List of new names and new combinations previously effectively, but not validly, published

Size: px
Start display at page:

Download "List of new names and new combinations previously effectively, but not validly, published"

Transcription

1 International Journal of Systematic and Evolutionary Microbiology (2015), 65, DOI /ijs Validation List no. 164 Correspondence Aharon Oren George M. Garrity List of new names and new combinations previously effectively, but not validly, published Aharon Oren 1 and George M. Garrity 2 1 The Institute of Life Sciences, The Hebrew University of Jerusalem, The Edmond J. Safra Campus, Givat Ram, Jerusalem, Israel 2 Department of Microbiology & Molecular Genetics, Biomedical Physical Sciences, Michigan State University, East Lansing, MI , USA The purpose of this announcement is to effect the valid publication of the following effectively published new names and new combinations under the procedure described in the Bacteriological Code (1990 Revision). Authors and other individuals wishing to have new names and/or combinations included in future lists should send three copies of the pertinent reprint or photocopies thereof, or an electronic copy of the published paper to the IJSEM Editorial Office for confirmation that all of the other requirements for valid publication have been met. It is also a requirement of IJSEM and the ICSP that authors of new species, new subspecies and new combinations provide evidence that types are deposited in two recognized culture collections in two different countries. It should be noted that the date of valid publication of these new names and combinations is the date of publication of this list, not the date of the original publication of the names and combinations. The authors of the new names and combinations are as given below. Inclusion of a name on these lists validates the publication of the name and thereby makes it available in the nomenclature of prokaryotes. The inclusion of a name on this list is not to be construed as taxonomic acceptance of the taxon to which the name is applied. Indeed, some of these names may, in time, be shown to be synonyms, or the organisms may be transferred to another genus, thus necessitating the creation of a new combination. Actibacterium atlanticum Li et al. 2014, 329 sp. nov. 22II-S11-z10 (5LMG MCCC 1A09298) Actinopolysporales Goodfellow and Trujillo ord. nov. Actinopolyspora , 162d Aquimarina penaei Li et al. 2014, 1227 sp. nov. P3-1 (5LMG MCCC A09871) Arcobacter aquimarinus Levican et al. 2015, sp. nov. W63 (5CECT 84425LMG 27923) Arcobacter ebronensis Levican et al. 2015, 31 sp. nov. F128-2 (5CECT 84415LMG ) Bifidobacterium commune Praet et al. 2015, sp. nov. LMG (5DSM 28792) Bosea vaviloviae Safronova et al. 2015, 917 sp. nov. Vaf-18 (5LMG RCAM ) Caldisalinibacter Ben Hania et al. 2015, 353 gen. nov. Caldisalinibacter kiritimatiensis 35 2 Caldisalinibacter kiritimatiensis Ben Hania sp. nov. L21-TH-D2 (5DSM JCM 35 2 et al. 2015, ) Catenulisporales Donadio et al. 2012, 225" ord. nov. Catenulispora 6 4 Cellvibrionaceae Spring et al. 2015, 13# ** fam. nov. Cellvibrio Cellvibrionales Spring et al. 2015, 13# ord. nov. Cellvibrio Chlamydia abortus (Everett et al. 1999) Sachse et al. 2015, 102 Chlamydophila abortus Everett et al. 1999) B577 (5ATCC VR-6565DSM 27654) G 2015 IUMS Printed in Great Britain 2017

2 Chlamydia avium Sachse et al. 2014, 86 sp. nov. 10DC88 (5CSUR P35085DSM ) Chlamydia felis (Everett et al. 1999) Sachse FP Baker (5ATCC VR-1205DSM et al. 2015, 102 Chlamydophila felis Everett et al. 1999) 26967) Chlamydia gallinacea Sachse et al. 2014, 87 sp. nov /3 (5CSUR P35095DSM 27451) Chromobacterium amazonense Menezes sp. nov. CBMAI 310 (5DSM 26508) et al. 2015, 1062 Chryseobacterium profundimaris Xu et al. sp. nov. DY46 (5CGMCC JCM , ) Convivina Praet et al. 2015, 1346 gen. nov. Convivina intestini Convivina intestini Praet et al. 2015, 1346 sp. nov. LMG (5DSM 28795)DD Corynebacteriales Goodfellow and Jones ord. nov. Corynebacterium , 235dd Edwardsiella anguillarum Shao et al. 2015, sp. nov. ET (5CCUG DSM MCCC 1K00238) Emcibacter Liu et al. 2015, 899 gen. nov. Emcibacter nanhaiensis Emcibacter nanhaiensis Liu et al. 2015, 899 sp. nov. HTCJW17 (5CGMCC LMG 27419)"" Enterobacillus Patil et al. 2015, 1214 gen. nov. Enterobacillus tribolii## Enterobacillus tribolii Patil et al. 2015, 1215 sp. nov. IG-V01 (5KCTC MCC ) Flavobacterium seoulense Shin et al. 2014, 6# sp. nov. EM1321 (5JCM KACC ) Glycomycetales Labeda 2012, 546DDD ord. nov. Glycomyces 6 19 Halieaceae Spring et al. 2015, 13# ddd fam. nov. Haliea Halodurantibacterium Lv et al. 2015, 147 gen. nov. Halodurantibacterium flavum 7 30 Halodurantibacterium flavum Lv et al. 2015, sp. nov. DQW12E (5CGMCC LMG 27742) Idiomarina atlantica Du et al. 2015, 399 sp. nov. G5_TVMV8_7 (5KCTC MCCC 1A10513) Jiangellales Tang et al. 2012, 555 ord. nov. Jiangella 6 48 Keratinibaculum Huang et al. 2013, 61 gen. nov. Keratinibaculum paraultunense""" Keratinibaculum paraultunense Huang et al. sp. nov. KD-1 (5DSM JCM , ) Kineosporiales Kämpfer 2012, 561### ord. nov. Kineosporia 6 17 Kushneria pakistanensis Bangash et al. 2015, sp. nov. NCCP-934 (5LMG KCTC **** 42082)DDDD Lactobacillus bombicola Praet et al. 2015, sp. nov. LMG (5DSM 28793)dddd Marinobacter shengliensis Luo et al. 2015, sp. nov. SL013A34A2 (5CGMCC LMG 27740) Methyloglobulus Deutzmann et al. 2014, 168 gen. nov. Methyloglobulus morosus 1 3 Methyloglobulus morosus Deutzmann et al. sp. nov. KoM1 (5DSM JCM , ) Microbulbiferaceae Spring et al. 2015, 14# fam. nov. Microbulbifer Micromonosporales Genilloud 2012, 1035 ord. nov. Micromonospora 6 8 Negadavirga Hu et al. 2015, 670"""" gen. nov. Negadavirga shengliensis#### Negadavirga shengliensis Hu et al. 2015, sp. nov. SLG (5CGMCC #### LMG 27737)***** Nocardia casuarinae Ghodhbane-Gtari et al. sp. nov. BMG51109a (5CECT 84695DSM , 1104DDDDD 45978) Oricola Hameed et al. 2015, 767 gen. nov. Oricola cellulosilytica International Journal of Systematic and Evolutionary Microbiology 65

3 Oricola cellulosilytica Hameed et al. 2015, sp. nov. CC-AMH-0 (5BCRC JCM 19534) Paraburkholderia Sawana et al. 2014, 19# gen. nov. Paraburkholderia graminis Paraburkholderia andropogonis (Gillis et al. 1995) Sawana et al. 2014, 14# comb. nov. (basonym: Burkholderia andropogonis Gillis et al. 1995) ATCC (5DSM 9511)ddddd Paraburkholderia bannensis (Aizawa et al. 2011) Sawana et al. 2014, 14# Paraburkholderia bryophila (Vandamme et al. 2007) Sawana et al. 2014, 14# Paraburkholderia caledonica (Coenye et al. 2001) Sawana et al. 2014, 14# Paraburkholderia caribensis (Achouak et al. 1999) Sawana et al. 2014, 14# Paraburkholderia caryophylli (Yabuuchi et al. 1993) Sawana et al. 2014, 14# Paraburkholderia diazotrophica (Sheu et al. 2013) Sawana et al. 2014, 15# Paraburkholderia endofungorum (Partida- Martinez et al. 2007) Sawana et al. 2014, 15# Paraburkholderia ferrariae (Valverde et al. 2006) Sawana et al. 2014, 15# Paraburkholderia fungorum (Coenye et al. 2001) Sawana et al. 2014, 15# Paraburkholderia ginsengisoli (Kim et al. 2006) Sawana et al. 2014, 15# Paraburkholderia glathei (Vandamme et al. 1997) Sawana et al. 2014, 15# Paraburkholderia graminis (Viallard et al. 1998) Sawana et al. 2014, 15# Paraburkholderia grimmiae (Tian et al. 2013) Sawana et al. 2014, 16# Paraburkholderia hospita (Goris et al. 2003) Sawana et al. 2014, 16# Paraburkholderia kururiensis (Zhang et al. 2000) Sawana et al. 2014, 16# Paraburkholderia megapolitana (Vandamme et al. 2007) Sawana et al. 2014, 16# Burkholderia bannensis Aizawa et al. 2011) Burkholderia bryophila Vandamme et al. 2007) Burkholderia caledonica Coenye et al. 2001) Burkholderia caribensis Achouak et al. 1999) Burkholderia caryophylli Yabuuchi et al. 1993) Burkholderia diazotrophica Sheu et al. 2013) Burkholderia endofungorum Partida-Martinez et al. 2007) Burkholderia ferrariae Valverde et al. 2006) Burkholderia fungorum Coenye et al. 2001) Burkholderia ginsengisoli Kim et al. 2006) Burkholderia glathei Vandamme et al. 1997) Burkholderia graminis Viallard et al. 1998) Burkholderia grimmiae Tian et al. 2013) Burkholderia hospita Goris et al. 2003) Burkholderia kururiensis Zhang et al. 2000) Burkholderia megapolitana Vandamme et al. 2007) E25 (5BCC NBRC ) 1S18 (5CCUG LMG 23644) W50D (5ATCC BAA-4625DSM 17062)ddddd MWAP64 (5CCUG DSM 13236)ddddd ATCC (5DSM 50341)ddddd JPY461 (5KCTC LMG 26031)ddddd HKI 456 (5CIP DSM 19003) FeGl01 (5DSM LMG 23612)ddddd Croize P763-2 (5CCUG DSM 17061)ddddd KMY03 (5CCUG LMG 24044)ddddd ATCC (5DSM LMG 14190)ddddd C4D1M (5CCUG DSM 17151)ddddd R27 (5DSM LMG 27580)ddddd LMG (5CCUG DSM 17164) KP23 (5CCUG DSM 13646)ddddd A3 (5CCUG LMG 23650)

