ACCEPTED. in BALB/c mice. James T. Paulley, Eric S. Anderson, and R. Martin Roop II*

Transcription

1 IAI Accepts, published online ahead of print on 20 August 2007 Infect. Immun. doi: /iai Copyright 2007, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved. Brucella abortus requires the heme transporter BhuA for maintenance of chronic infection in BALB/c mice James T. Paulley, Eric S. Anderson, and R. Martin Roop II* Department of Microbiology and Immunology, East Carolina University School of Medicine, *Corresponding Author Department of Microbiology and Immunology, East Carolina University School of Medicine 600 Moye Boulevard Greenville, North Carolina Phone: FAX: Greenville, North Carolina Running title: Brucella heme transport and chronic infection in mice

2 Abstract The gene annotated as BAB2_1150 in the Brucella abortus 2308 genome sequence is predicted to encode a homolog of the well-characterized heme transporter ShuA of Shigella dysenteriae and accordingly has been given the designation bhua (Brucella heme utilization). Phenotypic analysis of an isogenic bhua mutant derived from B. abortus 2308 verified a link between BhuA and the ability of the parent strain to use heme as an iron source in in vitro assays. Maximum expression of bhua in B. abortus 2308 is observed during stationary phase when this strain in cultivated in low iron minimal medium, and a comparison of the growth characteristics of the B. abortus bhua mutant and 2308 in this medium suggest that heme serves as an important iron source for the parent strain during stationary phase. The B. abortus bhua mutant HR1703 exhibits significant attenuation in cultured murine macrophages compared to strain 2308, and unlike its parent strain, the B. abortus bhua mutant is unable to maintain chronic spleen infection in experimentally infected BALB/c mice. These experimental findings suggest that heme and/or heme-containing proteins represent important iron sources for B. abortus 2308 during its residence in the mammalian host and that BhuA is required for efficient utilization of these iron sources. 2

3 Introduction The capacity of a bacterium to acquire sufficient amounts of iron is almost always linked to its ability to survive in its biological niche. Accomplishing this in the iron-restricted environment of a mammalian host represents a major virulence determinant in the case of bacterial pathogens (42). Indeed, pathogens often employ specialized transport machinery to counteract the iron restriction associated with the host innate immune defense. Brucella abortus is a Gram negative zoonotic pathogen that causes abortion and infertility in ruminants and a chronic debilitating disease known as undulant fever in humans (1). Survival and replication of the brucellae within host macrophages is critical for virulence (38). These bacteria produce the monocatechol 2,3-dihydroxybenzoic acid (2,3-DHBA) (22) and a more complex 2,3-DHBA-based compound known as brucebactin (18) in response to iron limitation in vitro. Experimental evidence indicates that both of these compounds function as siderophores. Biochemical studies (23) and genome analysis (39) also suggest that these are the only siderophores produced by the brucellae. Neither 2,3-DHBA nor brucebactin are required for the survival and replication of B. abortus 2308 in cultured murine macrophages or wild-type virulence of this strain in experimentally infected BALB/c or C57BL6 mice (4,18,31). Consequently, the question of what iron source(s) the brucellae use during their prolonged residence in host macrophages during the chronic stage of infection remains unanswered (39). B. melitensis 16M and B. abortus 2308 have been shown to utilize heme as an iron source in vitro (5,11). Due to the central role of macrophages in heme recycling in mammals (10,45) heme may represent a relevant iron source for the brucellae during residence in the macrophage (39). Other bacterial pathogens including Shigella dysenteriae, Escherichia coli, Vibrio cholerae, Yersinia pestis, Staphylococcus aureus, Haemophilus influenzae and the Bordetella spp. produce 3

4 heme transporters and have the capacity to use heme as an iron source. Loss of these heme transporters has a detrimental effect on the virulence of some of these pathogens in experimental animal models or cell lines, while in others loss of the heme transporter has little or no impact on virulence (26,29,35,42,46,47,48). Analysis of the currently available Brucella genome sequences (9,13,19,32) reveals the presence of a homolog of the shua gene of Shigella dysenteriae (28). This latter gene encodes a TonB-dependent outer membrane protein involved in heme transport in S. dysenteriae. To determine if the Brucella ShuA homolog performs a similar function and assess the relative importance of heme as an iron source for the brucellae, a derivative of virulent B. abortus 2308 lacking the ShuA homolog was constructed and evaluated for its phenotype in vitro and in the mouse model. 4

5 Materials and Methods Bacterial strains. Brucella abortus 2308 and derivatives of this strain were cultivated on Schaedler agar supplemented with 5% defibrinated bovine blood (SBA) at 37 C with 5% CO 2 or in brucella broth at 37 C with shaking unless otherwise noted. Low iron minimal medium was prepared as previously described (22), and 50 µm FeCl 3 was added to this medium to provide iron replete growth conditions. Escherichia coli strain DH5-α was used as a host strain for recombinant DNA procedures and this strain was cultivated on tryptic soy agar at 37 C or in LB broth at 37 C with shaking. Growth media were supplemented with ampicillin (25 µg/ml for B. abortus and 100 µg/ml for E. coli DH5-α), chloramphenicol (5 µg/ml for B. abortus and 30 µg/ml for E. coli DH5-α) and/or kanamycin (45 µg/ml) as necessary. Brucella stock cultures were maintained in brucella broth supplemented with 25% glycerol and E. coli stock cultures were maintained in LB supplemented with 25% glycerol at -80 C. Construction of the B. abortus bhua mutant. Oligonucleotide primers (Fwd primer: TGTTGAGCATGAAAACCAAA; Rev primer: TATTGATTGACAGCAAATTG) and polymerase chain reaction (PCR) were used to amplify a 3279 bp fragment of genomic DNA from B. abortus 2308 encompassing the bhua gene (BAB2_1150). This fragment was cloned into pgem -T Easy (Promega) and digested with ClaI, which resulted in the removal of 1549 bp of the 1983 bp bhua coding region. The linearized plasmid was then treated with the Klenow fragment of DNA polymerase I and ligated with the chloramphenicol acetyltransferase (cat) gene from pblue-cm2 (36). The resulting plasmid was then used in a gene replacement strategy (14) to construct an isogenic bhua mutant from virulent B. abortus The genotype of a B. abortus bhua mutant (designated HR1703) constructed in this manner was confirmed by PCR 5

