Mendel: Understanding Inheritance. What is Genetics?

Size: px
Start display at page:

Download "Mendel: Understanding Inheritance. What is Genetics?"

Transcription

1 Gregor Mendel The father of genetics Mendelian Genetics & Punnett Squares What is Genetics? GENETICS - is the science of how traits are inherited. In other words, how traits pass from parent to offspring. What are TRAITS? TRAITS are characteristics (the way we look, are, or think). For example, eing tall or short, lond or dark-haired, rown eyes or lue eyes, light or dark skinned, funny or serious, etc Traits are genetic and are passed down from parent to offspring. Who was Gregor Mendel? Gregor Mendel was an Austrian monk, who lived in the 1800 s. Mendel conducted thousands of experiments on pea plants to see how traits (shape, color) were passed from generation to generation. Mendel is known as the Father of Genetics for figuring out the asic rules of how traits are inherited. What type of experiments did Mendel do? Mendel crossed pea plants with different traits (eg. tall & short). He started with PURERED plants (showed same trait for many generations short parents had short offspring) He crossed a tall parent with a short parent to see what the offspring plants would look like. The 1 st generation of offspring were ALL tall! The short trait was lost it had disappeared. What happened? In the 2 nd generation, the lost short trait reappeared in ¼ of the offspring. (Even though neither parent was short!) Mendel tested MANY traits and found that one form of the trait was always dominant in the first generation of offspring, ut that the hidden trait re-appeared in 25% of the second generation. So, what are Mendel s rules of inheritance? Mendel figured out that: Traits are controlled y PAIRS of factors (genes) that are inherited from your parents (one from mom, one from dad). Some factors are dominant - they mask or hide the other factor. (For example, the tallness gene hides the shortness gene in pea plants.) Let s get the new vocaulary straight GENES - are the factors that control an inherited trait. ALLELES are the different forms of a gene. (the TALL and SHORT alleles are the 2 forms of the HEIGHT gene in pea plants) *We inherit one allele (or form of a gene) from our mom and one allele from our dad, so we have 2 alleles for every gene. 1

2 Let s get the new vocaulary straight Let s get the new vocaulary straight Let s get the new vocaulary straight DOMINANT ALLELE - is one whose trait always shows up when the allele is present. It can mask or hide the other form of the trait. It is shown with an upper-case letter, for example T. Example: Tall stems = TT or Tt RECESSIVE ALLELE is one whose trait is hidden whenever the dominant allele is present. It will only show up if OTH alleles are recessive. It is shown with a lower-case letter, for example t. Example: Short stems = tt HOMOZYGOUS - Organisms with 2 same alleles. HETEROZYGOUS - Organisms with 2 different alleles. TT Tt tt Tt Let s review When you cross the tall and the short plant, the offspring get a Tall allele (T) from the tall plant and a short allele (t) from the short plant. In the first generation, the dominant TALL allele hides the recessive SHORT allele, so ALL the offspring are tall. They are all heterozygous. TT tt Tt Tt What happens if heterozygous plants cross? In the SECOND generation, the heterozygous plants cross and it s possile to have an offspring with the 2 recessive alleles. With 2 recessive alleles, the plant will e SHORT, not tall. TT tt Tt Tt TT Tt Tt tt SUMMARY When studying genetics, we need to take 2 things into account: PHENOTYPE - an organism s PHYSICAL appearance. (3 plants are tall, 1 is short) GENOTYPE an organism s GENETIC makeup (alleles). (1 plant is TT, 2 plants are Tt, and 1 plant is tt) TT Tt Tt tt Proaility & Heredity: Punnett Squares How can we figure out which traits will e inherited? To talk aout inheritance, we need to use our new vocaulary We ve learned aout dominant & recessive alleles: Dominant alleles are more powerful, and can hide a recessive trait. Shown with an upper-case letter ( T for tall stems) Recessive alleles can e hidden when a dominant allele is present. Shown with a lower-case letter ( t for short stems) How can we figure out which traits will e inherited? You know the differences etween genotype and phenotype: Genotype descries which genes (alleles) are present.» TT = 2 dominant alleles» Tt = 1 dominant & 1 recessive» tt = 2 recessive alleles Phenotype descries what the physical trait looks like.» Tall stems (TT and Tt)» Short stems (tt) 2

