGCCTTG bla OXA-51-like 12 OXA-51-like-R TGGATTGCACTTCATCTTGG IntI1-F GGTCAAGGATCTGGATTTCG inti1 16 IntI1-R ACATGCGTGTAAATCATCGTC IntI2-F CACGGATATGCGACAAAAAGGT inti2 16 IntI2-R GTAGCAAACGAGTGACGAAATG IntI3-F AGTGGGTGGCGAATGAGTG inti3 16 IntI3-R TGTTCTTGTATCGGCAGGTG IMP-F GGAATAGAGTGGCTTAAYTCTC bla IMP 17 IMP-R GGTTTAAYAAAACAACCACC SPM-F AAAATCTGGGTACGCAAACG bla SPM 17 SPM-R ACATTATCCGCTGGAACAGG VIM-F GATGGTGTTTGGTCGCATA bla VIM 17 VIM-R CGAATGCGCAGCACCAG Sul1-F CTTCGATGAGAGCCGGCGGC sul1 18 Sul1-R GCAAGGCGGAAACCCGCGCC Sul2-F TCGTCAACATAACCTCGGACAG sul2 18 Sul2-R GTTGCGTTTGATACCGGCAC

4 70 B. Soltani, et al. (12%) bloodstream, 8 (8.7%) skin and soft tissue infections (SSTIs), urinary tract infections (UTIs) and abdominal each with 5 (5.4%) cases and 2 (2.2%) from eye infection. Based on the results of susceptibility testing, all of A. baumannii isolates were resistant to tested carbapenems, fluoroquinolones and sulfonamide agents. Polymixins with full susceptibility were the most effective antibiotics followed by tetracyclines. The full results of antimicrobial susceptibility testing of isolates toward 16 antibiotics are shown in Table 2. The majority of isolates 85/92 (92.4%) were XDR with six different resistance patterns and 7 (7.6%) isolates were MDR with 4 different patterns. PCR screening for the presence of integrons genes revealed that 43 (46.7%) of isolates were positive for int1 gene and harboring class 1 integron and 17 (18.5%) isolates were positive for inti2 genes and harboring class 2 integron, and 8 (8.7%) isolates contained both inti1and inti2 genes. Class 3 integron was not detected in any of the isolates by the absence of inti3 gene. Of the investigated MBL genes, bla VIM gene was detected in 69 (75%) isolates and bla IMP and bla SPM genes being positive in 11 (12%) isolates separately. Totally, MBL genes were detected in 82.6% (76/92) of isolates. Sulfonamide resistance genes, sul1 and sul2 were detected in 44 (47.8%) and 62 (67.4%) of isolates, respectively. Thirty nine (42.4%) isolates contained both sul1 and sul2 genes, and 67 (72.8%) isolates contained at least one of the sul genes. The occurrence of resistance genes among integrons positive isolates are reported in Table 3. Although, the relative Table 2 - The antibiotic susceptibility testing results of 92 A. baumannii isolates. Class Antibiotic Susceptible Intermediate-resistant Resistant Carbapenems Meropenem (100) Imipenem (100) Fluoroquinolones Ciprofloxacin (100) Levofloxacin (100) Sulfonamide Co-trimoxazole (100) b-lactam/b-lactamase Inhibitor Piperacillin-tazobactam (100) Ticarcillin-clavulanate 0 b0 92 (100) Ampicillin-sulbactam 8 (8.7) 33 (35.9) 51 (55.4) Cephalosporins Ceftazidime 1 (1.1) 0 91 (98.9) Aminoglycosides Gentamicin 2 (2.2) 0 90 (97.8) Tobramycin 2 (2.2) 0 90 (97.8) Amikacin 1 (1.1) 4 (4.3) 87 (94.6) Tetracyclines Doxycycline 36 (39.1) 3 (3.3) 53 (57.6) Minocycline 62 (67.4) 25 (27.2) 5 (5.4) Polymyxins Polymyxin B 92 (100) 0 0 Colistin 92 (100) 0 0 Table 3 - The occurrence of resistance genes among integrons positive A. baumannii isolates. Integron class (Total positive No.) SPM IMP VIM sul1 sul2 inti1 (43) 5 (11.6) 6 (14.0) 30 (69.8) 21 (48.8) 30 (69.8) inti2 (17) 2 (11.8) 2 (11.8) 15 (88.2) 11 (64.7) 16 (94.1) inti1+inti2 (52) 7 (13.5) 7 (13.5) 39 (75) 27 (51.9) 38 (73.1)