6 analysis of genomic DNA from this strain using bhua-, cat-, and pgem-specific primer sets. Crystal violet exclusion was used to verify that the B. abortus bhua mutant had retained its smooth lipopolysaccharide phenotype (3). Attempts to use a pmr10-based plasmid (16) carrying a cloned copy of the intact bhua gene for genetic complementation of the B. abortus bhua mutant (see Results) were unsuccessful. Therefore, relying on the observation that bhua is transcribed as a monocistronic gene in B. abortus 2308 (data not shown), the bhua gene was reconstructed in HR1703 using the following procedures. A version of the pgem-based plasmid containing the 3280 bp DNA fragment bearing the intact bhua gene was introduced into B. abortus HR1703 by electroporation. Transformants were first plated on SBA containing 25 µg/µl ampicillin to select for merodiploid derivatives of HR1703 containing both the cat-disrupted and intact versions of the bhua locus. One of these transformants was then subcultured in brucella broth at 37 C with shaking and plated onto SBA. Following replica plating of the bacterial colonies obtained onto SBA and SBA containing 25 µg/ml ampicillin and 5 µg/ml chloramphenicol, colonies were selected that grew on SBA but not SBA supplemented with antibiotics. Reconstruction of the bhua locus in ampicillin- and chloramphenicol-sensitive derivatives of HR1703 derived in this manner was verified by PCR analysis of genomic DNA from these strains with bhua-, cat-, and pgemspecific primer sets. One of these derivatives was selected for further examination and given the designation HR1703RC. The smooth lipopolysaccharide phenotype of HR1703RC was verified by crystal violet dye exclusion. Capacity of the B. abortus strains to use heme as an iron source in vitro. Free iron was removed from the hemin stock solutions used for the iron source utilization assays using the 6

7 procedure described by Staggs and Perry (43). To test for the capacity of hemin to serve as an iron source, B. abortus strains were grown on SBA for 48 h at 37 C with 5% CO 2. Bacterial cells were harvested into PBS (ph 7.2) and adjusted to an OD 600nm of 0.15 (=10 9 CFU/ml). One hundred (100) µl of these bacterial cell suspensions were then added to 500 ml flasks containing 100 ml low iron minimal medium and the flasks incubated in a water bath at 37 C with shaking at 250 rpm. Following 96 h of growth the bacterial cultures were adjusted to an OD 600nm of 0.15 and 100 µl of the bacterial cell suspensions were mixed with 3 ml trypic soy broth (TSB) containing 0.7% agar and 300 µm EDDA. These mixtures were overlaid onto plates with TSB containing 1.5% agar and 300 µm EDDA. Seven (7) mm sterile filter paper (Whatman no. 3) disks were placed onto the plates and 10 µl of a 2 mm solution of hemin, a 20 mm solution of hemin or a 50 mm solution of FeCl 3 was added to the filter disks and the plates incubated for 96 h at 37 C with 5% CO 2. Following this incubation period, the diameter of the zone of bacterial growth around each filter disk was measured and recorded in millimeters. Construction of a bhua-lacz fusion and β-galactosidase assays. PCR with sequence-specific oligonucleotide primers (Fwd primer: ATAAGGCGACCTTACCGAG; Rev primer: GACGGTGGCAAGCAGAGA) was used to amplify a 445 bp fragment of genomic DNA from B. abortus This fragment, which contained approximately 260 bp upstream of the bhua ORF, was cloned into the EcoRV site upstream of the promoterless lacz gene in pmr15 (17). The resulting plasmid (designated pbhua-lacz) and pmr15 were introduced into B. abortus 2308 by electroporation. Derivatives of B. abortus 2308 carrying these plasmids were grown in the low iron minimal medium described by López-Goñi et al. (22) with and without the addition 7

8 of 50µM FeCl 3. β-galactosidase production by these cultures was measured using the procedures described by Miller (27). Relative quantification of specific transcript levels using real time reverse transcriptase PCR. Total cellular RNA was isolated from B. abortus 2308 following growth in low iron minimal medium and low iron minimal medium supplemented with 50 M FeCl 3 using a modification of the cesium chloride based method described by Martin et al. (25). Following harvest, the bacterial cells were resuspended in a buffer containing lysozyme [5 mg/ml lysozyme, 50 mm glucose, 25 mm TRIS (ph 8.0), and 10 mm EDTA in diethyl pyrocarbonate (DEPC) treated sterile distilled de-ionized water (ddh 2 O)] prior to lysis with SDS. After collection from the cesium chloride tubes, the RNA preparations were ethanol precipitated and treated with Turbo DNase (Ambion) following the manufacturer s instructions to remove residual contaminating DNA. Absence of DNA from the RNA preparations was confirmed by failure of the gene amplification reactions to generate a product detectable by agarose gel electrophoresis in the absence of reverse transcriptase in a reverse transcriptase-pcr (RT-PCR) reaction. Concentrations of RNA in the samples were determined by measuring the absorbance at 260 nm. The iscript cdna Synthesis Kit (Bio-Rad) was used to amplify 40 ng of RNA from these preparations into cdna for each following the manufacturer s instructions using the random primers supplied with the kit. These cdna preparations were then used as the templates in real time RT PCR analysis (34) to evaluate the relative levels of gene-specific mrna transcripts in the total cellular RNA preparations. Gene-specific oligonucleotide primers [bhua forward CGTTTCTCAAGCGCGTGGAAGT-3 ; bhua reverse - 5 -AGCGCATTAACGGTCTCGT 8