3 More vocaulary Geneticist use 2 terms to descrie GENOTYPE: Homozygous the organism has 2 same alleles.» TT = 2 dominant alleles» tt = 2 recessive alleles Heterozygous the organism has 2 different alleles.» Tt = 1 dominant & 1 recessive allele So, how do we know which genotype or phenotype the offspring will e? We can use a tool called a punnett square to predict how likely it is for an offspring to inherit certain traits. A PUNNETT SQUARE: is a chart that shows ALL the possile cominations of a genetic cross. shows genotype and phenotype of the offspring. is also used to predict the proaility (the chance) that an offspring will have a certain trait. How do we draw a Punnett Square? R is dominant for Round seeds. r is recessive for wrinkled seeds. oth parents are heterozygous and have round seeds. The two-letter cominations are the possile genotypes of the offspring. They are RR, Rr, Rr, and rr genotypes. From this it is possile to determine the proaility (chance) that a seed will have: a round seed phenotype (3/4 or 75%) OR a wrinkled seed phenotype (1/4 or 25%) Try one on your own Cross a homozygous guinea pig with lack fur () with a homozygous guinea pig with white fur (). 3

4 The result? All 4 possile offspring will e heterozygous and have one dominant allele for lack fur and 1 recessive allele for white fur. All the guinea pigs will have the lack fur phenotype; and genotype. More practice prolems 1) Cross a heterozygous tall pea plant (Tt) with a homozygous short pea plant (tt). Tall stems (T) are dominant over short stems (t). What are the possile offspring from this cross? 2) Cross a rait who is heterozygous for short ears (Ee) with another rait who is heterozygous for short ears (Ee). Short ears (E) are dominant over long, floppy ears (e). What are the possile offspring from this cross? Proaility & Heredity: Punnett Squares How can we figure out which traits will e inherited? To talk aout inheritance, we need to use our new vocaulary We ve learned aout dominant & recessive alleles: Dominant alleles are more powerful, and can hide a recessive trait. Shown with an upper-case letter ( T for tall stems) Recessive alleles can e hidden when a dominant allele is present. Shown with a lower-case letter ( t for short stems) How can we figure out which traits will e inherited? You know the differences etween genotype and phenotype: Genotype descries which genes (alleles) are present.» TT = 2 dominant alleles» Tt = 1 dominant & 1 recessive» tt = 2 recessive alleles Phenotype descries what the physical trait looks like.» Tall stems (TT and Tt)» Short stems (tt) More vocaulary Geneticist use 2 terms to descrie GENOTYPE: Homozygous the organism has 2 same alleles.» TT = 2 dominant alleles» tt = 2 recessive alleles Heterozygous the organism has 2 different alleles.» Tt = 1 dominant & 1 recessive allele So, how do we know which genotype or phenotype the offspring will e? We can use a tool called a punnett square to predict how likely it is for an offspring to inherit certain traits. A PUNNETT SQUARE: is a chart that shows ALL the possile cominations of a genetic cross. shows genotype and phenotype of the offspring. is also used to predict the proaility (the chance) that an offspring will have a certain trait. How do we draw a Punnett Square? R is dominant for Round seeds. r is recessive for wrinkled seeds. oth parents are heterozygous and have round seeds. 4

5 The two-letter cominations are the possile genotypes of the offspring. They are RR, Rr, Rr, and rr genotypes. From this it is possile to determine the proaility (chance) that a seed will have: a round seed phenotype (3/4 or 75%) OR a wrinkled seed phenotype (1/4 or 25%) Try one on your own Cross a homozygous guinea pig with lack fur () with a homozygous guinea pig with white fur (). (lack fur is dominant over white fur). Try one on your own Cross a homozygous guinea pig with lack fur () with a homozygous guinea pig with white fur (). Try one on your own Cross a homozygous guinea pig with lack fur () with a homozygous guinea pig with white fur (). Try one on your own Cross a homozygous guinea pig with lack fur () with a homozygous guinea pig with white fur (). The result? All 4 possile offspring will e heterozygous and have one dominant allele for lack fur and 1 recessive allele for white fur. All the guinea pigs will have the lack fur phenotype; and genotype. 5