4 Paraburkholderia mimosarum (Chen et al. 2006) Sawana et al. 2014, 16# Paraburkholderia nodosa (Chen et al. 2007) Sawana et al. 2014, 16# Paraburkholderia oxyphila (Otsuka et al. 2011) Sawana et al. 2014, 16# Paraburkholderia phenazinium (Viallard et al. 1998) Sawana et al. 2014, 16# Paraburkholderia phenoliruptrix (Coeyne et al. 2005) Sawana et al. 2014, 17# Paraburkholderia phymatum (Vandamme et al. 2003) Sawana et al. 2014, 17# Paraburkholderia phytofirmans (Sessitsch et al. 2005) Sawana et al. 2014, 17# Paraburkholderia rhizoxinica (Partida- Martinez et al. 2007) Sawana et al. 2014, 17# Paraburkholderia sabiae (Chen et al. 2008) Sawana et al. 2014, 17# Paraburkholderia sacchari (Bräner et al. 2001) Sawana et al. 2014, 17# Paraburkholderia sartisoli (Vanlaere et al. 2008) Sawana et al. 2014, 17# Paraburkholderia silvatlantica (Perin et al. 2006) Sawana et al. 2014, 17# Paraburkholderia soli (Yoo et al. 2007) Sawana et al. 2014, 17# Paraburkholderia sordidicola (Lim et al. 2003) Sawana et al. 2014, 17 # Paraburkholderia symbiotica (Sheu et al. 2012) Sawana et al. 2014, 18# Paraburkholderia terrae (Yang et al. 2006) Sawana et al. 2014, 18# Paraburkholderia terricola (Goris et al. 2003) Sawana et al. 2014, 18# Paraburkholderia tropica (Reis et al. 2004) Sawana et al. 2014, 18# Paraburkholderia tuberum (Vandamme et al. 2003) Sawana et al. 2014, 18# Burkholderia mimosarum Chen et al. 2006) Burkholderia nodosa Chen et al. 2007) Burkholderia oxyphila Otsuka et al. 2011) Burkholderia phenazinium Viallard et al. 1998) Burkholderia phenoliruptrix Coeyne et al. 2005) Burkholderia phymatum Vandamme et al. 2003) Burkholderia phytofirmans Sessitsch et al. 2005) Burkholderia rhizoxinica Partida- Martinez et al. 2007) Burkholderia sabiae Chen et al. 2008) Burkholderia sacchari Brämer et al. 2001) Burkholderia sartisoli Vanlaere et al. 2008) Burkholderia silvatlantica Perin et al. 2006) Burkholderia soli Yoo et al. 2007) Burkholderia sordidicola Lim et al. 2003) Burkholderia symbiotica Sheu et al. 2012) Burkholderia terrae Yang et al. 2006) Burkholderia terricola Goris et al. 2003) Burkholderia tropica Reis et al. 2004) Burkholderia tuberum Vandamme et al. 2003) PAS44 (5CCUG LMG 23256)ddddd Br3437 (5BCRC LMG 23741) OX-01 (5LMG NBRC )ddddd ATCC (5BCRC CCUG 46044)ddddd AC1100 (5DSM LMG 22037)ddddd STM815 (5CCUG DSM 17167)ddddd PsJN (5CCUG DSM 17436)ddddd HKI 454 (5CIP DSM 19002) Br3407 (5BCRC LMG 24235) CCT 6771 (5CCUG DSM 17165)ddddd RP 007 (5CCUG LMG 24000)ddddd SRMrh-20 (5CCUG LMG 23149)ddddd GP25-8 (5DSM LMG 24076)ddddd CCUG (5DSM 17212)ddddd JPY-345 (5BCRC KCTC 23309)ddddd KMY02 (5DSM NBRC )ddddd CCUG (5DSM 17221)ddddd Ppe8 (5DSM LMG 22274)ddddd STM678 (5CCUG DSM 18489)ddddd 2020 International Journal of Systematic and Evolutionary Microbiology 65

5 Paraburkholderia unamae (Caballero- Mellado et al. 2004) Sawana et al. 2014, 18# Paraburkholderia xenovorans (Goris et al. 2004) Sawana et al. 2014, 18# Burkholderia unamae Caballero- Mellado et al. 2004) Burkholderia xenovorans Goris et al. 2004) MTI-641 (5DSM LMG 22722) LB400 (5CCUG DSM 17367)ddddd Paradevosia Geng et al. 2015, 115 gen. nov. Paradevosia shaoguanensis 5 7 Paradevosia shaoguanensis Geng et al. 2015, sp. nov. J5-3 (5CGMCC LMG ) Pedobacter lotistagni Singh et al. 2015, 956 sp. nov. THG-DN6.8 (5JCM KCTC 42229) Porphyromonas pogonae Kawamura et al. sp. nov. PAGU 1787 (5MI , 108""""" 12885ATCC BAA-26435JCM 19732) Porticoccaceae Spring et al. 2015, 14# ##### fam. nov. Porticoccus Propionibacteriales Patrick and McDowell ord. nov. Propionibacterium , 1137 Pseudohongiella acticola Park et al. 2014, sp. nov. GBSW-5 (5CECT 86275KCTC ****** 42131) Pseudomonas asuensis Reddy and Garcia- sp. nov. CP (5LMG KCTC Pichel 2015, )DDDDDD Pseudomonas donghuensis Gao et al. 2015, sp. nov. HYS (5CCTCC AB dddddd NRRL B-59108) Pseudonocardiales Labeda and Goodfellow ord. nov. Pseudonocardia , 1301 Pseudooceanicola Lai et al. 2015, 1070 gen. nov. Pseudooceanicola atlanticus Pseudooceanicola antarcticus (Huo et al. Oceanicola Ar-45 (5CGMCC LMG ) Lai et al. 2015, 1073 antarcticus Huo et al. 2014) 27868) Pseudooceanicola atlanticus Lai et al. 2015, 1072 sp. nov. 22II-S11g (5KCTC LMG MCCC 1A09160) Pseudooceanicola batsensis (Cho and Giovannoni 2004) Lai et al. 2015, 1073 Oceanicola batsensis Cho and Giovannoni 2004) Oceanicola marinus Lin et al. 2007) Oceanicola nanhaiensis Gu et al. 2007) Oceanicola nitratireducens Zheng et al. 2010) HTCC2597 (5ATCC BAA- 8635DSM KCTC 12145) Pseudooceanicola marinus (Lin et al. 2007) Lai et al. 2015, 1073 AZO-C (5BCRC LMG 23705) Pseudooceanicola nanhaiensis (Gu et al. SS011B1-20 (5CGMCC ) ) Lai et al. 2015, 1073 Pseudooceanicola nitratireducens (Zheng JLT1210 (5CGMCC et al. 2010) Lai et al. 2015, LMG 24663) Rhizobium capsici Lin et al. 2015, 780 sp. nov. CC-SKC2 (5BCRC JCM ) Rhodopirellula caenicola Yoon et al. 2015, sp. nov. YM (5KCTC # NBRC ) Salisediminibacterium haloalkalitolerans sp. nov. 10nlg (5CGMCC KCTC Sultanpuram et al. 2015, ) Salisediminibacterium locisalis (Márquez comb. nov. (basonym Bacillus CG1 (5CCM 73705CECT et al. 2011) Sultanpuram et al. 2015, 559 locisalis Márquez et al. 2011) 71525CGMCC DSM 18085) Seohaeicola nanhaiensis Xie et al. 2014, 806 sp. nov. SS011A0-7#2-2 (5CGMCC LMG 27733) Sphingobium endophyticum corrig. Zhu sp. nov. GZGR-4 (5CCTCC AB et al. 2015, KCTC 32447) Spirochaeta lutea Shivani et al. 2015, 113 sp. nov. JC230 (5DSM KCTC ) Spongiibacteraceae Spring et al. 2015, 14# fam. nov. Spongiibacter """"""

6 Streptosporangiales Goodfellow 2012, ord. nov. Streptosporangium ###### Thioclava atlantica Lai et al. 2014, 923 sp. nov. 13D2W-2 (5LMG MCCC A02612) Thioclava indica Liu et al. 2015, 302 sp. nov. DT23-4 (5KCTC LMG MCCC 1A00513) Tropicihabitans Hamada et al. 2015, 1302 gen. nov. Tropicihabitans flavus Tropicihabitans flavus Hamada et al. 2015, sp. nov. PS (5InaCC A 5165NBRC ) Weissella bombi Praet et al. 2015, 1346 sp. nov. LMG (5DSM )******* Wenyingzhuangia heitensis Yoon and Kasai sp. nov. H-MN17 (5KCTC NBRC , ) Xanthomonas maliensis Triplett et al. 2015, 879DDDDDDD sp. nov. M97 (5CFBP 79425LMG 27592) For references to Validation Lists 1 71, see Int J Syst Bacteriol 49 (1999) Lists were published in Int J Syst Evol Microbiol 50 (2000) 3, 423, 949, 1415, 1699, 1953; and 51 (2001) 1, 263, 793, 1229, 1619, 1945; and 52 (2002) 3, 685, 1075, 1437, 1915; and 53 (2003) 1, 373, 627, 935, 1219, 1701; and 54 (2004) 1, 307, 631, 1005, 1425, 1909; and 55 (2005) 1, 547, 983, 1395, 1743, 2235; and 56 (2006) 1, 499, 925, 1459, 2025, 2507; and 57 (2007) 1, 433, 893, 1371, 1933, 2449; and 58 (2008) 1, 529, 1057, 1511, 1993, 2471; and 59 (2009) 1, 451, 923, 1555, 2129, 2647; and 60 (2010) 1, 469, 1009, 1477, 1985, 2509; and 61 (2011) 1, 475,1011, 1499, 2025, 2563; and 62 (2012) 1, 473, 1017, 1443, 2045, 2549; and 63 (2013) 1, 797, 1577, 2365, 3131, 3931, and 64 (2014) 1, 693, 1455, 2184, 3603; and 65 (2015), 1, 741, *Abbreviations of culture collections cited in this list can be found at DPriority number assigned according to the date the documentation and request for validation are received. dthe preferred syllabification is Ac.ti.no.po.ly.spo.ra9les. The documents received as proof of deposition of the type strain in the DSMZ and the LMG culture collections mention strain number H This number does not feature in the article in which the species is described. The preferred syllabification is va.vi.lo9vi.ae. "The preferred syllabification is Ca.te.nu.li.spo.ra9les. #The online open-access journal in which the name was effectively published does not have continuous page numbers for each volume. **The preferred syllabification is Cell.vi.bri.o.na.ce9ae. DDThe documents received as proof of deposition of the type strain in the DSMZ and the LMG culture collections mention strain number H This number does not feature in the article in which the species is described. ddthe preferred syllabification is Co.ry.ne.bac.te.ri.a9les. The etymology must be adjusted as follows: L. fem. gen. pl. anguillarum of eels. The effective publication states that the type strain was also deposited as CCTC AB , but no documentation was supplied. ""The effective publication states that the type strain was also deposited as MCCC 1A06723, but no documentation was supplied. ##The effective publication erroneously states that the type species is Enterobacillus tribolii IG-V01. ***The preferred syllabification is Fran.ki.a9les. DDDThe preferred syllabification is Gly.co.my.ce.ta9les. dddthe preferred syllabification is Ha.li.e.a.ce9ae. The preferred syllabification is at.lan9ti.ca. (L. fem. adj....). The preferred syllabification is Ji.ang.el.la9les. """The type species is Keratinibaculum paraultunense and not K. parault-unense as given in the effective publication. ###The preferred syllabification is Ki.ne.o.spo.ra9les. ****The etymology must state N.L. masc. adj. instead of N.L. fem. adj. DDDDThe effective publication states that the type strain was also deposited as JCM 18802, but no documentation was supplied. ddddthe documents received as proof of deposition of the type strain in the DSMZ and the LMG culture collections mention strain number H70-3. This number does not feature in the article in which the species is described. The preferred syllabification is Mi.cro.bul.bi.fe.ra.ce9ae. The preferred syllabification is Mi.cro.mo.no.spo.ra9les. """"The syllabification and etymology must be corrected as follows: Ne.ga.da.vir9ga. L. fem. n. virga a rod; N.L. fem. n. Negadavirga arbitrary name for a rod negative for oxidase activity. ####The erratum has Shengliensis instead of shengliensis [Hu et al., Antonie van Leeuwenhoek 107 (2015), 1367]. *****The incorrect LMG culture collection accession number given in the original publication was corrected in an erratum [Hu et al., Antonie van Leeuwenhoek 107 (2015), 1367] International Journal of Systematic and Evolutionary Microbiology 65