9 AGC-3 ; BAB1_0370 forward 5 - CGTGCTTGAAACCTATGACG-3 ; BAB1_0370 reverse 5 TGTTGATATCCATCAGCACCA-3 ; rpll forward - 5 -CAGAAGAAAAGACCGAATTC GA-3 ; rpll reverse - 5 -GCACTTCCTTGATCACGTTGAT-3 ] were designed to produce products of approximately bp in length. Primer binding efficiencies for these primer sets were determined using a standard curve and the Bio-Rad icycler. The randomly primed cdna preparations generated from the total cellular RNA preparations were used in reaction mixtures containing 25µl iq SYBR Green Supermix (Bio-Rad), 1.5µl of 5µM forward and reverse gene-specific primers, 21µl ddh 2 O, and 1µl cdna template per well. PCR conditions were 1 cycle of 95 C for 3 min (melting), followed by 35 cycles of 95 C for 10 s, 58 C for 15 s and 72 C for 15 s (amplification). Fluorescence data were collected with a Bio-Rad icycler during the elongation step. A melting curve analysis was performed after amplification to ensure the formation of a single product from the primer sets. Samples were assayed three times in triplicate with purified RNA without reverse transcriptase serving as a negative control on each reaction plate evaluated. The differences in the relative levels of the bhua- and BAB1_0370- specific transcripts present in the RNA preparations obtained under different experimental conditions were calculated using methods described by Pfaffl (34) using the rpll gene as an internal standard. This gene (designated BAB1_1265 in the B. abortus 2308 genome) encodes the ribosomal L7/L12 protein and its expression is constitutive in 2308 under the experimental conditions examined here. Survival and replication of the B. abortus strains in cultured murine macrophages. A modification of the methods described by Gee et al. (16) was used to evaluate the capacity of the B. abortus strains to survive and replicate in cultured resident peritoneal macrophages 9

10 obtained from BALB/c mice. Because unopsonized brucellae were used for these experiments the multiplicity of infection (MOI) was increased from 100:1 to 500:1 (bacteria:macrophage) to ensure uniform infection of the macrophage monolayer (B. H. Bellaire, personal communication). After addition of the bacteria, the cultured macrophages were subjected to centrifugation at 400 g at 4 C for 10 min to optimize contact of the unopsonized brucellae with the host cell monolayer and synchronize the infection. Experimental infection of BALB/c mice. Six-week old female BALB/c mice were infected via the peritoneal route with of B. abortus 2308, HR1703 (2308 bhua), or HR1703RC (HR1703 bhua + ). The number of brucellae present per spleen in the infected animals was determined at 1, 4, and 8 weeks post-infection as described previously (16). Statistical analysis. All statistical analyses were performed using the student two-tailed t test (40). P values 0.05 were considered significant. 10

11 Results Identification of a putative heme transporter in B. abortus Heme serves as an efficient iron source for both B. abortus 2308 (5) and B. melitensis 16M (11) in in vitro assays. Phenotypic analysis of a hemh mutant derived from B. abortus 2308 has also shown that the parental strain has the capacity to transport intact heme into the cytoplasm (2). Gram-negative bacteria that transport the intact heme molecule across both membranes generally rely upon TonB-dependent transporters to move this molecule across the outer membrane (33). A survey of the B. abortus 2308 genome sequence reveals only three genes predicted to encode TonBdependent outer membrane iron transporters, and only one of these is predicted to have the characteristics expected of a heme transporter. These characteristics include amino acid sequence homology and colinearity with other well characterized outer membrane heme transporters, the presence of amino acid motifs predicted to interact with TonB and the presence of conserved His residues corresponding to the His 128 and His 461 residues required for heme transport mediated by the HemR protein of Yersinia enterocolitica (7). The gene annotated as BAB2_1150 in the B. abortus 2308 genome sequence is predicted to encode a 661 amino acid protein that shares considerable amino acid identity, similarity and colinearity with other wellcharacterized bacterial TonB-dependent heme transporters including the Shigella dysenteriae ShuA (18% identity, 32% similarity) (28), Plesiomonas shigelloides HugA (19% identity, 32% similarity) (20), Yersinia pestis HmuR (18% identity, 31% similarity) (46), Yersinia enterocolitica HemR (19% identity, 31% similarity) (44), Bradyrhizobium japonicum HmuR (18% identity, 30% similarity) (30), and Vibrio vulnificus HupA (19% identity, 30% similarity) (21) proteins. Amino acid residues 29-37, , and of the Brucella ShuA homolog display significant homology with the consensus TonB boxes 1, 2, 3 and 4 (24) that are 11