6 More practice prolems Review Review 1) Cross a heterozygous tall pea plant (Tt) with a homozygous short pea plant (tt). Tall stems (T) are dominant over short stems (t). What are the possile offspring from this cross? 2) Cross a rait who is heterozygous for short ears (Ee) with another rait who is heterozygous for short ears (Ee). Short ears (E) are dominant over long, floppy ears (e). What are the possile offspring from this cross? Tall eyealls (T) are dominant over short eyealls (t). Mr. Kras is homozygous for tall eyealls. What is his genotype? T T Mrs. Kras is heterozygous (Tt). Does she have tall eyealls or short eyealls? Tall eyealls (the short allele is hidden). Draw the punnett square for Mr. and Mrs. Kras. T t T TT Tt T TT Tt Any ay that Mr. and Mrs. Kras would have tall eyes (100% chance), ecause they get a dominant TALL eyeall allele from Mr. Kras. While 50% of their kids might have the short eyeall gene from their mom, it is ALWAYS hidden if the dominant (T) gene is present! Punnett Square Practice Prolems To test his genotype, she Dalmatians A She dog will reeder only are reed has often a the male orn dog dog deaf. if reeds him to a deaf (dd) These that his genotype she dogs would are is like DD, deaf to so if reed. there they will female. Use Punnett squares to inherit The e no dog risk two can of copies hear, deafness so of she the in the knows predict the outcomes if the recessive his puppies. genotype allele is either for hearing DD or (d). Dd. male is DD or Dd. 1)Show your punnett square for each cross. 2) Give the phenotypes of the offspring. Will the puppies e deaf or hearing? Punnett Square Practice Prolems To test his genotype, she reeds him to a deaf (dd) female. Use Punnett squares to predict the outcomes if the male is DD or Dd. If D the male D is If the male is homozygous D d heterozygous (Dd), d Dd Dd dominant (DD), d Ddall puppies half of the puppies will dd will e ale to hear. The e orn deaf. They will d Dd Dd recessive d deaf Dd allele dd is e homozygous for the hidden. recessive deaf allele. Punnett Square Practice Prolems Cindy wants to know if their Jimmy Neutron and Cindy children will all have ig, poofy Vortex may pretend not to hair ( or ), the dominant like each other, ut they end trait in Retroville. Jimmy and up marrying later in life! Cindy are oth heterozygous for the ig hair trait. What are Jimmy and Cindy s genotypes? Jimmy = Cindy = Punnett Square Practice Prolems Cindy, who is proud of her ig hair, does not want a flathaired child (). Set up a Punnett square to figure out whether Cindy will e disappointed or not. rain last! 25% of our kids will have flat hair. Sorry Cindy! Challenge Question! In purple people-eaters, 2-horns is dominant (H), and no horns is recessive (h). Two purple people-eaters crossed and they had 4 children shown elow. (What are the genotypes?) Work ackwards from a punnett square to find out the genotypes and phenotypes of the parents. Hh hh hh Hh Challenge Question! What are the genotypes and phenotypes of the parents? Genotype = Hh, hh Phenotype = One parent had horns, the other parent had no horns! h? h?? H? h Hh Hh hh hh Hh hh hh Hh 6