7 DDDDDThe etymology must state N.L. gen. n. instead of N.L. gen. N. dddddthe effective publication states that the type strains of the following species of the genus Paraburkholderia were deposited in additional culture collections, but no documentation was supplied: P. andropogonis: CCUG 32772, CFBP 2421, CIP , ICMP 2807, JCM 10487, LMG 2129, NCPPB 934, NRRL B-14296; P. caledonica: CCUG 42236, CIP , JCM 21561, LMG 19076, NBRC ; P. caribensis: CIP , LMG 18531; P. caryophylli: CCUG 20834, CFBP 2429, CFBP 3818, CIP , HAMBI 2159, ICMP 512; P. diazotrophica: NKMU-JPY461, BCRC 80259; P. ferrariae: CECT 7171; P. fungorum: CIP , JCM 21562, LMG 16225, NBRC ; P. ginsengisoli: KCTC 12389, NBRC ; P. glathei: CFBP 4791, CIP , JCM 10563; P. graminis: ATCC , CIP , LMG 18924; P. grimmiae: CGMCC ; P. kururiensis: ATCC , CIP , JCM 10599, LMG 19447; P. mimosarum: BCRC 17516; P. oxyphila: DSM 22550; P. phenazinium: CCUG 20836, CFBP 4793, CIP , DSM 10684, JCM 10564, LMG 2247, NCIMB 11027; P. phenoliruptrix: CCUG 48558; P. phymatum: LMG 21445; P. phytofirmans: LMG 22146; P. sacchari: CCUG 46032, CIP , IPT 101, LMG 19450; P. sartisoli: ICMP 13529; P. silvatlantica: ATCC BAA-1244; P. soli: KACC 11589; P. sordidicola: JCM 11778, KCTC 12081; P. symbiotica: NKMU-JPY-345, LMG 26032; P. terrae: KCTC 12388; P. terricola: LMG 20594; T. tropica: ATCC BAA-831; P. tuberum: LMG 21444; P. unamae: ATCC BAA-744, CIP ; P. xenovorans: LMG 21463, NRRL B The etymology must twice state N.L. fem. adj. instead of N.L. masc. adj. The etymology must state N.L. fem. adj. instead of masc. n. """""The preferred syllabification is po.go9nae. #####The preferred syllabification is Por.ti.co.coc.ca.ce9ae. ******The etymology must state L. n. acta seaside, shore instead of L. n. acta i seaside, shore. DDDDDDThe effective publication states that the type strain was also deposited as ATCC BAA-1264 and JCM 13501, but no documentation was supplied. ddddddthe preferred syllabification is dong.hu.en9sis. The preferred syllabification is Pseu.do.no.car.di.a9les. The List Editors have corrected endophyticus N.L. masc. adj. to endophyticum N.L. neut. adj. """"""The preferred syllabification is Spon.gi.i.bac.te.ra.ce9ae. ######The preferred syllabification is Strep.to.spo.ran.gi.a9les. *******The documents received as proof of deposition of the type strain in the DSMZ and the LMG culture collections mention strain number H This number does not feature in the article in which the species is described. DDDDDDDThe preferred syllabification is ma.li.en9sis. References 1. Bangash, A., Ahmed, I., Abbas, S., Kudo, T., Shahzad, A., Fujiwara, T. & Ohkuma, M. (2015). Kushneria pakistanensis sp. nov. a novel moderately halophilic bacterium isolated from rhizosphere of a plant (Saccharum spontaneum) growing in salt mines of the Karak area in Pakistan. Antonie van Leeuwenhoek 107, Ben Hania, W., Joseph, M., Fiebig, A., Bunk, B., Klenk, H.-P., Fardeau, M.-L. & Spring, S. (2015). Calidisalinibacter kiritimatiensis gen. nov., sp. nov., a moderately thermohalophilic thiosulfate-reducing bacterium from a hypersaline microbial mat. Geomicrobiol J 32, Deutzmann, J. S., Hoppert, M. & Schink, B. (2014). Characterization and phylogeny of a novel methanotroph, Methyloglobulus morosus gen. nov., spec. nov. Syst Appl Microbiol 37, Donadio, S., Cavaletti, L. & Monciardini, P. (2012). Order IV. Catenulisporales ord. nov. In Bergey s Manual of Systematic Bacteriology, p Edited by M. Goodfellow, P. Kämpfer, H.- J. Busse, M. E. Trujillo, K. Suzuki, W. Ludwig & W. B. Whitman. vol. 5, 2nd edn., New York: Springer. 5. Du, J., Lai, Q., Liu, Y., Du, Y., Liu, X., Sun, F. & Shao, Z. (2015). Idiomarina atlantica sp. nov., a marine bacterium isolated from the deep sea sediment of the North Atlantic Ocean. Antonie van Leeuwenhoek 107, Gao, J., Xie, G., Peng, F. & Xie, Z. (2015). Pseudomonas donghuensis sp. nov., exhibiting high-yields of siderophore. Antonie van Leeuwenhoek 107, Geng, S., Pan, X.-C., Mei, R., Wang, Y.-N., Sun, J.-Q., Liu, X.-Y., Tang, Y.-Q. & Wu, X.-L. (2015). Paradevosia shaoguanensis gen. nov., sp. nov., isolated from a coking wastewater. Curr Microbiol 70, Genilloud, O. (2012). Order XI Micromonosporales ord. nov. In Bergey s Manual of Systematic Bacteriology, p Edited by M. Goodfellow, P. Kämpfer, H.-J. Busse, M. E. Trujillo, K. Suzuki, W. Ludwig & W. B. Whitman. vol. 5, 2nd edn. New York: Springer. 9. Ghodhbane-Gtari, F., Nouioui, I., Salem, K., Ktari, A., Montero- Calasanz, M., del, C., Tisa, L. S., Klenk, H.-P. & Gtari, M. (2014). Nocardia casuarinae sp. nov., an actinobacterial endophyte isolated from root nodules of Casuarina glauca. Antonie van Leeuwenhoek 105, Goodfellow, M. (2012). Order XV. Streptosporangiales ord. nov. In Bergey s Manual of Systematic Bacteriology, p Edited by by M. Goodfellow, P. Kämpfer, H.-J. Busse, M. E. Trujillo, K. Suzuki, W. Ludwig & W. B. Whitman. 2nd edn. New York: Springer. 11. Goodfellow, M. & Jones, A. L. (2012). Order V. Corynebacteriales ord. nov. In Bergey s Manual of Systematic Bacteriology, p Edited by M. Goodfellow, P. Kämpfer, H.-J. Busse, M. E. Trujillo, K. Suzuki, W. Ludwig & W. B. Whitman. vol. 5, 2nd edn., New York: Springer. 12. Goodfellow, M. & Trujillo, M. E. (2012). Order II. Actinopolysporales ord. nov. In Bergey s Manual of Systematic Bacteriology, p Edited by M. Goodfellow, P. Kämpfer, H.- J. Busse, M. E. Trujillo, K. Suzuki, W. Ludwig & W. B. Whitman. vol. 5, 2nd edn., New York: Springer