5 Characteristics of MDR and XDR A. baumannii 71 frequency of some resistance genes among class 1 and 2 integrons positive isolates were high, the statistical analysis showed no significant differences compared to integron negative isolates. The detailed results of all 92 studied A. baumannii isolates are reported in Table 4. Table 4 - Detailed results of 92 A. baumannii isolates. No. Gender Ward Source of infection Antibiotic resistance pattern e Resistance genes pattern 1 F a Surgery Skin and soft tissue XDR1 inti1+vim 2 F ICU c Respiratory XDR1 VIM 3 M b ICU Skin and soft tissue XDR2 VIM 4 M Internal Medicine Abdominal MDR1 inti1+vim 5 F ICU Respiratory XDR2 VIM+sul2 6 M Internal Medicine Respiratory XDR2 inti1+inti2+vim+sul2 7 M Internal Medicine Respiratory XDR2 inti1+inti2+sul2 8 F ICU Respiratory MDR2 VIM+sul2 9 M ICU Respiratory XDR2 VIM 10 F ICU Respiratory XDR2 VIM+SPM 11 M ICU Respiratory XDR2 inti1+spm 12 M ICU Respiratory XDR1 VIM 13 M Internal Medicine Bloodstream XDR3 inti1+vim+sul1+sul2 14 M Internal Medicine Bloodstream XDR3 sul1+sul2 15 M ICU Skin and soft tissue XDR2 inti1+vim+sul1 16 F Internal Medicine Respiratory XDR3 inti1+inti2+sul1+sul2 17 M ICU Respiratory MDR3 inti2+vim+sul2 18 M Internal Medicine Respiratory XDR3 inti1+vim+sul1+sul2 19 F ICU Respiratory XDR2 inti1+vim+sul2 20 F ICU Respiratory XDR2 inti2+imp+vim+sul1 21 M ICU Respiratory XDR2 IMP+VIM 22 F ICU Respiratory XDR2 inti1+vim 23 F Internal Medicine Abdominal XDR2 VIM 24 F ICU Respiratory XDR1 inti1+sul2 25 F ICU Respiratory XDR1 VIM 26 M ICU Respiratory XDR3 inti1+vim+sul2 27 F ICU Respiratory XDR3 inti2+vim+sul1+sul2 28 M Internal Medicine Respiratory XDR3 inti2+vim+sul1+sul2 29 M ICU Respiratory XDR3 inti2+vim+sul1+sul2 30 F ICU Respiratory XDR2 inti1+vim 31 M Internal Medicine Respiratory XDR3 inti1+sul1+sul2 32 M ICU Respiratory XDR3 sul1+sul2 33 M ICU Respiratory XDR1 VIM+SPM+sul1 34 M ICU Bloodstream XDR2 inti2+vim+sul1+sul2

6 72 B. Soltani, et al. No. Gender Ward Source of infection Antibiotic resistance pattern e Resistance genes pattern 35 F ICU Respiratory XDR2 inti1+vim+sul1 36 M ICU Respiratory XDR1 inti1+imp+vim+sul2 37 F ICU Respiratory XDR2 inti1+imp 38 F ICU Respiratory XDR1 VIM+sul2 39 F ICU Respiratory MDR2 inti1+vim+sul1+sul2 40 M Surgery Abdominal XDR3 inti1+inti2+imp+vim+sul1+sul2 41 M ICU Bloodstream XDR2 VIM+sul1+sul2 42 M ICU Eye XDR1 VIM 43 M ICU Bloodstream XDR2 inti1+vim+spm+sul1 44 F ICU Respiratory XDR3 inti1+vim+sul1+sul2 45 M ICU Skin and soft tissue XDR2 VIM+sul1+sul2 46 F Internal Medicine UTI d XDR1 VIM 47 F Surgery Skin and soft tissue XDR2 inti1+vim 48 M ICU UTI XDR2 VIM+sul2 49 F Surgery Respiratory XDR1 inti1+sul2 50 M ICU Respiratory XDR1 inti1+vim 51 F Surgery UTI XDR2 sul2 52 F ICU Bloodstream XDR1 inti1+inti2+vim+sul1+sul2 53 M Transplantation Respiratory MDR4 inti2+vim+spm+sul2 54 M Internal Medicine Respiratory XDR2 inti2+vim+spm+sul2 55 F Surgery Abdominal XDR1 inti1+spm+sul2 56 M ICU Respiratory XDR3 inti1+vim+sul1+sul2 57 F ICU Abdominal XDR1 VIM+sul2 58 M ICU Respiratory XDR3 IMP+sul1+sul2 59 F ICU Respiratory XDR1 VIM+SPM 60 M Internal Medicine Bloodstream XDR2 IMP+VIM+SPM+sul2 61 M Surgery Skin and soft tissue XDR1 