7 Incomplete Dominance With some traits, there is a situation where the What dominant you think allele will is not happen completely in this dominant. cross? When RR (red the flowers) organism x is rr heterozygous, (white flowers) the trait is expressed as a lend. All offspring will e heterozygous ut NOT red (ecause it is not completely dominant). R R They will e a lend of red and white PINK! r Rr Rr r Rr Rr Incomplete Dominance What if we cross 2 of the pink flowers? Rr (pink flowers) x Rr ( pink flowers) R r R RR Rr r Rr rr 1 (RR) has RED flowers. 2 are a lend (Rr) PINK flowers. 1 (rr) has white flowers. Exit Slip In humans, rown eyes () are dominant over lue (). A man who is heterozygous for rown eyes marries a lue-eyed woman and they have 3 kids. 1) What is the genotype of the father? 2) What is the genotype of the mother? 3) Draw a punnett square for this cross. 4) What are the possile phenotypes and genotypes of their children? 5) What is the proaility (% chance) that their child will have lue eyes? rown eyes? Genetics: The Science of Heredity What is Genetics? GENETICS - is the science of how traits are inherited. In other words, how characteristics pass from parent to offspring. So, what are genes anyway? Genes are: The asic unit of inheritance (they are what you get from your parents). Pieces of DNA (more on that later ) The recipe for making YOU. (Genes make proteins & proteins make up your cells). What make you different from one another. No one else has your exact, unique comination of genes. Where are my genes? Your genes are inside all the cells of your ody. Inside the nucleus of your cells, are chromosomes. Chromosomes are made of tightly wound up DNA (called chromatin). The DNA code makes up your genes. Chromosomes?!?! Chromosomes are tightly wound-up packages of DNA. Humans have 23 pairs of chromosomes, 46 in all. (Sperm & Egg cells only have 23 single chromosomes!) Each parent contriutes one chromosome to each pair, so you get half your chromosomes from your mom and half from your dad. Tell me more aout DNA DNA stands for: deoxyrionucleic acid. Sound it out. DE OXY RYE OW NEWK LAY IC ACID. DNA is a giant molecule made of certain chemicals. 7

8 The Structure of DNA DNA looks like a long, twisted ladder called a DOULE HELIX. There are 2 long strands. These are the sugar-phosphate ackones of DNA. The steps of the ladder that connect the strands are asepairs. There are only 4 different chemicals that ond the 2 strands together: ADENINE (A) THYMINE (T) CYTOSINE (C) GUANINE (G) The Structure of DNA Only ond with each other! Only ond with each other! Order of the ase Pairs = Genetic Code The order of the ase pairs (ACGTGCGATAT) are the recipe for how the proteins will e made If you have 1 of the strands, you can uild a protein y matching up the missing ases: G T C A This is how DNA copies itself and makes proteins! Mutations Sometimes, mistakes are made when DNA is copied. These mistakes are called MUTATIONS. There are 3 types: sustitution, deletion, addition. Effects of Mutations Some mutations are harmful, some are helpful, and others don t make much of difference. Mutations add GENETIC VARIETY. We are all different ecause mutations have occurred in our genetic code. Weed toes! So, how many genes do we have anyway? The HUMAN GENOME: Has 3 illion ase pairs of DNA! Includes aout 35,000 genes! 99.9% of your DNA is identical to everyone else s. All our differences come from that 0.1%! - The DNA Connection Review Inside your cells, you have chromosomes (23 pairs!). Chromosomes are made of long strands of DNA. DNA has a doule helix shape (twisted ladder). DNA is made of cominations of nitrogen ase-pairs (A-T, C-G). These cominations are the recipes for making proteins. GATGCTAC CRACKING AAT THE GEN TCCAGCA ETIC CODE TTCG What is DNA? DNA stands for deoxyrionucleic acid. DNA is the chemical that makes up our genes. Your DNA is your GENETIC CODE - it is the recipe or the set of instructions to make YOU! 8