8 13. Hamada, M., Shibata, C., Nurkanto, A., Ratnakomala, S., Lisdiyanti, P., Tamura, T. & Suzuki, K. (2015). Tropicihabitans flavus gen. nov., sp. nov., a new member of the family Cellulomonadaceae. Antonie van Leeuwenhoek 107, Hameed, A., Shahina, M., Lai, W.-A., Lin, S.-Y., Young, L.-S., Liu, Y.-C., Hsu, Y.-H. & Young, C.-C. (2015). Oricola cellulosilytica gen. nov., sp. nov., a cellulose-degrading bacterium of the family Phyllobacteriaceae isolated from surface seashore water, and emended descriptions of Mesorhizobium loti and Phyllobacterium myrsinacearum. Antonie van Leeuwenhoek 107, Hu, B., Yang, Q., Cai, M., Tang, Y.-Q., Zhao, G.-F. & Wu, X.-L. (2015). Negadavirga shengliensis gen. nov., sp. nov., a novel member of the family Cyclobacteriaceae isolated from oil-contaminated saline soil. Antonie van Leeuwenhoek 107, Huang, Y., Sun, Y., Ma, S., Chen, L., Zhang, H. & Deng, Y. (2013). Isolation and characterization of Keratinibaculum paraultunense gen. nov., sp. nov., a novel thermophilic, anaerobic bacterium with keratinolytic activity. FEMS Microbiol Lett 345, Kämpfer, P. (2012). Order IX. Kineosporiales ord. nov. In Bergey s Manual of Systematic Bacteriology, p Edited by M. Goodfellow, P. Kämpfer, H.-J. Busse, M. E. Trujillo, K. Suzuki, W. Ludwig & W. B. Whitman. vol. 5, 2nd edn. New York: Springer. 18. Kawamura, Y., Kuwabara, S., Kania, S. A., Kato, H., Hamagishi, M., Fujiwara, N., Sato, T., Tomida, J., Tanaka, K. & Bemis, D. A. (2015). Porphyromonas pogonae sp. nov., an anaerobic but low concentration oxygen adapted coccobacillus isolated from lizards (Pogona vitticeps) or human clinical specimens, and emended description of the genus Porphyromonas Shah and Collins Syst Appl Microbiol 38, Labeda, D. P. (2012). Order VII. Glycomycetales ord. nov. In Bergey s Manual of Systematic Bacteriology, p Edited by M. Goodfellow, P. Kämpfer, H.-J. Busse, M. E. Trujillo, K. Suzuki, W. Ludwig & W. B. Whitman. vol. 5, 2nd edn., New York: Springer. 20. Labeda, D. P. & Goodfellow, M. (2012). Order XIII. Pseudonocardiales ord. nov. In Bergey s Manual of Systematic Bacteriology, p Edited by M. Goodfellow, P. Kämpfer, H.-J. Busse, M. E. Trujillo, K. Suzuki, W. Ludwig & W. B. Whitman. vol. 5, 2nd edn., New York: Springer. 21. Lai, Q., Li, S., Xu, H., Jiang, L., Zhang, R. & Shao, Z. (2014). Thioclava atlantica sp. nov., isolated from deep sea sediment of the Atlantic Ocean. Antonie van Leeuwenhoek 106, Lai, Q., Li, G., Liu, X., Du, Y., Sun, F. & Shao, Z. (2015). Pseudooceanicola atlanticus gen. nov. sp. nov., isolated from surface seawater of the Atlantic Ocean and reclassification of Oceanicola batsensis, Oceanicola marinus, Oceanicola nitratireducens, Oceanicola nanhaiensis, Oceanicola antarcticus and Oceanicola flagellatus, as Pseudooceanicola batsensis comb. nov., Pseudooceanicola marinus comb. nov., Pseudooceanicola nitratireducens comb. nov., Pseudooceanicola nanhaiensis comb. nov., Pseudooceanicola antarcticus comb. nov., and Pseudooceanicola flagellatus comb. nov. Antonie van Leeuwenhoek 107, Levican, A., Rubio-Arcos, S., Martinez-Murcia, A., Collado, L. & Figueras, M. J. (2015). Arcobacter ebronensis sp. nov. and Arcobacter aquimarinus sp. nov., two new species isolated from marine environment. Syst Appl Microbiol 38, Li, G., Lai, Q., Sun, F., Du, Y., Liu, X., Li, G., Xie, Y. & Shao, Z. (2014). Actibacterium atlanticum sp. nov., isolated from surface seawater of the Atlantic Ocean. Antonie van Leeuwenhoek 106, Li, X., Wang, L., Huang, H., Lai, Q. & Shao, Z. (2014). Aquimarina penaei sp. nov., isolated from intestinal tract contents of Pacific white shrimp, Penaeus vannamei. Antonie van Leeuwenhoek 106, Lin, S.-Y., Hung, M.-H., Hameed, A., Liu, Y.-C., Hsu, Y.-H., Wen, C.-Z., Arun, A. B., Busse, H.-J., Glaeser, S. P. & other authors (2015). Rhizobium capsici sp. nov., isolated from root tumor of a green bell pepper (Capsicum annuum var. grossum) plant. Antonie van Leeuwenhoek 107, Liu, X., Li, G., Lai, Q., Sun, F., Du, Y. & Shao, Z. (2015). Emcibacter nanhaiensis gen. nov. sp. nov., isolated from sediment of the South China Sea. Antonie van Leeuwenhoek 107, Liu, Y., Lai, Q., Du, J., Xu, H., Jiang, L. & Shao, Z. (2015). Thioclava indica sp. nov., isolated from surface seawater of the Indian Ocean. Antonie van Leeuwenhoek 107, Luo, Y.-J., Xie, B.-S., Lv, X.-L., Cai, M., Wang, Y.-N., Cui, H.-L., Cai, H. & Wu, X.-L. (2015). Marinobacter shengliensis sp. nov., a moderately halophilic bacterium isolated from oil-contaminated saline soil. Antonie van Leeuwenhoek 107, Lv, X.-L., Xie, B.-S., Cai, M., Tang, Y.-Q., Wang, Y.-N., Cui, H.-L., Liu, X.-Y., Tan, Y. & Wu, X.-L. (2015). Halodurantibacterium flavum gen. nov., sp. nov., a non-phototrophic bacterium isolated from an oil production mixture. Curr Microbiol 70, Menezes, C. B. A., Tonin, M. F., Corrêa, D. B. A., Parma, M., de Melo, I. S., Zucchi, T. D., Destéfano, S. A. L. & Fantinatti- Garboggini, F. (2015). Chromobacterium amazonense sp. nov. isolated from water samples from the Rio Negro, Amazon, Brazil. Antonie van Leeuwenhoek 107, Park, S., Jung, Y.-T., Park, J.-M. & Yoon, J.-H. (2014). Pseudohongiella acticola sp. nov., a novel gammaproteobacterium isolated from seawater, and emended description of the genus Pseudohongiella. Antonie van Leeuwenhoek 106, Patil, V. S., Salunkhe, R. C., Patil, R. H., Husseneder, C., Shouche, Y. S. & Venkata Ramana, V. (2015). Enterobacillus tribolii gen. nov., sp. nov., a novel member of the family Enterobacteriaceae, isolated from the gut of a red flour beetle, Tribolium castaneum. Antonie van Leeuwenhoek 107, Patrick, S. & McDowell, A. (2012). Order XII. Propionibacteriales ord. nov. In Bergey s Manual of Systematic Bacteriology, p Edited by M. Goodfellow, P. Kämpfer, H.-J. Busse, M. E. Trujillo, K. Suzuki, W. Ludwig & W. B. Whitman. vol. 5, 2nd edn., New York: Springer. 35. Praet, J., Meeus, I., Cnockaert, M., Aerts, M., Smagghe, G. & Vandamme, P. (2015). Bifidobacterium commune sp. nov. isolated from the bumble bee gut. Antonie van Leeuwenhoek 107, Praet, J., Meeus, I., Cnockaert, M., Houf, K., Smagghe, G. & Vandamme, P. (2015). Novel lactic acid bacteria isolated from the bumble bee gut: Convivina intestini gen. nov., sp. nov., Lactobacillus bombicola sp. nov., and Weissella bombi sp. nov. Antonie van Leeuwenhoek 107, Reddy, G. S. & Garcia-Pichel, F. (2015). Description of Pseudomonas asuensis sp. nov. from biological soil crusts in the Colorado plateau, United States of America. J Microbiol 53, International Journal of Systematic and Evolutionary Microbiology 65

9 38. Sachse, K., Laroucau, K., Riege, K., Wehner, S., Dilcher, M., Creasy, H. H., Weidmann, M., Myers, G., Vorimore, F. & other authors (2014). Evidence for the existence of two new members of the family Chlamydiaceae and proposal of Chlamydia avium sp. nov. and Chlamydia gallinacea sp. nov. Syst Appl Microbiol 37, Sachse, K., Bavoil, P. M., Kaltenboeck, B., Stephens, R. S., Kuo, C.-C., Rosselló-Móra, R. & Horn, M. (2015). Emendation of the family Chlamydiaceae: proposal of a single genus, Chlamydia, to include all currently recognized species. Syst Appl Microbiol 38, Safronova, V. I., Kuznetsova, I. G., Sazanova, A. L., Kimeklis, A. K., Belimov, A. A., Andronov, E. E., Pinaev, A. G., Chizhevskaya, E. P., Pukhaev, A. R. & other authors (2015). Bosea vaviloviae sp. nov., a new species of slow-growing rhizobia isolated from nodules of the relict species Vavilovia formosa (Stev.) Fed. Antonie van Leeuwenhoek 107, Sawana, A., Adeolu, M. & Gupta, R. S. (2014). Molecular signatures and phylogenomic analysis of the genus Burkholderia: proposal for division of this genus into the emended genus Burkholderia containing pathogenic organisms and a new genus Paraburkholderia gen. nov. harboring environmental species. Front Genet 5, Shao, S., Lai, Q., Liu, Q., Wu, H., Xiao, J., Shao, Z., Wang, Q. & Zhang, Y. (2015). Phylogenomics characterization of a highly virulent Edwardsiella strain ET T encoding two distinct T3SS and three T6SS gene clusters: propose a novel species as Edwardsiella anguillarum sp. nov. Syst Appl Microbiol 38, Shin, S.-K., Goo, H., Cho, Y.-J., Kwon, S., Yong, D. & Yi, H. (2014). Non-contiguous finished genome sequence and description of the gliding bacterium Flavobacterium seoulense sp. nov. Stand Genomic Sci 9, Shivani, Y., Subhash, Y., Tushar, L., Sasikala, Ch. & Ramana, Ch. V (2015). Spirochaeta lutea sp. nov., isolated from marine habitats and emended description of the genus Spirochaeta. Syst Appl Microbiol 38, Singh, H., Du, J., Ngo, H. T. T., Kim, K.-Y. & Yi, T.-H. (2015). Pedobacter lotistagni sp. nov. isolated from lotus pond water. Antonie van Leeuwenhoek 107, Spring, S., Scheuner, C., Göker, M. & Klenk, H.-P. (2015). A taxonomic framework for emerging groups of ecologically important marine gammaproteobacteria based on the reconstruction of evolutionary relationships using genome-scale data. Front Microbiol 6, Sultanpuram, V. R., Mothe, T. & Mohammed, F. (2015). Salisediminibacterium haloalkalitolerans sp. nov., isolated from Lonar soda lake, India, and a proposal for reclassification of Bacillus locisalis as Salisediminibacterium locisalis comb. nov., and the emended description of the genus Salisediminibacterium and of the species Salisediminibacterium halotolerans. Arch Microbiol 197, Tang, S. K., Zhi, X.-Y. & Li, W.-J. (2012). Order VIII. Jiangellales ord. nov. In Bergey s Manual of Systematic Bacteriology, p Edited by M. Goodfellow, P. Kämpfer, H.-J. Busse, M. E. Trujillo, K. Suzuki, W. Ludwig & W. B. Whitman. vol. 5, 2nd edn., New York: Springer. 49. Triplett, L. R., Verdier, V., Campillo, T.,., Van Malderghem, C., Cleenwerck, I., Maes, M., Deblais, L., Corral, R., Koita, O. & other authors (2015). Characterization of a novel clade of Xanthomonas isolated from rice leaves in Mali and proposal of Xanthomonas maliensis sp. nov. Antonie van Leeuwenhoek 107, Xie, B.-S., Lv, X.-L., Cai, M., Tang, Y.-Q., Wang, Y.-N., Cui, H.-L., Liu, X.-Y., Tan, Y. & Wu, X.-L. (2014). Seohaeicola nanhaiensis sp. nov., a moderately halophilic bacterium isolated from the benthic sediment of South China Sea. Curr Microbiol 69, Xu, L., Huo, Y.-Y., Li, Z.-Y., Wang, C.-S., Oren, A. & Xu, X.-W. (2015). Chryseobacterium profundimaris sp. nov., a new member of the family Flavobacteriaceae isolated from deep-sea sediment. Antonie van Leeuwenhoek 107, Yoon, J. & Kasai, H. (2015). Wenyingzhuangia heitensis sp. nov., a new species of the family Flavobacteriaceae within the phylum Bacteroidetes isolated from seawater. Antonie van Leeuwenhoek 107, Yoon, J., Matsuo, Y., Kasai, H. & Lee, M.-K. (2015). Phylogenetic and taxonomic analyses of Rhodopirellula caenicola sp. nov., a new marine Planctomycetes species isolated from iron sand. J Phylogenetics Evol Biol 3, Zhu, L., Xin, K., Chen, C., Li, C., Si, M., Zhao, L., Shi, X., Zhang, L. & Shen, X. (2015). Sphingobium endophyticus sp. nov., isolated from the root of Hylomecon japonica. Antonie van Leeuwenhoek 107,

List of new names and new combinations previously effectively, but not validly, published

List of new names and new combinations previously effectively, but not validly, published International Journal of Systematic and Evolutionary Microbiology (), 63, 1 5 DOI 10.1099/ijs.0.049312-0 Validation List no. 149 List of new names and new combinations previously effectively, but not validly,

More information

List of new names and new combinations previously effectively, but not validly, published

List of new names and new combinations previously effectively, but not validly, published International Journal of Systematic and Evolutionary Microbiology (2015), 65, 1105 1111 DOI 10.1099/ijs.0.000178 Validation List no. 163 Correspondence Aharon Oren aharon.oren@mail.huji.ac.il George M.