12 characteristic of bacterial outer membrane heme transporters. More importantly, amino acid sequence alignments suggest that His 119 and His 448 of the Brucella ShuA homolog correspond to the His 128 and His 461 residues that are critical for heme transport by the Y. enterocolitica HemR protein (7) and are highly conserved in many other TonB-dependent outer membrane heme transporters of this class. Based on these features, the putative Brucella heme transporter was given the provisional designation BhuA (Brucella heme uptake A) and its corresponding gene the designation bhua. Genes homologous to bhua are also present in the genome sequences of B. abortus (BruAb2_1126), B. melitensis 16M (BMEII0105), and B. suis 1330 (BRA1190). RT-PCR analysis of total RNA from B. abortus 2308 with primers specific for the bhua coding region and flanking regions indicates that bhua is monocistronic (data not shown). The B. abortus bhua mutant cannot use heme as an iron source in vitro. The B. abortus bhua mutant retained its ability to use FeCl 3 (Table 1) and 2,3-DHBA (data not shown) as iron sources in an in vitro assay that employs a solid growth medium containing a chelator, but was unable to use hemin as an iron source. In contrast, the parental 2308 strain and HR1703RC exhibited robust growth around disks containing hemin on the chelator plates (Table 1). These experimental findings support the proposition that BhuA serves as a TonB-dependent heme transporter. Although the B. abortus bhua mutant was clearly able to use FeCl 3 as an iron source on the chelator plates, this strain produced smaller zones of growth around disks containing FeCl 3 than the parental 2308 strain or HR1703RC (Table 1). The physiologic basis for the smaller zone size is presently unknown, but does not appear to be the result of a generalized inability of the 12

13 the B. abortus bhua mutant to use FeCl 3 as an iron source since the addition of this compound to low iron minimal medium allows HR1703 to exhibit the same growth characteristics in this medium as 2308 and HR1703RC (Figure 1B). The B. abortus bhua mutant exhibits a stationary phase defect in iron acquisition. Although the B. abortus bhua mutant HR1703 consistently demonstrated a slightly different growth pattern than B. abortus 2308 or HR1703RC during cultivation in low iron minimal medium, all three of these strains reached stationary phase at approximately the same time post-inoculation and at the same cell density (Figure 1A). However, the B. abortus bhua mutant began to exhibit an accelerated loss of viability after approximately 144 hours culture in low iron minimal medium, but the parental 2308 strain and HR1703RC did not (Figure 1A). In contrast, this accelerated loss of stationary phase viability was not observed for the B. abortus bhua mutant when this strain was grown in low iron minimal medium supplemented with 50 µm FeCl 3 at the time of inoculation (Figure 1B). The addition of either FeCl 3 (Fe +++ ) or Fe(NH 4 ) 2 (SO 4 ) 2 (Fe ++ ) to cultures of the B. abortus bhua mutant after 96 h growth in low iron minimal medium also prevented the loss of stationary viability of this mutant (Figure 2). These experimental findings suggest that BhuA plays an important role in stationary phase iron acquisition in B. abortus The bhua gene exhibits maximum expression in B. abortus 2308 during stationary phase. Bacterial genes involved in heme transport are typically only expressed under conditions of iron limitation (33). Correspondingly, maximum levels of β-galactosidase production were observed in cultures of the B. abortus 2308 derivative carrying the plasmid-borne bhua-lacz fusion 13

14 grown under iron-deprived conditions (Figure 3) while growth under iron-replete conditions repressed β galactosidase production by this strain. During growth under iron-deprived conditions, bhua expression in B. abortus 2308 increases dramatically as this strain makes the transition into stationary phase. This profile of bhua expression B. abortus 2308 was verified by real time RT-PCR analysis of RNA obtained from cultures grown under iron-deprived and iron-replete conditions with bhua-specific primers (Figure 4). The dhbc gene was included as a positive control for the analysis shown in Figure 4A because it has been experimentally demonstrated using both Northern blots and gene fusions that dhbc exhibits maximal expression in response to iron deprivation in B. abortus 2308 (6). Similarly, the gene designated as BAB1_0370 in the B. abortus 2308 genome sequence displays neither iron-repression (Figure 4A) nor significant growth-phase induction in this bacterium and thus serves as a useful negative control for the analyses depicted in Figures 4A and 4B. The pattern of iron-repressible and stationary phase-maximal bhua expression shown in Figures 3 and 4 further support the proposition that BhuA plays an important role in stationary phase iron acquisition in B. abortus B. abortus 2308 requires BhuA for the maintenance of chronic spleen infection in experimentally infected BALB/c mice. To evaluate the potential role of BhuA in pathogenesis and at the same time to assess the relative importance of heme as an iron source for the brucellae during residence in a mammalian host, the virulence properties of B. abortus 2308, the bhua mutant HR1703 and the HR1703 derivative carrying the reconstructed bhua locus (HR1703RC) were examined in cultured murine macrophages and BALB/mice. The B. abortus bhua mutant exhibited significant attenuation compared to 2308 and HR1703RC in both macrophages (Figure 14

15 5) and mice (Figure 6). Considering the phenotype displayed by the B. abortus bhua mutant during cultivation under iron-deprived conditions in vitro (e.g. accelerated loss of stationary phase viability compared to 2308), it is noteworthy that 2308 and the bhua mutant were recovered in equivalent numbers from the spleens of experimentally infected mice at one week post infection, but accelerated clearance of the bhua mutant from these spleens of these mice compared to 2308 begins at some point between one and four weeks post infection. These results suggest that B. abortus 2308 requires BhuA for the maintenance of chronic spleen infection in BALB/c mice rather than establishment of the infection. 15