9 What does DNA look like? It is shaped like a twisted ladder called a doule helix. There are 2 long strands the sugar-phosphate ackones. The steps of the ladder are the ase-pairs that connect the 2 strands. What is the Genetic Code? There are only 4 different chemicals that ond the 2 strands together: C only onds with G A only onds with T What is the Genetic Code? The order of the ase-pairs is your genetic code! ATGCTGCATGCCTGAAATAGCTA TACGACGTACGGACTTTATCGAT This code isn t nonsense! It s the recipe for making the proteins that make up YOU! How does your ody read this code and know which proteins to make? The Each ody codon reads is one the small code part 3-ases of the at a time. instructions Each group that tells of 3-ases the ody is called to a make CODON. a specific protein. ATG TTCCAA GCC TCATTC Genetic Code-reaking! Try using the codon key to decode a set of instructions! Why were there different pictures? The original code said GAC AGA GCA TGG ATT GCA ATT CAC CCG ACG AGC GAA ATT DRAW GCA AAC A HOUSE GAC ATT GCA AND ATT A AGA RED GAA FISH GAC ATT IN TTC A OWL. ATA AGC CAC ATT ATA AAC ATT GCA ATT GCG CCG TGG TTA ut one group had one codon switched GAC AGA GCA TGG ATT GCA ATT CAC ATG CCG ACG AGC GAA ATT DRAW GCA AAC A MOUSE GAC ATT GCA AND ATT A AGA RED GAA FISH GAC ATT IN TTC A OWL. ATA AGC CAC ATT ATA AAC ATT GCA ATT GCG CCG TGG TTA Another group had a codon switched and an extra codon inserted GAC AGA GCA TGG ATT GCA ATT CAC CCG ACG AGC GAA ATT DRAW GCA AAC A HOUSE GAC ATT GCA AND ATT A AGA DEAD GAC GAA FISH GAA GAC IN ATT A OWL. TTC ATA AGC CAC ATT ATA AAC ATT GCA ATT GCG CCG TGG TTA The last group had several codons deleted GAC AGA GCA TGG ATT GCA ATT CAC CCG ACG AGC GAA DRAW A HOUSE AND A ATT GCA AAC GAC ATT GCA ATT AGA GAA RED GAC FISHOWL. ATT TTC ATA AGC CAC ATT ATA AAC ATT GCA ATT GCG CCG TGG TTA 9

10 What happens if there is a mistake in the code? Sometimes, These mistakes mistakes are called are made MUTATIONS. when DNA is There copied. are 3 types: SUSTITUTION DELETION ADDITION What is the effect of a mutation? The mutation changes the meaning of the code It messes up the instructions! For example look at the effect of taking out one letter from this sentence THE ATC FAT CAT ATA ATE TET THE HER RAT. DELETION Mutation ut Deleting rememer, even 1 codons ase pair are read can make in 3 letter a ig difference! sections, so all the letters move over What is the effect of a mutation? THE AT FAT CAT ATE THE RAT. SUSTITUTION Mutation Changing 1 ase pair may make a small difference or THE FAT FAAT TCA CAT TAT ATE ETH THE ERA RAT. ADDITION Mutation a ig difference! What is the effect of a mutation? Some Mutations mutations add GENETIC are harmful VARIETY. UT, We are some all different can e helpful, ecause and others don t mutations make have much occurred difference. in our genetic code. Weed toes! What is a pedigree chart? How is it used? One important tool a geneticist uses to trace the inheritance of traits is a pedigree chart. A pedigree chart is one that geneticists use to track an inherited trait through several generations of a family to try to understand how it is inherited. How do you read a pedigree chart? A CIRCLE represents a FEMALE. A SQUARE represents a MALE. A horizontal line represents marriage. A vertical line and rackets connects parents to children. How do you read a pedigree chart? A shape that is not shaded indicates that the person does NOT have the trait. A shape that is half-shaded indicates that the person is a carrier (has 1 allele). A shape that is completely-shaded indicates that the person has the trait (homozygous oth alleles for the trait). 10

11 What does this pedigree chart show? What does this pedigree chart show? How many people are unaffected carriers? How many people are affected y the disorder? How many carriers are female? If only 1 parent is a carrier, what is the proaility of having a child with the disorder? How many people are unaffected carriers? How many people are affected y the disorder? Can we tell if the disorder is dominant or recessive? If 1 parent has the disorder, what is the proaility of having a child with the disorder? Genetic Disorders What are genetic disorders? A genetic disorder is an anormal condition that a person inherits through their genes or chromosomes. What are genetic disorders? Some are caused y mutations in DNA. For example, sickle cell disease! What are genetic disorders? This is a picture of ALL your chromosomes called a karyotype. Others are caused y igger changes in the chromosome. For example, having too many chromosomes Down Syndrome. How do you get a genetic disorder? Genetic disorders like Cystic Firosis are NOT contagious! You can t catch them from someone else who is sick! You inherit them from your parents. Sickle Cell Disease What is Sickle Cell Disease? Affects millions around the world, mostly in Africa Aout 70,000 Americans are estimated to have the disease Aout 1000 aies are orn with the disease in the US each year 11