inti1+inti2+vim+sul2 62 F ICU Bloodstream XDR3 VIM+sul1+sul2 63 F ICU Eye XDR3 inti1+imp+vim+sul1+sul2 64 F ICU Respiratory XDR3 VIM+sul1+sul2 65 M ICU Respiratory XDR3 inti1+vim+spm+sul2 66 F ICU Respiratory XDR3 inti1+sul1+sul2 67 M ICU Respiratory XDR2 VIM 68 M Internal Medicine Respiratory XDR3 sul1+sul2 69 F ICU Bloodstream XDR3 inti1+imp+sul1+sul2 70 M ICU Respiratory XDR3 sul1+sul2 71 F ICU Bloodstream XDR3 inti1+imp+sul1+sul2 72 F ICU Respiratory XDR1 VIM 73 F ICU Respiratory XDR3 IMP+sul1+sul2 74 F ICU Respiratory XDR1 inti1+inti2+vim+sul1+sul2

7 Characteristics of MDR and XDR A. baumannii 73 No. Gender Ward Source of infection Antibiotic resistance pattern e Resistance genes pattern 75 M ICU Respiratory XDR4 inti2+vim+sul1+sul2 76 M Surgery Respiratory XDR3 sul2 77 M ICU Respiratory XDR3 VIM+sul1+sul2 78 M Internal Medicine UTI XDR2 VIM 79 F ICU Respiratory XDR1 inti1+vim+sul2 80 M ICU Respiratory MDR2 inti1+vim+spm+sul1+sul2 81 M Internal Medicine Skin and soft tissue XDR1 inti1+vim+sul1+sul2 82 M ICU Respiratory XDR1 inti1+vim 83 F ICU Respiratory XDR5 inti1 84 M ICU Respiratory MDR2 sul1+sul2 85 F Transplantation Skin and soft tissue XDR1 inti1+sul2 86 F Transplantation UTI XDR2 VIM+sul1+sul2 87 M ICU Respiratory XDR3 inti1+vim+sul1+sul2 88 F ICU Bloodstream XDR6 inti1+inti2+vim+sul1+sul2 89 F ICU Respiratory XDR3 VIM+sul1+sul2 90 M ICU Respiratory XDR2 VIM 91 M Internal Medicine Respiratory XDR1 VIM+sul1+sul2 92 F ICU Respiratory XDR3 sul1+sul2 a F: female; b M: male; c ICU: Intensive Care Unit; d UTI: Urinary Tract Infection; e numbers indicate to different resistance pattern. n DISCUSSION The emergence of clinical A. baumannii isolates with high resistance to different classes of antibiotics has become a global problem [4]. In the present study we observed a high frequency of XDR A. baumannii isolates (92.4%) which were resistant to most of tested antimicrobial agents. Since authors do not use routinely a standard definition to describe bacteria that are resistant to multiple antimicrobial agents, reporting rate of XDR A. baumannii isolates in Iran are limited [2,4,20]. But in a recently published multicenter hospital-based survey from the capital of Iran, the reported isolation rate (366/401; 91.3%) was close to our finding which indicates the high distribution of XDR isolates in Iranian healthcare settings [21]. Based on our results, polymyxins and tetracyclines exhibited promising in vitro activity against A. baumannii isolates. This findings were in accordance with previous works showing that these older antibiotics could be used as the last resort for the treatment of infections caused by MDR or XDR A. baumannii isolates [3, 22-24]. As part of HGT system, the role of integrons in the spread of resistance genes among bacterial population are undeniable [7,8]. In the present study, class 1 and 2 integron-integrase genes were found in 46.7% and 18.5% of isolates, respectively. Numerous studies reported the prevalence of integrons among clinical A. baumannii isolates from Iran and other parts of world, and most of them reported a higher incidence of class 1 integron [25-28]. However, there were some variations according to the geographical distribution and source of infections. Goudarzi et al. from