More information

List of bacterial type strains available for distribution at CRB-JD

List of bacterial type strains available for distribution at CRB-JD List of bacterial type strains available for distribution at CRB-JD Species name CRB-JD code Other collections code References Azomonas macrocytogenes BR 10692 Azorhizobium caulinodans BR 5410 Azorhizobium

More information

REFERENCE STRAIN CATALOGUE PERTAINING TO ORGANISMS FOR PERFORMANCE TESTING OF CULTURE MEDIA

REFERENCE STRAIN CATALOGUE PERTAINING TO ORGANISMS FOR PERFORMANCE TESTING OF CULTURE MEDIA REFERENCE STRAIN CATALOGUE PERTAINING TO ORGANISMS FOR PERFORMANCE TESTING OF CULTURE MEDIA This catalogue is placed on line in response to a request by the ISO TC 34 SC 9 Joint Working Group 5 and the

More information

Antimicrobial Resistance: Do we know everything? Dr. Sid Thakur Assistant Professor Swine Health & Production CVM, NCSU

Antimicrobial Resistance: Do we know everything? Dr. Sid Thakur Assistant Professor Swine Health & Production CVM, NCSU Antimicrobial Resistance: Do we know everything? Dr. Sid Thakur Assistant Professor Swine Health & Production CVM, NCSU Research Focus Antimicrobial Resistance On farm, Slaughter, Retail, Human Sample

More information

Aquatic Animal Bacterial Pathogen

Aquatic Animal Bacterial Pathogen Aquatic Animal Bacterial Pathogen Veterinary Bacteriology and Mycology (3142304 ) Academic year 2012 Channarong Rodkhum D.V.M. (Hons), Ph.D. Department of Veterinary Microbiology Faculty of Veterinary

More information

Juehuaornis gen. nov.

Juehuaornis gen. nov. 34 1 2015 3 GLOBAL GEOLOGY Vol. 34 No. 1 Mar. 2015 1004 5589 2015 01 0007 05 Juehuaornis gen. nov. 1 1 1 2 1. 110034 2. 110034 70% Juehuaornis zhangi gen. et sp. nov Q915. 4 A doi 10. 3969 /j. issn. 1004-5589.

More information

Genome sequence analyses show that Neisseria oralis is the same species as Neisseria mucosa var. heidelbergensis

Genome sequence analyses show that Neisseria oralis is the same species as Neisseria mucosa var. heidelbergensis International Journal of Systematic and Evolutionary Microbiology (2013), 63, 3920 3926 DOI 10.1099/ijs.0.052431-0 Genome sequence analyses show that Neisseria oralis is the same species as Neisseria mucosa

More information

REFERENCE MATERIALS CATALOGUE FOR PHYSICAL-CHEMICAL AND MICROBIOLOGICAL LABORATORIES

REFERENCE MATERIALS CATALOGUE FOR PHYSICAL-CHEMICAL AND MICROBIOLOGICAL LABORATORIES REFERENCE MATERIALS CATALOGUE FOR PHYSICAL-CHEMICAL AND MICROBIOLOGICAL LABORATORIES 2019 Issue: January 2019 ielab is a company engaged to provide services and products for the application of quality

More information

Enterobacter aerogenes

Enterobacter aerogenes Enterobacter aerogenes Enterobacter sp. Enterobacter sp. Species: Enterobacter aerogenes Enterobacter agglomerans Enterobacter cloacae causes UTI, enterotoxigenic Often found in the normal intestinal flora,

More information

Evaluation of antimicrobial activity of Salmonella species from various antibiotic

Evaluation of antimicrobial activity of Salmonella species from various antibiotic ISSN: 2347-3215 Volume 3 Number 8 (August-2015) pp. 51-55 www.ijcrar.com Evaluation of antimicrobial activity of Salmonella species from various antibiotic Shashi P. Jambhulkar 1 * and Arun B. Ingle 2

More information

Drug resistance analysis of bacterial strains isolated from burn patients

Drug resistance analysis of bacterial strains isolated from burn patients Drug resistance analysis of bacterial strains isolated from burn patients L.F. Wang, J.L. Li, W.H. Ma and J.Y. Li Inner Mongolia Institute of Burn Research, The Third Affiliated Hospital of Inner Mongolia

More information

Phenotypic Plasticity in Embryonic Development of Reptiles: Recent Research and Research Opportunities in China

Phenotypic Plasticity in Embryonic Development of Reptiles: Recent Research and Research Opportunities in China Asian Herpetological Research 2013, 4(1): 1 8 DOI: 10.3724/SP.J.1245.2013.00001 Phenotypic Plasticity in Embryonic Development of Reptiles: Recent Research and Research Opportunities in China Weiguo DU

More information

Increasing trends in mcr-1 prevalence among ESBL-producing E. coli in French calves

Increasing trends in mcr-1 prevalence among ESBL-producing E. coli in French calves AAC Accepted Manuscript Posted Online 8 August 2016 Antimicrob. Agents Chemother. doi:10.1128/aac.01147-16 Copyright 2016, American Society for Microbiology. All Rights Reserved. 1 2 Increasing trends

More information

Application of sewage in pisciculture in order to augment fish production has been an

Application of sewage in pisciculture in order to augment fish production has been an Conclusions Application of sewage in pisciculture in order to augment fish production has been an ancient practice in India and other countries like i.e. China, Egypt and Europe. Possible health hazard

More information

ESCHERICHIA COLI RESISTANCE AND GUT MICROBIOTA PROFILE IN PIGS RAISED WITH DIFFERENT ANTIMICROBIAL ADMINISTRATION IN FEED

ESCHERICHIA COLI RESISTANCE AND GUT MICROBIOTA PROFILE IN PIGS RAISED WITH DIFFERENT ANTIMICROBIAL ADMINISTRATION IN FEED ESCHERICHIA COLI RESISTANCE AND GUT MICROBIOTA PROFILE IN PIGS RAISED WITH DIFFERENT ANTIMICROBIAL ADMINISTRATION IN FEED Caroline Pissetti 1, Jalusa Deon Kich 2, Heather K. Allen 3, Claudia Navarrete

More information

in wastewater treatment plant

in wastewater treatment plant Abundance of carbapenem-resistant resistant bacteria in wastewater treatment plant Tomislav Ivankovic, Faculty of Science, University of Zagreb, Croatia Svjetlana Dekic, Faculty of Science, University

More information

I. БАКТЕРИИ. Acetobacter aceti (Pasteur 1864) Beijerinck 1898

I. БАКТЕРИИ. Acetobacter aceti (Pasteur 1864) Beijerinck 1898 I. БАКТЕРИИ NBIMCC 8850 Acetobacter aceti (Pasteur 1864) Beijerinck 1898 CCUG 18122. ATCC 15973, DSMZ 3508, LMG 1261, NCIB 8621, CECT 298, CCTM 3043, PDDCC 8807. Alcohol turned to vinegar. Acetobacter

More information

Myxosporeans and myxosporidiosis of common carp and gibel carp in China

Myxosporeans and myxosporidiosis of common carp and gibel carp in China Myxosporeans and myxosporidiosis of common carp and gibel carp in China Zhang Jinyong, Liu Xinhua, Xi Bingwen, Kálmán Molnár zhangjy@ihb.ac.cn Hungary 2015 June.3 Laboratory of Fish Diseases; Institute

More information

Seroprevalence and risk factors of Chlamydia abortus infection in free-ranging white yaks in China

Seroprevalence and risk factors of Chlamydia abortus infection in free-ranging white yaks in China Qin et al. BMC Veterinary Research (2015) 11:8 DOI 10.1186/s12917-015-0323-y RESEARCH ARTICLE Open Access Seroprevalence and risk factors of Chlamydia abortus infection in free-ranging white yaks in China

More information

Testimony of the Natural Resources Defense Council on Senate Bill 785

Testimony of the Natural Resources Defense Council on Senate Bill 785 Testimony of the Natural Resources Defense Council on Senate Bill 785 Senate Committee on Healthcare March 16, 2017 Position: Support with -1 amendments I thank you for the opportunity to address the senate

More information

Animal Chlamydioses and the Zoonotic Implications

Animal Chlamydioses and the Zoonotic Implications Food and Agriculture (FA) Domain Committee MONITORING PROGRESS REPORT 2006 COST - Chair: Konrad Sachse 3rd DC meeting, Antalya (TR), 31 Jan 2 Feb 2007 COST Action Domain Food and Agriculture (FA) Animal

More information

Research on pathogenic bacteria and antibiotic resistance of Enterobacteriaceae in hospitalized elderly patients.