12 What is Sickle Cell Disease? Sickle cell is passed on y a recessive gene People with only one copy of the gene are healthy Since they can still pass on the recessive sickle-cell gene, these people are called carriers Sickle cell gene in lue Can e covered up y the dominant gene (red). What is Sickle Cell Disease? People with two copies of the sickle cell gene have sickle cell disease + If two people who are oth carriers have children, what is the possiility of their child having sickle cell disease? Set up a Punnett square on the ack of your video guide to figure this out! = sickle cell disease Punnett Square Carriers are heterozygous (they have one dominant gene and one recessive gene) H h H HH Hh h Hh hh There is a 25% chance that their child will have the sickle cell disease. What does it do to you? People with two copies of the sickle cell gene have sickle cell disease The gene codes for hemogloin, an important protein in red lood cells The anormal form of hemogloin clumps together, which changes the shape of the red lood cells + = sickle cell disease What does it do to you? Sickled cells are fragile, sticky, and stiff These cells can get trapped in lood vessels, making it impossile for lood to get through Muscles and organs that depend on lood for oxygen and nutrients can suffer or even stop working Genetics & Heredity Unit Review Where in the cell do you find the genetic material? A. riosome. cell memrane C. rain D. nucleus What does Tt mean to geneticists? A. Two dominant alleles. Two recessive alleles C. One dominant and one recessive allele D. Homozygous allele What is the proaility of producing a tall pea plant from a genetic cross etween 2 hyrid tall plants? A. 1 in 4 (25%). 2 in 4 (50%) C. 3 in 4 (75%) D. 4 in 4 (100%) 12

13 4/3/2015 What determines the genetic code? A. the order of nitrogen ase-pairs along a gene. the numer of nitrogen asepairs in a DNA molecule C. the order of amino acids in a protein D. The numer of cytosine and guanines in a molecule A homozygous lack rait () is crossed with a homozygous white rait (). What is the % proaility the offspring will have white fur? A. 0%. 25% C. 50% D. 75% Which comination of sex chromosomes result in a male human eing? A.. C. D. XX YY XY Either XX or YY What is the missing genotype in the punnett square? A.. C. D.? We know that the alleles for detached/free earloes (E) is dominant over attached earloes (e). What is the dominant phenotype? A. EE. Ee C. Detached earloes D. Attached earloes An organism s genotype is its: A.. C. D. genetic makeup chromosome numer physical appearance stem height What is the total magnification of a microscope when the eyepiece is 10x magnification and the medium power ojective is 10x? A. 10x. 100x C. 1x D. 20x What is a mutation? A. Any change that is harmful to an organism. Any change in a gene or chromosome C. Any change that is helpful to an organism D. Any change in phenotype Chromosomes are made up of: A. one pair of alleles. messenger RNA C. cells D. Many genes joined together 13

14 4/3/2015 Genetic disorders are caused y: What is the purpose of the Human Genome Project? A. pedigrees.. DNA mutations or changes in chromosomes C. Dominant alleles only. D. Recessive alleles only. A. to identify the DNA sequence of every gene in the human genome. To clone every gene on a single chromosome in human DNA C. To cure genetic diseases D. To inreed the est genes on every chromosome of human DNA How do geneticists use pedigree charts? What would e the est way to determine the proaility of a ay having cystic firosis? A. to create genetic crosses. To replicate strands of DNA C. To prove recessive traits are most common D. To trace inheritance of traits in a family A. y studying the parents cells. y studying the family s pedigree chart C. y exploring new methods of genetic engineering D. y determining if the parents have co-dominant alleles What genetic disorder results in anormally shaped lood cells? What controls the variation in skin color among humans? A. A person s diet. Many genes C. Multiple alleles of a single gene D. Two alleles of a single gene A. Hemophilia. Down syndrome C. Cystic firosis D. Sickle-Cell Disease The Human Genome Project (HGP) can help genetic engineers produce human proteins ecause: A. Identical twins have identical DNA. The HGP has determined the structure of trna. C. The HGP has determined the structure of proteins. D. To produce a protein, geneticists must know the sequence of DNA ases that code for a protein. 14

Mendel: Understanding Inheritance

Mendel: Understanding Inheritance Gregor Menel The father of genetics 1822-1864 Menel: Unerstaning Inheritance What is Genetics? GENETICS - is the science of how traits are inherite. In other wors, how traits pass from parent to offspring.