North of Iran (Tehran city), showed 74.1% and 12.5%, prevalence of class 1 and 2 integrons in ICU wards respectively [29]. These rates in our ICUs were 43.8% for class 1 and 14.1% for class 2 integrons. Najar Peerayeh et al. among 30 XDR A. baumannii isolates reported 96.7% of the isolates were positive for class I integron and 43.3% for class II [30]. In our findings, class 1 and 2 integrons were found to be 47.1% and 17.6% among XDR A. baumannii isolates, respectively. Farshadzadeh et al. in burns patients reported class 1 integron was 84%, while class 2 and 3 integrons were not found [4].

8 74 B. Soltani, et al. Because of some limitations including the presence of cryptic resistance genes and influence of these genes promoters by broad-spectrum antibiotics, determination of MBL producing isolates by susceptibility tests are insufficient [31]. In our results, 82.6% of isolates harbored one of the investigated MBL genes. The presence of MBL genes in carbapenems-resistant isolates in our region and Iran is not uncommon, since several authors mentioned the occurrence of these genes [11, 32-34]. But, some points must be highlighted such as the emergence of bla SPM containing A. baumannii isolates for the first time in our region and the increasing frequency of bla VIM in our isolates. Previously, the prevalence of bla SPM was cited by Shahcheraghi et al. from North of country, but our results is the first report of A. baumannii isolates containing bla SPM in South of Iran [35]. Recently, Pourabbas et al. detected bla SPM in one isolate of Acinetobacter nosocomialis in our studied hospital [36]. Closest to our findings, Farsiani et al. reported a high incidence of bla VIM gene (64%) among carbapenems-resistant A. baumannii isolates from North-east of Iran (Mashhad city) [37]. But this rate was higher than our previous work within years 2012 to 2013, where we showed 32.6% bla VIM positivity [1]. The first reason of such a controversy was investigation of MBL genes only among phenotypic MBL producing isolates [1]. Second, despite all reports indicating the high prevalence of carbapenems-resistant isolates, still our clinicians use carbapenems as empirical therapy of infections caused by Gram-negative bacteria and may cause selection of carbapenems-resistant isolates in region. At global scale these differences in prevalence of carbapenems resistance genes could also result from several factors, including differences in geographical regions, infection control policies, nature of infections and sample size. Sulfonamides are not routinely administered for A. baumannii infections; but, sulfonamides resistance determinants have high potential for transmission to other bacteria via mobile genetic elements [14]. Therefore, the knowledge of their epidemiology has an important role in preventing and overcoming the emergence of sulfonamide-resistant strains. It seems that compared to those studies which reported prevalence of sul genes among Gram-negative bacteria, despite all variation in detection rates, prevalence of sul1 gene was mostly associated with incidence of class 1 integron; while, prevalence of sul2 gene was mainly arisen from plasmid origin [38-41]. In conclusion, beside all limitations possibly related to the present