Research on pathogenic bacteria and antibiotic resistance of Enterobacteriaceae in hospitalized elderly patients. Biomedical Research 2017; 28 (16): 7243-7247 ISSN 0970-938X www.biomedres.info Research on pathogenic bacteria and antibiotic resistance of Enterobacteriaceae in hospitalized elderly patients. Feng Zheng

More information

Understanding and prevention of transmission of antibiotic resistance between bacterial populations and One Health reservoirs

Understanding and prevention of transmission of antibiotic resistance between bacterial populations and One Health reservoirs Priority Topic D - Transmission Understanding and prevention of transmission of antibiotic resistance between bacterial populations and One Health reservoirs The overarching goal of this priority topic

More information

Course: Microbiology in Health and Disease Office Hours: Before or after Class or by appointment

Course: Microbiology in Health and Disease Office Hours: Before or after Class or by appointment SYLLABUS BIOL 2900 SECTIONS C AND D Spring, 2011 Course: Microbiology in Health and Disease Office Hours: Before or after Class or by appointment Semester Begins on January 10, 2011 and ends on May 2,

More information

Course: Microbiology in Health and Disease

Course: Microbiology in Health and Disease SYLLABUS BIOL 2900 SECTION D SPRING 2012 Course: Microbiology in Health and Disease BIPIN PATEL Office Hours: Before or after Class or by appointment Semester Begins JANUARY 09 TO MAY 04 2012 2900 D 4.00

More information

Classification of Bacteria

Classification of Bacteria Classification of Bacteria MICROBIOLOGY -TAXONOMY Taxonomy is the system to classify living organisms Seven groups kingdom, phylum or div, class, order, family, genus, species Binomial system of nomenclature

More information

Pathogens and antibiotic resistance of children with community-acquired pneumonia.

Pathogens and antibiotic resistance of children with community-acquired pneumonia. Biomedical Research 2017; 28 (20): 8839-8843 ISSN 0970-938X www.biomedres.info Pathogens and antibiotic resistance of children with community-acquired pneumonia. Ma Jinghua 1, Liu Gaizhuang 2, Chai Qiaoli

More information

Antimicrobial Susceptibility of Clinically Relevant Gram-Positive Anaerobic Cocci Collected over a Three-Year Period in the Netherlands

Antimicrobial Susceptibility of Clinically Relevant Gram-Positive Anaerobic Cocci Collected over a Three-Year Period in the Netherlands ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Mar. 2011, p. 1199 1203 Vol. 55, No. 3 0066-4804/11/$12.00 doi:10.1128/aac.01771-09 Copyright 2011, American Society for Microbiology. All Rights Reserved. Antimicrobial

More information

Occurrence, molecular characterization and predominant genotypes of Enterocytozoon bieneusi in dairy cattle in Henan and Ningxia, China

Occurrence, molecular characterization and predominant genotypes of Enterocytozoon bieneusi in dairy cattle in Henan and Ningxia, China Li et al. Parasites & Vectors (2016) 9:142 DOI 10.1186/s13071-016-1425-5 SHORT REPORT Occurrence, molecular characterization and predominant genotypes of Enterocytozoon bieneusi in dairy cattle in Henan

More information

Specificity (target gene) Primer name Sequence Product length[bp] GGATTAGATACCCTGGTAGTC TACCTTGTTACGACTT

Specificity (target gene) Primer name Sequence Product length[bp] GGATTAGATACCCTGGTAGTC TACCTTGTTACGACTT Supplementary material for Beneficial Microbes DOI: http://dx.doi.org/10.3920/bm2013.0021 Individual responses of mother sows to a probiotic Enterococcus faecium strain lead to different microbiota composition

More information

The role of the environment in the selection and spread of antimicrobial resistance

The role of the environment in the selection and spread of antimicrobial resistance Priority Topic E - Environment The role of the environment in the selection and spread of antimicrobial resistance The overarching goal of this priority topic is to investigate the role of the environment

More information

Aerobic Bacterial Profile and Antimicrobial Susceptibility Pattern of Pus Isolates in a Tertiary Care Hospital in Hadoti Region

Aerobic Bacterial Profile and Antimicrobial Susceptibility Pattern of Pus Isolates in a Tertiary Care Hospital in Hadoti Region International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 6 Number 5 (2017) pp. 2866-2873 Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2017.605.326

More information

ANTIBIOTIC SENSITIVITY PATTERN OF YERSINIA ENTEROCOLITICA ISOLATED FROM MILK AND DAIRY PRODUCTS*

ANTIBIOTIC SENSITIVITY PATTERN OF YERSINIA ENTEROCOLITICA ISOLATED FROM MILK AND DAIRY PRODUCTS* Short Communication ANTIBIOTIC SENSITIVITY PATTERN OF YERSINIA ENTEROCOLITICA ISOLATED FROM MILK AND DAIRY PRODUCTS* T.R.Pugazhenthi 1, A. Elango 2, C. Naresh Kumar 3, B. Dhanalakshmi 4 and A. Bharathidhasan

More information

Species: Panthera pardus Genus: Panthera Family: Felidae Order: Carnivora Class: Mammalia Phylum: Chordata

Species: Panthera pardus Genus: Panthera Family: Felidae Order: Carnivora Class: Mammalia Phylum: Chordata CHAPTER 6: PHYLOGENY AND THE TREE OF LIFE AP Biology 3 PHYLOGENY AND SYSTEMATICS Phylogeny - evolutionary history of a species or group of related species Systematics - analytical approach to understanding

More information

Parasites and their vectors

Parasites and their vectors Parasites and their vectors ThiS is a FM Blank Page Yvonne Ai Lian Lim Indra Vythilingam Editors Parasites and their vectors A special focus on Southeast Asia Editors Yvonne Ai Lian Lim Indra Vythilingam

More information

Ozone Inactivation Kinetics of Multiple Antibiotic Resistant Strains of Bacteria in Water.

Ozone Inactivation Kinetics of Multiple Antibiotic Resistant Strains of Bacteria in Water. Ozone Inactivation Kinetics of Multiple Antibiotic Resistant Strains of Bacteria in Water. M. S. Gutiérrez, I. Lezcano, Ch. Baluja and E. Sánchez Centro de Investigaciones del Ozono Calle 230 # 1313 y

More information

Co-transfer of bla NDM-5 and mcr-1 by an IncX3 X4 hybrid plasmid in Escherichia coli 4

Co-transfer of bla NDM-5 and mcr-1 by an IncX3 X4 hybrid plasmid in Escherichia coli 4 SUPPLEMENTARY INFORMATION ARTICLE NUMBER: 16176 DOI: 10.1038/NMICROBIOL.2016.176 Co-transfer of bla NDM-5 and mcr-1 by an IncX3 X4 hybrid plasmid in Escherichia coli 4 5 6 7 8 9 10 11 12 13 14 15 16 17

More information

Key words: Campylobacter, diarrhea, MIC, drug resistance, erythromycin

Key words: Campylobacter, diarrhea, MIC, drug resistance, erythromycin Key words: Campylobacter, diarrhea, MIC, drug resistance, erythromycin Table 1 Detection rate of Campylobacter from stool samples taken from sporadic diarrheic patients Table 2 Detection rates of Campylobacter

More information

Supplementary Information

Supplementary Information Supplementary Information Microbial Population Dynamics in Membrane Bioreactor with Quorum Quenching Hak-Woo Kim 1, Hyun-Suk Oh 1, Sang-Ryoung Kim 1, Ki-Baek Lee 1, Kyung-Min Yeon 1, Chung-Hak Lee 1, Seil

More information

BIOL 2900 D 4.00 Microbiology in Health/Disease

BIOL 2900 D 4.00 Microbiology in Health/Disease SYLLABUS BIOL 2900 - D Spring, 2017 Course: Microbiology in Health and Disease Instructor: Prafull C. Shah Office Hours: Before or after classes, or by appointment by Email to pcshah@valdosta.edu. Semester

More information

Session Fur & Wool. Qian Q.X., Ma J.X., Zhang G.Z., Xie C.S., Ren L., Qian B.Q. BREEDING AND APPLICATION OF ZHEXI ANGORA RABBITS.

Session Fur & Wool. Qian Q.X., Ma J.X., Zhang G.Z., Xie C.S., Ren L., Qian B.Q. BREEDING AND APPLICATION OF ZHEXI ANGORA RABBITS. PROCEEDINGS OF THE 11 th WORLD RABBIT CONGRESS Qingdao (China) - June 15-18, 2016 ISSN 2308-1910 Session Fur & Wool Qian Q.X., Ma J.X., Zhang G.Z., Xie C.S., Ren L., Qian B.Q. BREEDING AND APPLICATION

More information

Epidemic and Information Research and Development Monitoring and Detection Education Training International Cooperation

Epidemic and Information Research and Development Monitoring and Detection Education Training International Cooperation Principal Vice Principal College of Bioresources and Agriculture Center for Biotechnology Zoonoses Reasearch Center Epidemic and Information Research and Development Monitoring and Detection Education

More information

Mine Spills and Antibiotic Resistance: What is the Connection?

Mine Spills and Antibiotic Resistance: What is the Connection? Mine Spills and Antibiotic Resistance: What is the Connection? Jean E. McLain, Associate Director and Research Scientist University of Arizona Water Resources Research Center 2 nd Annual Conference on

More information

Myxosporeans and myxosporidiosis of allogynogenetic gibel carp (Carassius auratus gibelio Bloch) in China

Myxosporeans and myxosporidiosis of allogynogenetic gibel carp (Carassius auratus gibelio Bloch) in China Myxosporeans and myxosporidiosis of allogynogenetic gibel carp (Carassius auratus gibelio Bloch) in China Zhang Jinyong zhangjy@ihb.ac.cn Laboratory of Fish Diseases; Institute of Hydrobiology (IHB), Chinese

More information

Int.J.Curr.Microbiol.App.Sci (2017) 6(3):

Int.J.Curr.Microbiol.App.Sci (2017) 6(3): International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 6 Number 3 (2017) pp. 891-895 Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2017.603.104

More information

Enzootic abortion in sheep and its economic consequences

Enzootic abortion in sheep and its economic consequences Vet Times The website for the veterinary profession https://www.vettimes.co.uk Enzootic abortion in sheep and its economic consequences Author : Louise Silk Categories : Farm animal, Vets Date : February

More information

Freshwater turtle trade in Hainan and suggestions for effective management

Freshwater turtle trade in Hainan and suggestions for effective management 2005, 13 (3): 239 247 Biodiversity Science doi: 10.1360/biodiv.050021 http: //www.biodiversity-science.net 1 (, 100875) 2 (, 571158) 3 (, 570228) : 2002 2004,, 22, 19.6%; 64, 65.3%; 103, 48910, 90%, 3,

More information

Classification. Chapter 17. Classification. Classification. Classification

Classification. Chapter 17. Classification. Classification. Classification Classification Chapter 17 Classification Classification is the arrangement of organisms into orderly groups based on their similarities. Classification shows how organisms are related and different. Classification

More information

RETROSPECTIVE STUDY OF GRAM NEGATIVE BACILLI ISOLATES AMONG DIFFERENT CLINICAL SAMPLES FROM A DIAGNOSTIC CENTER OF KANPUR

RETROSPECTIVE STUDY OF GRAM NEGATIVE BACILLI ISOLATES AMONG DIFFERENT CLINICAL SAMPLES FROM A DIAGNOSTIC CENTER OF KANPUR Original article RETROSPECTIVE STUDY OF GRAM NEGATIVE BACILLI ISOLATES AMONG DIFFERENT CLINICAL SAMPLES FROM A DIAGNOSTIC CENTER OF KANPUR R.Sujatha 1,Nidhi Pal 2, Deepak S 3 1. Professor & Head, Department