16 Discussion There is a considerable flux of heme and heme containing compounds through macrophages due to their central role in heme recycling in the host (10). When the macrophages engulf and degrade senescent erythrocytes (8), hemoglobin and heme are released into the macrophage. These phagocytes also work in concert with hemopexin and haptoglobin to scavenge heme and hemoglobin released from damaged cells before these latter compounds reach toxic levels (45). Consequently, it has been postulated that heme may represent a biologically relevant iron source for the brucellae during their intracellular residence in host macrophages (39). The experimental findings presented here support the proposition that BhuA serves as the TonB-dependent outer membrane component of a heme transport system in B. abortus More importantly, the significant attenuation exhibited by the B. abortus bhua mutant in cultured murine macrophages and experimentally infected mice indicates that heme serves as a critical iron source for this bacterium in vivo. The link between BhuA and the maintenance of stationary phase viability in B. abortus 2308 during cultivation under iron deprived conditions is intriguing and potentially informative with regard to the relative importance of heme as an iron source for this bacterium. Laboratory studies (5,11,12,22) and surveys of genome sequences (39) indicate that the Brucella spp. possess multiple iron acquisition pathways that transport different iron sources, yet none of the other iron-acquisition systems present in B. abortus 2308 has the capacity to compensate for the loss of BhuA during prolonged iron deprivation once this bacterium has made the transition into stationary phase physiology. One possible explanation for these experimental findings is that the ability to transport heme allows B. abortus 2308 to incorporate this heme directly into the hemecontaining proteins that play important roles in the maintenance of stationary phase physiology 16

17 such as the bd type cytochromes (15). This would save the brucellae the energetic expense of having to synthesize the protoporphyrin IX backbone of heme and lessen the overall need for this bacterium to transport iron. The B. abortus bhua mutant, in contrast, might be able to rely upon its other iron transport systems to meet its physiologic needs for iron during growth under iron-replete conditions. The experimental results presented here would also indicate that the bhua mutant can use these other iron transport systems to meets its physiological need for iron during exponential growth under iron-deprived conditions. However, these other iron transport systems do not appear to be able to supply the bhua mutant with sufficient levels of iron to produce the full repertoire of iron-containing proteins needed for long-term survival during stationary phase when this strain is subjected to iron deprivation. BhuA shares many of the features of TonB-dependent outer membrane heme transporters described in other bacteria, but this protein and its encoding gene also have a couple of unusual characteristics. Although BhuA possesses the conserved histidine residues that have been shown to be required for wild-type heme transport by the Yersinia enterocolitica HemR (7) and are conserved in most of the bacterial TonB-dependent outer membrane heme transporters that have been described, BhuA does not have the conserved amino acid motifs FRAP and NPNL that are present in most of these proteins (33). The biological significance of the absence of these latter domains in the Brucella BhuA is unknown. In many Gram-negative bacteria that use heme as an iron source, the genes that encode the periplasmic binding protein-dependent ABC transporter that transports heme across the cytoplasmic membrane are also located in an operon with the gene that encodes the TonB-dependent outer membrane transporter. This does not appear to be the case in the Brucella spp.. In B. abortus 2308 the bhua gene is monocistronic, and the genes that are predicted to be involved in the transport of heme across the cytoplasmic membrane in 17

18 this bacterium are located in an operon distant from the bhua locus. Not surprisingly, these latter genes (annotated as BAB2_ in the B. abortus 2308 genome sequence) are homologs of the shut, U and V genes of Shigella dysenteriae (49). This same genetic organization (e.g. physical separation of bhua and the shut, U and V homologs) is conserved in the genome sequences of B. abortus 9-941, B. melitensis 16M and B. suis Whether or not the Brucella shut, U and V homologs function in heme transport is presently under evaluation. Although the contributions of numerous bacterial heme transporters to virulence have been examined using a variety of animal models and cell cultures (26,29,35,42,46,47,48), few bacterial heme transporters exhibit as strong a link to virulence as that displayed between BhuA and virulence of B. abortus 2308 in the mouse model. In fact, the experimental findings reported here strongly suggest that heme represents a critical, and possibly indispensable, iron source for this bacterium during chronic infection. Iron acquisition mediated by BhuA also appears to be essential for the prolonged maintenance of stationary phase viability when B. abortus 2308 is cultivated under iron deprived conditions in vitro. It has been proposed that stationary phase physiology plays an important role in allowing the brucellae to maintain long term intracellular residence in host macrophages (37), and the phenotype exhibited by the B. abortus bhua mutant supports this proposal. Consequently, gaining a better understanding of the physiologic basis for why heme represents such an important iron source for B. abortus 2308 during stationary phase should provide important insight with regard to the mechanisms by which this bacterium produces disease in the host. 18

19 Acknowledgements This work was supported by grants from the United States Department of Agriculture s National Research Initiative Competitive Grants Program ( ) and the National Institute of Allergy and Infectious Disease (AI 63516) to R. M. R. II. The authors thank Bob Perry for his advice regarding the in vitro assays for hemin utilization. 19

20 References 1. Acha, P. N., and B. Szyfres Zoonoses and communicable diseases common to man and animals, p Pan American Health Organization, Washington, D.C. 2. Almirón, M., M. Martínez, N. Sanjuan, and R. A. Ugalde Ferrochelatase is present in Brucella abortus and is critical for its intracellular survival and virulence. Infect. Immun. 69: Alton, G. G., L. M. Jones, R. D. Angus, and J. M. Verger Techniques for the brucellosis laboratory. Institut National de la Recherche Agronomique, Paris, France. 4. Bellaire, B. H., P. H. Elzer, C. L. Baldwin, and R. M. Roop II The siderophore 2,3- dihydroxybenzoic acid is not required for virulence of Brucella abortus in BALB/c mice. Infect. Immun. 67: Bellaire, B. H Ph.D. thesis. Louisiana State University Health Sciences Center Shreveport. 6. Bellaire, B. H., P. E. Elzer, S. Hagius, J. Walker, C. L. Baldwin, and R. M. Roop II Genetic organization and iron-responsive regulation of the Brucella abortus 2,3- dihydroxybenzoic acid biosynthesis operon, a cluster of genes required for wild-type virulence in pregnant cattle. Infect. Immun. 71: Bracken, C. S., M. T. Baer, A. Abdur-Rashid, W. Helms, and I. Stojiljkovic Use of hemin-protein complexes by the Yersinia enterocolitica HemR receptor: histidine residues are essential for receptor function. J. Bacteriol. 181:

21 8. Bratosin, D., J. Mazurier, J. P. Tissier, J. Estaquier, J. J. Huart, J. C. Amiesen, D. Aminoff, and J. Montreuil Cellular and molecular mechanisms of senescent erythrocyte phagocytosis by macrophages. Biochimie 80: Chain, P. S. G., D. J. Comerci, M. E. Tomalsky, F. W. Larimer, S. A. Malfatti, L. M. Vergez, F. Aguero, M.L. Land, R. A. Ugalde, and E. Garcia Whole-genome analyses of speciation events in pathogenic brucellae. Infect. Immun. 73: Crichton, R. R., S. Wilmet, R. Legssyer, and R. J. Ward Molecular and cellular mechanisms of iron homeostasis and toxicity in mammalian cells. J. Inorg. Biochem. 91: Danese, I Ph.D. thesis. Facultes Universitaires Notre-Dame de la Paix Namur. 12. Danese, I., V. Haine, R.-M. Delrue, A. Tibor, P. Lestrate, O. Stevaux, P. Mertens, J.-Y. Paquet, J. Godfroid, X. de Bolle, and J.-J. Letesson The Ton system, an ABC transporter, and a universally conserved GTPase are involved in iron utilization by Brucella melitensis 16M. Infect. Immun. 72: del Vecchio, V. G., V. Kapatral, R. J. Redkar, G. Patra, C. Mujer, T. Los, N. Ivanova, I. Anderson, A. Bahattacharyya, A. Lykidis, G. Reznik, L. Jablonski, N. Larsen, M. D Souza, A. Bernal, M. Mazur, E. Goltsman, E. Selkov, P.H. Elzer, S. Hagius, D. O Callaghan, J. J. Letesson, R. Haselkorn, N. Kyrpides, and R. Overbeek The genome sequence of the facultative intracellular pathogen Brucella melitensis. Proc. Natl. Acad. Sci. U.S.A. 99: Elzer, P. H., R. W. Phillips, M. E. Kovach, K. M. Peterson, and R. M. Roop II Characterization and genetic complementation of a Brucella abortus high-temperaturerequirement A (htra) deletion mutant. Infect. Immun. 62:

22 15. Endley, S., D. McMurray, and T. A. Ficht Interruption of the cydb locus in Brucella abortus attenuates intracellular survival and virulence in the mouse model of infection. J. Bacteriol. 183: Gee, J.M., M. W. Valderas, M. E. Kovach, V. K. Grippe, G. T. Robertson, W.-L. Ng, J. M. Richardson, M. E. Winkler, and R. M. Roop II The Brucella abortus Cu/Zn superoxide dismutase is required for optimal resistance to oxidative killing by murine macrophages and wild-type virulence in experimentally infected mice. Infect. Immun. 73: Gober, J. W., and L. Shapiro A developmentally regulated Caulobacter flagellar promoter is activated by 3 enhancer and IHF binding elements. Mol. Biol. Cell 3: González-Carreró, M. I., F. J. Sangari, J. Agüero, and J. M. García Lobo Brucella abortus 2308 produces brucebactin, a highly efficient catecholic siderophore. Microbiology 148: Halling, S. M., B. D. Peterson-Burch, B. J. Bricker, R. L. Zuerner, Z. Zing, L. L. Li, V. Kapur, D. P. Alt, and S. C. Olsen Completion of the genome sequence of Brucella abortus and comparison to the highly similar genomes of Brucella melitensis and Brucella suis. J. Bacteriol. 187: Henderson, D. P., E. E. Wyckoff, C. E. Rashidi, H. Verlei, and A. L. Oldham Characterization of the Plesiomonas shigelloides genes encoding the heme iron utilization system. J. Bacteriol. 183: Litwin, C. M., and B. L. Byrne Cloning and characterization of an outer membrane protein of Vibrio vulnificus required for heme utilization: regulation of expression and determination of the gene sequence. Infect. Immun. 66:

23 22. López-Goñi, I., I. Moriyón, and J. B. Neilands Identification of 2,3- dihydroxybenzoic acid as a Brucella abortus siderophore. Infect. Immun. 60: López-Goñi, I., and I. Moriyón Production of 2,3-dihydroxybenzoic acid by Brucella species. Curr. Microbiol. 31: Lundrigan, M. D., and R. J. Kadner Nucleotide sequence of the gene for the ferrienterochelin receptor FepA in Escherichia coli. J. Biol. Chem. 261: Martin, D. W., M. J. Schurr, and V. Deretic Analysis of promoters controlled by the putative sigma factor AlgU regulating conversion to mucoidy in Pseudomonas aeruginosa: relationship to σ E and stress response. J. Bacteriol. 176: Mey, A. R., and S. M. Payne Haem utilization in Vibrio cholerae involves multiple TonB-dependent haem receptors. Mol. Microbiol. 42: Miller, J. H Experiments in molecular genetics. Cold Spring Harbor Laboratory. Cold Spring Harbor., N.Y. 28. Mills, M., and S. M. Payne Identification of shua, the gene encoding the heme receptor of Shigella dysenteriae, and analysis of invasion and intracellular multiplication of a shua mutant. Infect. Immun. 65: Murphy, E. R., E. Sacco, A. Dickenson, D. J. Metzger, Y. Hu, P. E. Orndorff, and T. D. Connell BhuR, a virulence-associated outer membrane protein of Bordetella avium, is required for the acquisition of iron from heme and hemoproteins. Infect. Immun. 70: Nienaber, A., H. Hennecke, and H.-M. Fischer Discovery of a haem uptake system in the soil bacterium Bradyrhizobium japonicum. Mol. Microbiol. 41:

24 31. Parent, M. A., B. H. Bellaire, E. A. Murphy, R. M. Roop II, P. H. Elzer, and C. L. Baldwin Brucella abortus siderophore 2,3-dihydroxybenzoic acid (DHBA) facilitates intracellular survival of the bacteria. Microb. Pathogen. 32: Paulsen, I. T., R. Seshadri, K. E. Nelson, J. A. Eisen, J. F. Heidelberg, T. D. Read, R. J. Dodson, L. Umayam, L. M. Brinkac, M. J. Beanan, S. C. Daugherty, R. T. Deboy, A. S. Durkin, J. F. Dolonay, R. Madupu, W. C. Nelson, B. Ayodeji, M. Kraul, J. Shetty, J. Malek, S. E. Van Aken, S. Riedmuller, H. Tettelin, S. R. Gill, O. White, S. L. Salzberg, D. L. Hoover, L. E. Lindler, S. M. Halling, S. M. Boyle, and C. M. Fraser The Brucella suis genome reveals fundamental similarities between animal and plant pathogens and symbionts. Proc. Natl. Acad. Sci. U.S.A. 99: Perkins-Balding, D., A. Rasmussen, and I. Stojiljkovic Bacterial heme and hemoprotein receptors, p In: J. H. Crosa, A. R. Mey and S. M. Payne (ed.), Iron transport in bacteria. American Society for Microbiology, Washington, DC. 34. Pfaffl, M.W A new mathematical model for relative quantification in real-time RT- PCR. Nucleic Acids Res. 29: Reeves. S. A., A. G. Torres, and S. M. Payne TonB is required for intracellular growth and virulence of Shigella dysenteriae. Infect. Immun. 68: Robertson, G. T., M. E. Kovach, C. A. Allen, T. A. Ficht, and R. M. Roop II The Brucella abortus Lon functions as a generalized stress response protease and is required for wild-type virulence in BALB/c mice. Mol. Microbiol. 35: Roop, R. M. II, J. M. Gee, G. T. Robertson, J. M. Richardson, W.-L. Ng, and M. E. Winkler Brucella stationary phase gene expression and virulence. Annu. Rev. Microbiol. 57:

25 38. Roop, R. M. II, B. H. Bellaire, M. W. Valderas, and J. A. Cardelli Adaptation of the brucellae to their intracellular niche. Mol. Microbiol. 52: Roop, R. M. II, B. H. Bellaire, E. Anderson, and J. T. Paulley Iron metabolism in Brucella, pp In: I. López-Goñi, and I. Moriyón (ed.), Brucella: molecular and cellular biology, Horizon Bioscience, Norfolk, UK. 40. Rosner, B Fundamentals of biostatistics, 5 th ed. Duxbury, Pacific Grove, Calif. 41. Schaible, U. E., and S. H. E. Kaufmann Iron and microbial infection. Nature Rev. Microbiol. 3: Seale, T. W., D. J. Morton, P.W. Whitby, R. Wolf, S.D. Kosanke, T. M. VanWagoner, and T. L. Stull Complex role of hemoglobin and hemoglobin-haptoglobin binding proteins in Haemophilus influenzae virulence in the infant rat model of invasive infection. Infect. Immun. 74: Staggs, T. M., and R. D. Perry Identification and cloning of a fur regulatory gene in Yersinia pestis. J. Bacteriol. 173: Stojiljkovic, I., and K. Hantke Hemin uptake system of Yersinia enterocolitica: similarities with other TonB-dependent systems in gram-negative bacteria. EMBO J. 11: Taketani, S Acquisition, mobilization and utilization of cellular iron and heme: endless findings and growing evidence of tight regulation. Tohoku J. Exp. Med. 205: Thompson, J. M., H. A. Jones, and R. D. Perry Molecular characterization of the hemin uptake locus (hmu) from Yersinia pestis and analysis of hmu mutants for hemin and hemoprotein utilization. Infect. Immun. 67:

26 47. Torres, A. G., P. Redford, R. A. Welch, and S. M. Payne TonB-dependent systems of uropathogenic Escherichia coli: aerobactin and heme transport and TonB are required for virulence in the mouse. Infect. Immun. 69: Torres, V. J., G. Pishchany, M. Humayun, O. Schneewind, and E. P. Skaar Staphylococcus aureus IsdB is a hemoglobin receptor require for heme iron utilization. J. Bacteriol. 188: Wyckoff, E. E., D. Duncan, A. G. Torres, M. Mills, and S. M. Payne Structure of the Shigella dysenteriae haem transport locus and its phylogenetic distribution in enteric bacteria. Mol. Microbiol. 28:

27 Figure Legends Figure 1. Growth and viability of B. abortus 2308 (diamonds), HR1703 (2308 bhua) (squares), and HR1703RC (HR1703 bhua +) (triangles) in (A) low iron minimal medium and (B) low iron minimal medium containing 50 µm FeCl 3. The results presented are means and standard deviations for triplicate determinations from a single flask for each strain at each experimental time point in a single experiment. * = P <0.05 for comparisons of the data obtained for HR1703 vs and HR1703RC in the experiment presented in this figure. The data presented are representative of multiple ( 3) experiments performed from which equivalent results and statistical trends were obtained. Figure 2. Growth and viability of the B. abortus bhua mutant HR1703 in low iron minimal medium (squares) or this medium supplemented with 50 µm FeCl 3 (diamonds) or 50 µm Fe(NH 4 ) 2 (SO 4 ) 2 (triangles) at 96 hours post inoculation. The arrow denotes the time of addition of FeCl 3 and Fe(NH 4 ) 2 (SO 4 ) 2 to the bacterial cultures. The results presented are means and standard deviations for triplicate determinations from a single flask for each strain at each experimental time point in a single experiment. * = P <0.05 for comparisons of the unsupplemented HR1703 culture vs. cultures of this strain supplemented with FeCl 3 or Fe(NH 4 ) 2 (SO 4 ) 2 in the experiment presented in this figure. The data presented are representative of multiple ( 3) experiments performed from which equivalent results and statistical trends were obtained. Figure 3. Expression of a bhua-lacz fusion in B. abortus 2308 during growth in low iron minimal medium (black bars) and low iron minimal medium supplemented with 50 µm FeCl 3 27

28 (white bars). β galactosidase activity is presented on the y-axis in Miller units (27). The results presented are means and standard deviations for triplicate determinations from a single culture for each strain at each experimental time point in a single experiment. The data presented are representative of multiple ( 3) experiments performed from which equivalent results and statistical trends were obtained. β galactosidase levels produced by the base pmr15 plasmid in B. abortus 2308 during growth in low iron minimal medium or this medium supplemented with 50 µm FeCl 3 never exceeded 200 Miller units in these assays (data not shown). Figure 4. Elevated levels of bhua transcripts are present in B. abortus 2308 in response to (A) iron deprivation and (B) the transition into stationary phase during growth under iron-limiting conditions. Fold induction in response to iron deprivation represents the difference between the levels of bhua, dhbc and BAB1_0370 transcripts detected by real time RT-PCR in RNA preparations from B. abortus 2308 cultures at 96 hours growth in low iron minimal medium or low iron minimal medium supplemented with 50 µm FeCl 3. The open bars in part B of this figure represent the levels of BAB1_0370 transcripts and the cross-hatched bars denote the levels of bhua transcripts detected by real time RT-PCR in RNA preparations from B. abortus 2308 after 72, 96 and 120 hours growth in low iron minimal medium compared to the levels of these transcripts detected in RNA preparations obtained from this strain after 48 hours cultivation in low iron minimal medium. The results presented are means and standard deviations for triplicate determinations for each gene at each experimental time point in a single experiment. The results presented are representative of three separate experiments performed from which equivalent results were obtained. 28

29 Figure 5. Survival and replication of B. abortus 2308 (triangles), HR1703 (2308 bhua) (squares), and HR1703RC (HR1703 bhua +) (diamonds) in cultured resident peritoneal macrophages from BALB/c mice. The results presented are means and standard deviations for the number of intracellular brucellae recovered for each strain from three separate wells of cultured macrophages at each experimental time point in a single experiment. * = P <0.05 and ** = P <0.01 for comparisons of the data obtained for HR1703 vs and HR1703RC in the experiment presented in this figure. The data presented are representative of multiple ( 3) experiments performed from which equivalent results and statistical trends were obtained. Figure 6. Spleen colonization profiles for B. abortus 2308 (diamonds), HR1703 (2308 bhua) (squares), and HR1703RC (HR1703 bhua +) (triangles) in experimentally infected BALB/c mice. The results presented are means and standard deviations for the number of brucellae detected in the spleens of five mice infected with each strain at each experimental time point in a single experiment. * = P <0.05 and ** = P <0.01 for comparisons of the data obtained for HR1703 vs and HR1703RC. 29

30 Table 1. Capacity of B. abortus 2308, HR1703 (2308 bhua) and HR1703RC (HR1703 bhua + ) to use hemin and FeCl 3 as iron sources. Strain 2 mm hemin 20 mm hemin FeCl ± 2.5 a** 32.7 ± 1.2 *** 52.7 ± 2.1 HR1703 NG b NG b ± 1.3 HR1703RC 19.7 ± 1.5 *** 30.3 ± 1.5 *** 51.7 ± 3.8 a The diameters of the zones of bacterial growth on TSB supplemented with 300 µm EDDA around filter disks impregnated with 10 µl of a 2 mm solution of hemin, a 20 mm solution of hemin or a 50 mm solution of FeCl 3 were measured after 96 h incubation at 37 C with 5% CO 2 and recorded in mm. The values presented in this table are the means and standard deviations of the average zone sizes obtained from three separate experiments and three separate determinations of growth were obtained for each strain in each experiment. b NG = no growth no zone one of bacterial growth was observed surrounding the disks impregnated with either concentration of hemin for B. abortus HR1703. Significance - ** = P 0.01 and *** = P for comparisons of HR1703 vs and HR1703RC. 30

31 Log10 CFU/ml Log10 CFU/ml Hours Hours * * * Paulley et al. Figure 1 33

32 Log10 CFU/ml Hours * * Paulley et al. Figure 2 34

33 β-galactosidase activity Hours Paulley et al. Figure 3 35

34 A) B) Fold Induction Paulley et al. Figure 4 0 Fold Induction BAB1_0307 bhua dhbc

35 Log 10 intracellular brucellae * Hours post infection ** Paulley et al. Figure 5 37

36 Log10 brucellae/spleen ** Weeks post infection ** Paulley et al. Figure 6 38