study, the high prevalence of MBL and sul genes in our results can indicate the importance of these genes in the dissemination of carbapenem- and sulfonamide-resistant A. baumannii isolates in our region. Moreover, rational and restricted prescription of carbapenems can be effective in minimizing the emergence and spread of MBL harboring strains. ACKNOWLEDGMENT The authors wish to thank Dr. Nasrin Shokrpour at the Research Consolation Centre (RCC) at Shiraz University of Medical Sciences for her invaluable assistance in editing this manuscript. This study was supported by Shiraz University of Medical Sciences. This article extracted from the MSc thesis by Ms. Behnaz Soltani under the supervision of Dr. M. Motamedifar. Funding This study was supported by Shiraz University of Medical Sciences with grant No Conflict of interest None declared. n REFERENCES [1] Moghadam M.N., Motamedifar M., Sarvari J., Sedigh E. S., Mousavi S. M., Moghadam F.N. Emergence of multidrug resistance and metallo-beta-lactamase producing Acinetobacter baumannii isolated from patients in Shiraz, Iran. Ann. Med. Health. Sci. Res. 6, 3, , [2] Japoni-Nejad A., Sofian M., Belkum A. V., Ghaznavi-Rad E. Nosocomial outbreak of extensively and pan drug-resistant Acinetobacter baumannii in tertiary hospital in central part of Iran. Jundishapur. J. Microbiol. 6, 8, e9892, [3] Razavi Nikoo H., Ardebili A., Mardaneh J. Systematic review of antimicrobial resistance of clinical Acinetobacter baumannii isolates in Iran: an update. Microb. Drug. Resist. 23, 6, , [4] Farshadzadeh Z., Hashemi F.B., Rahimi S., et al. Wide distribution of carbapenem resistant Acinetobacter baumannii in burns patients in Iran. Front. Microbiol. 6, 1146, [5] Deveci O., Dal T., Tekin R., Bozkurt F., Tekin A., Dayan S. Carbapenem resistance in Acinetobacter bau-

9 Characteristics of MDR and XDR A. baumannii 75 mannii: where is it heading? Infez. Med. 21, 3, , [6] Moradi J., Hashemi F.B., Bahador A. Antibiotic resistance of Acinetobacter baumannii in Iran: a systemic review of the published literature. Osong. Public. Health. Res. Perspect. 6, 2, 79-86, [7] Deng Y., Bao X., Ji L., et al. Resistance integrons: class 1, 2 and 3 integrons. Ann. Clin. Microbiol. Antimicrob. 14, 45, [8] Berglund B. Environmental dissemination of antibiotic resistance genes and correlation to anthropogenic contamination with antibiotics. Infect. Ecol. Epidemiol. 5, 28564, [9.] Mano Y., Saga T., Ishii Y., et al. Molecular analysis of the integrons of metallo-beta-lactamase-producing Pseudomonas aeruginosa isolates collected by nationwide surveillance programs across Japan. BMC Microbiol. 15, 41, [10] Zahedi Bialvaei A., Samadi Kafil H., Ebrahimzadeh Leylabadlo H., Asgharzadeh M., Aghazadeh M. Dissemination of carbapenemases producing Gram negative bacteria in the Middle East. Iran. J. Microbiol. 7, 5, , [11] Peymani A., Nahaei M. R., Farajnia S., et al. High prevalence of metallo-beta-lactamase-producing Acinetobacter baumannii in a teaching hospital in Tabriz, Iran. Jpn. J. Infect. Dis. 64, 1, 69-71, [12] Grape M., Farra A., Kronvall G., Sundstrom L. Integrons and gene cassettes in clinical isolates of co-trimoxazole-resistant Gram-negative bacteria. Clin. Microbiol. Infect. 