More information

A Study on Bacterial Flora on the Finger printing Surface of the Biometric Devices at a Tertiary Care Hospital

A Study on Bacterial Flora on the Finger printing Surface of the Biometric Devices at a Tertiary Care Hospital International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 5 Number 9 (2016) pp. 441-446 Journal homepage: http://www.ijcmas.com Original Research Article http://dx.doi.org/10.20546/ijcmas.2016.509.047

More information

The Disinfecting Effect of Electrolyzed Water Produced by GEN-X-3. Laboratory of Diagnostic Medicine, College of Medicine, Soonchunhyang University

The Disinfecting Effect of Electrolyzed Water Produced by GEN-X-3. Laboratory of Diagnostic Medicine, College of Medicine, Soonchunhyang University The Disinfecting Effect of Electrolyzed Water Produced by GEN-X-3 Laboratory of Diagnostic Medicine, College of Medicine, Soonchunhyang University Tae-yoon Choi ABSTRACT BACKGROUND: The use of disinfectants

More information

Aerobic bacterial infections in a burns unit of Sassoon General Hospital, Pune

Aerobic bacterial infections in a burns unit of Sassoon General Hospital, Pune Original article Aerobic bacterial infections in a burns unit of Sassoon General Hospital, Pune Patil P, Joshi S, Bharadwaj R. Department of Microbiology, B.J. Medical College, Pune, India. Corresponding

More information

DRUG-RESISTANT ACINETOBACTER BAUMANNII A GROWING SUPERBUG POPULATION. Cara Wilder Ph.D. Technical Writer March 13 th 2014

DRUG-RESISTANT ACINETOBACTER BAUMANNII A GROWING SUPERBUG POPULATION. Cara Wilder Ph.D. Technical Writer March 13 th 2014 DRUG-RESISTANT ACINETOBACTER BAUMANNII A GROWING SUPERBUG POPULATION Cara Wilder Ph.D. Technical Writer March 13 th 2014 ATCC Founded in 1925, ATCC is a non-profit organization with headquarters in Manassas,

More information

Antimicrobial Resistance Monitoring Program in Food-Producing Animals in Japan

Antimicrobial Resistance Monitoring Program in Food-Producing Animals in Japan 93,0 * Antimicrobial Resistance Monitoring Program in Food-Producing Animals in Japan Tetsuo ASAI* National Veterinary Assay Laboratory, Ministry of Agriculture, Forestry and Fisheries, + +/ + Tokura,

More information

Martin Chénier, Ph.D. Microbiology. Antibiotics in Animal Production: Resistance and Alternative Solutions

Martin Chénier, Ph.D. Microbiology. Antibiotics in Animal Production: Resistance and Alternative Solutions Faculty of Agricultural and Environmental Sciences Department of Food Science, Department of Animal Science Martin Chénier, Ph.D. Microbiology Antibiotics in Animal Production: Resistance and Alternative

More information

Summary 1. INLAND WATER STREPTOCOCCOSIS Synopsis

Summary 1. INLAND WATER STREPTOCOCCOSIS Synopsis Summary Bacterial diseases cause huge damages in fish farms worldwide, and numerous bacterial pathogens from inland and saline waters have been identified and studied for their characterization, diagnosis,

More information

Short Communication. Received 8 May 2017; received in revised form 23 May 2017; accepted 25 May 2017

Short Communication. Received 8 May 2017; received in revised form 23 May 2017; accepted 25 May 2017 Tropical Biomedicine 34(3): 717 722 (2017) Short Communication A case of Diphyllobothrium latum infection in Dalian and a brief review of diphyllobothriasis in China Ren, Y.X., Zheng, L.L., Dai, X.D.,

More information

Supplementary Information. Chlamydia gallinacea is the endemic chlamydial species in chicken (Gallus gallus) Chengming Wang 1 **

Supplementary Information. Chlamydia gallinacea is the endemic chlamydial species in chicken (Gallus gallus) Chengming Wang 1 ** 1 Supplementary Information 2 3 gallinacea is the endemic chlamydial species in chicken (Gallus gallus) 4 5 6 Weina Guo 1,2*, Jing Li 1*, Bernhard Kaltenboeck 3, Jiansen Gong 4, Weixing Fan 5 & Chengming

More information

Epidemiological Characteristics and Drug Resistance Analysis of Multidrug-Resistant Acinetobacter baumannii in a China Hospital at a Certain Time

Epidemiological Characteristics and Drug Resistance Analysis of Multidrug-Resistant Acinetobacter baumannii in a China Hospital at a Certain Time Polish Journal of Microbiology 2014, Vol. 63, No 3, 275 281 ORIGINAL PAPER Epidemiological Characteristics and Drug Resistance Analysis of Multidrug-Resistant Acinetobacter baumannii in a China Hospital

More information

Peng GUO 1, 2*, Qin LIU 1, 2, Jiatang LI 3, Guanghui ZHONG 2, Yueying CHEN 3 and Yuezhao WANG Introduction. 2. Material and Methods

Peng GUO 1, 2*, Qin LIU 1, 2, Jiatang LI 3, Guanghui ZHONG 2, Yueying CHEN 3 and Yuezhao WANG Introduction. 2. Material and Methods Asian Herpetological Research 2012, 3(4): 334 339 DOI: 10.3724/SP.J.1245.2012.00334 Catalogue of the Type Specimens of Amphibians and Reptiles in the Herpetological Museum of the Chengdu Institute of Biology,

More information

Accurate identification and epidemiological characterization of Burkholderia cepacia complex: an update

Accurate identification and epidemiological characterization of Burkholderia cepacia complex: an update Devanga Ragupathi and Veeraraghavan Ann Clin Microbiol Antimicrob (2019) 18:7 https://doi.org/10.1186/s12941-019-0306-0 Annals of Clinical Microbiology and Antimicrobials REVIEW Open Access Accurate identification

More information

JAC Bactericidal index: a new way to assess quinolone bactericidal activity in vitro

JAC Bactericidal index: a new way to assess quinolone bactericidal activity in vitro Journal of Antimicrobial Chemotherapy (1997) 39, 713 717 JAC Bactericidal index: a new way to assess quinolone bactericidal activity in vitro Ian Morrissey* Department of Biosciences, Division of Biochemistry

More information

Feeding Original XPC TM can help reduce Campylobacter in broilers and turkeys

Feeding Original XPC TM can help reduce Campylobacter in broilers and turkeys As published in RESEARCH UPDATE Campylobacter is one of the leading causes of foodborne illness. Traditional methods for controlling Campylobacter contamination have been focused within the processing

More information

Antimicrobial Resistance (AMR) in Aquaculture

Antimicrobial Resistance (AMR) in Aquaculture Antimicrobial Resistance (AMR) in Aquaculture Melba.Reantaso@fao.org AMR Side Event, COFI/SCA 9 25 October 2017, Rome, Italy http://www.fao.org/cofi/aq/90408/en/ Benefits on the use of antimicrobials Antimicrobial

More information

OIE Collaborating Centres Reports Activities

OIE Collaborating Centres Reports Activities OIE Collaborating Centres Reports Activities Activities in 2016 This report has been submitted : 2017-01-08 05:38:55 Title of collaborating centre: Food-Borne Parasites from the Asia-Pacific Region Address

More information

Effects of different doses of dexmedetomidine on inflammatory factors and T lymphocyte subsets in elderly patients undergoing laparoscopic surgery

Effects of different doses of dexmedetomidine on inflammatory factors and T lymphocyte subsets in elderly patients undergoing laparoscopic surgery 62 Journal of Hainan Medical University 2017; 23(17): 62-66 Journal of Hainan Medical University http://www.hnykdxxb.com Effects of different doses of dexmedetomidine on inflammatory factors and T lymphocyte

More information

Short information about the ZOBA. Participating on proficiency tests. Monitoring programme

Short information about the ZOBA. Participating on proficiency tests. Monitoring programme Short information about the ZOBA Laboratory methods Participating on proficiency tests Research projects Monitoring programme Raymond Miserez DVM, ZOBA, Institute of Veterinary Bacteriology, Vetsuisse

More information

GROUP 4: ANTIMICROBIAL SUSCEPTIBILITY TESTING FOR SELECETED SPECIES

GROUP 4: ANTIMICROBIAL SUSCEPTIBILITY TESTING FOR SELECETED SPECIES GROUP 4: ANTIMICROBIAL SUSCEPTIBILITY TESTING FOR SELECETED SPECIES CARPS-Bacterial species of importance Aeromonas sp. (A. hydrohila, A. veronii, A. sorbia, A. caviae, A. schubertii, except A. salmonicida)

More information

Phages. The Tbilisi phage (Vershilova and

Phages. The Tbilisi phage (Vershilova and DIFFERENTIATION OF BRUCELLAE BY THE AID OF PHAGES J6ZEF PARNAS Department of Microbiology, Academy of Medicine, Lublin, Poland ABSTRACT PARNAS, J6ZEF (Academy of Medicine, Lublin, Poland). Differentiation

More information

Design of antimicrobial susceptibility testing programmes relevant to aquaculture and aquacultural products

Design of antimicrobial susceptibility testing programmes relevant to aquaculture and aquacultural products FMM/RAS/298: Strengthening capacities, policies and national action plans on prudent and responsible use of antimicrobials in fisheries Workshop 2 in cooperation with Malaysia Department of Fisheries and

More information

Ch. 17: Classification

Ch. 17: Classification Ch. 17: Classification Who is Carolus Linnaeus? Linnaeus developed the scientific naming system still used today. Taxonomy What is? the science of naming and classifying organisms. A taxon group of organisms

More information

QUICK REFERENCE. Pseudomonas aeruginosa. (Pseudomonas sp. Xantomonas maltophilia, Acinetobacter sp. & Flavomonas sp.)

QUICK REFERENCE. Pseudomonas aeruginosa. (Pseudomonas sp. Xantomonas maltophilia, Acinetobacter sp. & Flavomonas sp.) Pseudomonas aeruginosa (Pseudomonas sp. Xantomonas maltophilia, Acinetobacter sp. & Flavomonas sp.) Description: Greenish gray colonies with some beta-hemolysis around each colony on blood agar (BAP),

More information

Aberdeen Hospital. Antibiotic Susceptibility Patterns For Commonly Isolated Organisms For 2015

Aberdeen Hospital. Antibiotic Susceptibility Patterns For Commonly Isolated Organisms For 2015 Aberdeen Hospital Antibiotic Susceptibility Patterns For Commonly Isolated s For 2015 Services Laboratory Microbiology Department Aberdeen Hospital Nova Scotia Health Authority 835 East River Road New

More information

The Journal of Veterinary Medical Science

The Journal of Veterinary Medical Science Advance Publication The Journal of Veterinary Medical Science Accepted Date: Sep 0 J-STAGE Advance Published Date: Oct 0 FULL PAPER Bacteriology SEROTYPES, ANTIMICROBIAL SUSCEPTIBILITY, AND MINIMAL INHIBITORY

More information

Cause Analysis of Asphalt Pavement Rutting on Section N5 in Pakistan

Cause Analysis of Asphalt Pavement Rutting on Section N5 in Pakistan 1 st International Conference on Transportation Infrastructure and Materials (ICTIM 2016) ISBN: 978-1-60595-367-0 Cause Analysis of Asphalt Pavement Rutting on Section N5 in Pakistan PengLin Li 1,2, Yu

More information

Acinetobacter species-associated infections and their antibiotic susceptibility profiles in Malaysia.