11, 3, , [13] Turton J.F., Woodford N., Glover J., Yarde S., Kaufmann M.E., Pitt T.L. Identification of Acinetobacter baumannii by detection of the blaoxa-51-like carbapenemase gene intrinsic to this species. J. Clin. Microbiol. 44, 8, , [14] Wayne P. Performance standards for antimicrobial susceptibility testing. Clinical and Laboratory Standards Institute (CLSI) 25th Informational Supplement., M100-S25, [15] Magiorakos A. P., Srinivasan A., Carey R.B., et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 18, 3, , [16] Heidari H., Emaneini M., Dabiri H., Jabalameli F. Virulence factors, antimicrobial resistance pattern and molecular analysis of Enterococcal strains isolated from burn patients. Microb. Pathog. 90, 93-97, [17] Machado E., Canton R., Baquero F., et al. Integron content of extended-spectrum-beta-lactamase-producing Escherichia coli strains over 12 years in a single hospital in Madrid, Spain. Antimicrob. Agents. Chemother. 49, 5, , [18] Poirel L., Walsh T. R., Cuvillier V., Nordmann P. Multiplex PCR for detection of acquired carbapenemase genes. Diagn. Microbiol. Infect. Dis. 70, 1, , [19] Byrne-Bailey K.G., Gaze W.H., Kay P., Boxall A.B., Hawkey P.M., Wellington E.M. Prevalence of sulfonamide resistance genes in bacterial isolates from manured agricultural soils and pig slurry in the United Kingdom. Antimicrob. Agents. Chemother. 53, 2, , [20] Mahdian S., Sadeghifard N., Pakzad I., et al. Acinetobacter baumannii clonal lineages I and II harboring different carbapenem-hydrolyzing-beta-lactamase genes are widespread among hospitalized burn patients in Tehran. J. Infect. Public. Health 8, 6, , [21] Jasemi S., Douraghi M., Adibhesami H., et al. Trend of extensively drug-resistant Acinetobacter baumannii and the remaining therapeutic options: a multicenter study in Tehran, Iran over a 3-year period. Lett. Appl. Microbiol. 63, 6, , [22] Goff D.A., Kaye K.S. Minocycline: an old drug for a new bug: multidrug-resistant Acinetobacter baumannii. Clin. Infect. Dis. 59 (Suppl. 6), S365-S366, [23] Metan G., Pala C., Kaynar L., Cevahir F., Alp E. A nightmare for haematology clinics: extensively drug-resistant (XDR) Acinetobacter baumannnii. Infez. Med. 22, 4, , [24] Ece G., Samlioglu P., Atalay S., Kose S. Evaluation of the in vitro colistin susceptibility of Pseudomonas aeruginosa and Acinetobacter baumannii strains at a tertiary care centre in Western Turkey. Infez. Med. 22, 1, 36-40, [25] Sung J.Y., Koo S.H., Kim S., Kwon K.C. Epidemiological characterizations of class 1 integrons from multidrug-resistant acinetobacter isolates in Daejeon, Korea. Ann. Lab. Med. 34, 4, , [26] Martins N., Picao R.C., Adams-Sapper S., Riley L.W., Moreira B.M. Association of class 1 and 2 integrons with multidrug-resistant Acinetobacter baumannii international clones and Acinetobacter nosocomialis isolates. Antimicrob. Agents Chemother. 59, 1, , [27] Cicek A.C., Duzgun A.O., Saral A., et al. Detection of class 1 integron in Acinetobacter baumannii isolates collected from nine hospitals in Turkey. Asian Pac. J. Trop. Biomed. 3, 9, , [28] Taherikalani M., Maleki A., Sadeghifard N., et al. Dissemination of class 1, 2 and 3 integrons among different multidrug resistant isolates of Acinetobacter baumannii in Tehran hospitals, Iran. Pol. J. Microbiol. 60, 2, , [29] Goudarzi H., Azad M., Seyedjavadi S.S., et al. Characterization of integrons and associated gene cassettes in Acinetobacter baumannii strains isolated from intensive care unit in Tehran, Iran. J. Acute. Dis. 5, 5, , [30] Najar Peerayeh S., Karmostaji A. Molecular identification of resistance determinants, integrons and genetic relatedness of extensively drug resistant Acineto-