Acinetobacter species-associated infections and their antibiotic susceptibility profiles in Malaysia. Biomedical Research 12; 23 (4): 571-575 ISSN 97-938X Scientific Publishers of India Acinetobacter species-associated infections and their antibiotic susceptibility profiles in Malaysia. Nazmul MHM, Jamal

More information

CHINA: Progress report on the aquaculture component of country NAPs on AMR

CHINA: Progress report on the aquaculture component of country NAPs on AMR FMM/RAS/298: Strengthening capacities, policies and national action plans on prudent and responsible use of antimicrobials in fisheries Workshop 2 in cooperation with Malaysia Department of Fisheries and

More information

albendazole praziquantel

albendazole praziquantel 255 1 1 1 2 2,3 1 2 3 (Cysticercosis) (Taenia solium) 2003 2012 18,500 albendazole praziquantel praziquantel albendazole 2015:25:255-261 albendazole praziquantel (Cysticercosis) (Taenia solium) 104 9 1

More information

Laboratory determination of the susceptibility to antibiotics of bacteria isolated from aquatic animals Peter Smith

Laboratory determination of the susceptibility to antibiotics of bacteria isolated from aquatic animals Peter Smith FMM/RAS/298: Strengthening capacities, policies and national action plans on prudent and responsible use of antimicrobials in fisheries Laboratory determination of the susceptibility to antibiotics of

More information

VERTEBRATA PALASIATICA

VERTEBRATA PALASIATICA 1) 42 2 2004 4 VERTEBRATA PALASIATICA pp. 171 176 fig. 1 1 1,2 1,3 (1 710069) (2 710075) (3 710062) :,, : Q915. 864 : A :1000-3118(2004) 02-0171 - 06 1, 1999, Coni2 codontosaurus qinlingensis sp. nov.

More information

Antibiotic Discovery and Development

Antibiotic Discovery and Development Thomas J. Dougherty Michael J. Pucci Editors Antibiotic Discovery and Development ringer VOLUME I Part I Introductory History of Antimicrobial Drugs 1 The Early History of Antibiotic Discovery: Empiricism

More information

DESCRIPTIONS OF THREE NEW SPECIES OF PETALOCEPHALA STÅL, 1853 FROM CHINA (HEMIPTERA: CICADELLIDAE: LEDRINAE) Yu-Jian Li* and Zi-Zhong Li**

DESCRIPTIONS OF THREE NEW SPECIES OF PETALOCEPHALA STÅL, 1853 FROM CHINA (HEMIPTERA: CICADELLIDAE: LEDRINAE) Yu-Jian Li* and Zi-Zhong Li** 499 DESCRIPTIONS OF THREE NEW SPECIES OF PETALOCEPHALA STÅL, 1853 FROM CHINA (HEMIPTERA: CICADELLIDAE: LEDRINAE) Yu-Jian Li* and Zi-Zhong Li** * Institute of Entomology, Guizhou University, Guiyang, Guizhou

More information

Received 4 April 2003/Returned for modification 23 May 2003/Accepted 11 June 2003

Received 4 April 2003/Returned for modification 23 May 2003/Accepted 11 June 2003 JOURNAL OF CLINICAL MICROBIOLOGY, Sept. 2003, p. 4318 4323 Vol. 41, No. 9 0095-1137/03/$08.00 0 DOI: 10.1128/JCM.41.9.4318 4323.2003 Copyright 2003, American Society for Microbiology. All Rights Reserved.

More information

Scientific Program. 08:30 Phylogenomic transduction networks reveal genetic barriers for phagemediated lateral gene transfer Tal Dagan, Germany

Scientific Program. 08:30 Phylogenomic transduction networks reveal genetic barriers for phagemediated lateral gene transfer Tal Dagan, Germany Scientific Program SUNDAY, 17 MAY 2015 17:00-17:30 Welcome Kornelia Smalla, Germany 17:30-18:05 Opening Lecture Antibiotics at sub-inhibitory concentrations Fernando Baquero, Spain 18:30-20:00 Welcome

More information

Isolation of antibiotic producing Actinomycetes from soil of Kathmandu valley and assessment of their antimicrobial activities

Isolation of antibiotic producing Actinomycetes from soil of Kathmandu valley and assessment of their antimicrobial activities International Journal of Microbiology and Allied Sciences (IJOMAS) ISSN: 2382-5537 May 2016, 2(4):22-26 IJOMAS, 2016 Research Article Page: 22-26 Isolation of antibiotic producing Actinomycetes from soil

More information

Reproductive ecology of Sichuan digging frogs (Microhylidae: Kaloula rugifera)

Reproductive ecology of Sichuan digging frogs (Microhylidae: Kaloula rugifera) Acta Herpetologica 10(1): 17-21, 2015 DOI: 10.13128/Acta_Herpetol-14594 Reproductive ecology of Sichuan digging frogs (Microhylidae: Kaloula rugifera) Wei Chen 1, *, Lina Ren 2, Dujuan He 2, Ying Wang

More information

OIE Reference Laboratory Reports Activities

OIE Reference Laboratory Reports Activities OIE Reference Laboratory Reports Activities Activities in 2017 This report has been submitted : 2018-01-03 08:50:56 Name of disease (or topic) for which you are a designated OIE Reference Laboratory: Enzootic

More information

S PRINGER PROTOCOLS HANDBOOKS

S PRINGER PROTOCOLS HANDBOOKS S PRINGER PROTOCOLS HANDBOOKS For further volumes: http://www.springer.com/series/8623 Animal Coronaviruses Edited by Leyi Wang Animal Disease Diagnostic Laboratory, Ohio Department of Agriculture, Reynoldsburg,

More information

Prevalence of Metallo-Beta-Lactamase Producing Pseudomonas aeruginosa and its antibiogram in a tertiary care centre

Prevalence of Metallo-Beta-Lactamase Producing Pseudomonas aeruginosa and its antibiogram in a tertiary care centre International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 4 Number 9 (2015) pp. 952-956 http://www.ijcmas.com Original Research Article Prevalence of Metallo-Beta-Lactamase

More information

No limbs Eastern glass lizard. Monitor lizard. Iguanas. ANCESTRAL LIZARD (with limbs) Snakes. No limbs. Geckos Pearson Education, Inc.

No limbs Eastern glass lizard. Monitor lizard. Iguanas. ANCESTRAL LIZARD (with limbs) Snakes. No limbs. Geckos Pearson Education, Inc. No limbs Eastern glass lizard Monitor lizard guanas ANCESTRAL LZARD (with limbs) No limbs Snakes Geckos Species: Panthera pardus Genus: Panthera Family: Felidae Order: Carnivora Class: Mammalia Phylum:

More information

International Research Journal of Biological Sciences ISSN Vol. 4(1), 16-24, January (2015)

International Research Journal of Biological Sciences ISSN Vol. 4(1), 16-24, January (2015) International Research Journal of Biological Sciences ISSN 2278-3202 A comparative study of Hygienic status of Butchers and Identifybacteria among the Slaughters of Meat, Chicken and Fish markets of Jagdalpur

More information

COURSE SYLLABUS. (Clinical Bacteriology-1

COURSE SYLLABUS. (Clinical Bacteriology-1 COURSE SYLLABUS (Clinical Bacteriology- MLAB-47) COURSE SYLLABUS Course title: Clinical Bacteriology- Code: MLAB-47 Credit hours: 4 (3 Theory+ Practical) Name of faculty member: Dr. Mohamudha Parveen Rahamathulla

More information

I yellow, a great assortment of shades of red and yellow being known. The

I yellow, a great assortment of shades of red and yellow being known. The INHERITANCE OF BULB COLOR IN THE ONION A. E. CLARKE, H. A. JONES, AND T. M. LITTLE' U. S. Department oj Agrudture, Bdtsville, Maryland Received February 17, 1944 N THE onion the color of the bulb ranges

More information

There are two international organisations that set up guidelines and interpretive breakpoints for bacteriology and susceptibility

There are two international organisations that set up guidelines and interpretive breakpoints for bacteriology and susceptibility ANTIMICROBIAL SUSCEPTIBILITY TESTING ON MILK SAMPLES Method and guidelines There are two international organisations that set up guidelines and interpretive breakpoints for bacteriology and susceptibility

More information

Global comparisons of beta diversity among mammals, birds, reptiles, and amphibians across spatial scales and taxonomic ranks

Global comparisons of beta diversity among mammals, birds, reptiles, and amphibians across spatial scales and taxonomic ranks Journal of Systematics and Evolution 47 (5): 509 514 (2009) doi: 10.1111/j.1759-6831.2009.00043.x Global comparisons of beta diversity among mammals, birds, reptiles, and amphibians across spatial scales

More information

Karyological Studies on Six Anuran Species from Yunnan Province, China

Karyological Studies on Six Anuran Species from Yunnan Province, China Japanese Journal of Herpetology 15(1): 22-28., June 1993 Karyological Studies on Six Anuran Species from Yunnan Province, China WANZHAO LIU, DATONG YANG, AND MITSURU KURAMOTO Abstract: Karyotypes of six

More information

European Committee on Antimicrobial Susceptibility Testing

European Committee on Antimicrobial Susceptibility Testing European Committee on Antimicrobial Susceptibility Testing Routine and extended internal quality control as recommended by EUCAST Version 5.0, valid from 015-01-09 This document should be cited as "The

More information

Whit I e y G. P The fishes of Michaelmas Cay, North Queensland. Ree. Austrar. Mus., v \V hit I e y G. P Studies in ichthyology no

Whit I e y G. P The fishes of Michaelmas Cay, North Queensland. Ree. Austrar. Mus., v \V hit I e y G. P Studies in ichthyology no Whit I e y G. P. 1927. The fishes of Michaelmas Cay, North Queensland. Ree. Austrar. Mus., v. 16. 1 \V hit I e y G. P. 1932. Studies in ichthyology no 6.- Ree. Austral. Mus., v. 18. Whit 1 e y G. P. 1933.

More information

Quality assurance of antimicrobial susceptibility testing

Quality assurance of antimicrobial susceptibility testing Quality assurance of antimicrobial susceptibility testing Derek Brown Routine quality control Repeated testing of controls in parallel with tests to ensure that the test system is performing reproducibly

More information