10 76 B. Soltani, et al. bacter baumannii isolated from hospitals in Tehran, Iran. Jundishapur. J. Microbiol. 8, 7, e27021, [31] Oh E.J., Lee S., Park Y.J., et al. Prevalence of metallo-beta-lactamase among Pseudomonas aeruginosa and Acinetobacter baumannii in a Korean university hospital and comparison of screening methods for detecting metallo-beta-lactamase. J. Microbiol. Methods. 54, 3, , [32] Safari M., Mozaffari Nejad A.S., Bahador A., Jafari R., Alikhani M.Y. Prevalence of ESBL and MBL encoding genes in Acinetobacter baumannii strains isolated from patients of intensive care units (ICU). Saudi. J. Biol. Sci. 22, 4, , [33] Fallah F., Noori M., Hashemi A., et al. Prevalence of blandm, blaper, blaveb, blaimp, and blavim genes among acinetobacter baumannii isolated from two hospitals of tehran, Iran. Scientifica. 2014, 6, [34] Aghamiri S., Amirmozafari N., Fallah Mehrabadi J., Fouladtan B., Hanafi Abdar M. antibiotic resistance patterns and a survey of metallo-beta-lactamase genes including bla-imp and bla-vim types in Acinetobacter baumannii isolated from hospital patients in Tehran. Chemotherapy 61, 5, , [35] Shahcheraghi F., Abbasalipour M., Feizabadi M., Ebrahimipour G., Akbari N. Isolation and genetic characterization of metallo-beta-lactamase and carbapenamase producing strains of Acinetobacter baumannii from patients at Tehran hospitals. Iran. J. Microbiol. 3, 2, 68-74, [36] Pourabbas B., Firouzi R., Pouladfar G. Characterization of carbapenem-resistant Acinetobacter calcoaceticus-baumannii complex isolates from nosocomial bloodstream infections in southern Iran. J. Med. Microbiol. 65, 3, , [37] Farsiani H., Mosavat A., Soleimanpour S., et al. Limited genetic diversity and extensive antimicrobial resistance in clinical isolates of Acinetobacter baumannii in north-east Iran. J. Med. Microbiol. 64, 7, , [38] Gundogdu A., Long Y.B., Vollmerhausen T.L., Katouli M. Antimicrobial resistance and distribution of sul genes and integron-associated inti genes among uropathogenic Escherichia coli in Queensland, Australia. J. Med. Microbiol. 60, Pt 11, , [39] Tajbakhsh E., Khamesipour F., Ranjbar R., Ugwu I.C. Prevalence of class 1 and 2 integrons in multi-drug resistant Escherichia coli isolated from aquaculture water in Chaharmahal Va Bakhtiari province, Iran. Ann. Clin. Microbiol. Antimicrob. 14, 37, [40] Shin H.W., Lim J., Kim S., Kim J., Kwon G.C., Koo S.H. Characterization of trimethoprim-sulfamethoxazole resistance genes and their relatedness to class 1 integron and insertion sequence common region in gram-negative bacilli. J. Microbiol. Biotechnol. 25, 1, , [41] Khorsi K., Messai Y., Hamidi M., Ammari H., Bakour R. High prevalence of multidrug-resistance in Acinetobacter baumannii and dissemination of carbapenemase-encoding genes blaoxa-23-like, blaoxa-24- like and blandm-1 in Algiers hospitals. Asian Pac. J. Trop. Med. 8, 6, , 2015.