More information

Analyzing Inheritance of Traits Using Punnett Squares and Pedigrees

Analyzing Inheritance of Traits Using Punnett Squares and Pedigrees Name: Analyzing Inheritance of Traits Using Punnett Squares and Pedigrees Part I: Genetics Vocaulary Use the word ank to complete the sentences elow. 1. is the physical, oservale trait that a person exhiits

More information

Table of Contents Date Assignment Pg # 12/16/16 Cell Exam Corrections 27R Genetics 1/4/17 DNA Extraction Lab 28R 1/6/17 Discovering DNA 29R 1/10/17

Table of Contents Date Assignment Pg # 12/16/16 Cell Exam Corrections 27R Genetics 1/4/17 DNA Extraction Lab 28R 1/6/17 Discovering DNA 29R 1/10/17 Tale of Contents Date Assignment Pg # 12/16/16 Cell Exam Corrections 27R Genetics 1/4/17 DNA Extraction La 28R 1/6/17 Discovering DNA 29R 1/10/17 DNA Notes 30R 1/12/17 Trait Inventory 31R 1//17 ay Face

More information

Important to know before getting started: Female. Male

Important to know before getting started: Female. Male Important to know efore getting started: Female Male Punnett Square Scientists use a Punnett s square to determine the possile genetic outcomes for the offspring that result from the comination of the

More information

Genetics Intervention

Genetics Intervention Genetics Intervention Vocabulary: Define the following terms on a separate piece of paper. allele autosome chromosome codominance dihybrid diploid dominant gene gamete haploid heterozygous homozygous incomplete

More information

Next Wednesday declaration of invasive species due I will have Rubric posted tonight Paper is due in turnitin beginning of class 5/14/1

Next Wednesday declaration of invasive species due I will have Rubric posted tonight Paper is due in turnitin beginning of class 5/14/1 Next Wednesday declaration of invasive species due I will have Rubric posted tonight Paper is due in turnitin beginning of class 5/14/1 4/13. Warm-up What is the difference between mrna and trna: mrna

More information

Chapter 8 Heredity. Learning Target(s):

Chapter 8 Heredity. Learning Target(s): Chapter 8 Heredity copyright cmassengale 1 Learning Target(s): I Can. A) explain the differences between dominant and recessive traits. B) explain the differences between phenotypes and genotypes. 1 Why

More information

Students will be able to answer their genetic questions using other inheritance patterns.

Students will be able to answer their genetic questions using other inheritance patterns. Chapter 9 Patterns of Inheritance Figure 9.0_ Chapter 9: Big Ideas Mendel s Laws Variations on Mendel s Laws PowerPoint Lectures for Campell Biology: Concepts & Connections, Seventh Edition Reece, Taylor,

More information

What is Genetics? Genetics is the scientific study of heredity

What is Genetics? Genetics is the scientific study of heredity What is Genetics? Genetics is the scientific study of heredity What is a Trait? A trait is a specific characteristic that varies from one individual to another. Examples: Brown hair, blue eyes, tall, curly

More information

HEREDITY HOW YOU BECAME YOU!

HEREDITY HOW YOU BECAME YOU! HEREDITY HOW YOU BECAME YOU! ESSENTIAL QUESTIONS Why do individuals of the same species vary in how they look, function and behave? WHY DO INDIVIDUALS OF THE SAME SPECIES VARY IN HOW THEY LOOK, FUNCTION

More information

Heredity. What s heredity? An organism s heredity is the set of characteristics it receives from its parents. Today, known as genetics.

Heredity. What s heredity? An organism s heredity is the set of characteristics it receives from its parents. Today, known as genetics. Heredity What s heredity? An organism s heredity is the set of characteristics it receives from its parents. Today, known as genetics. 1 Gregor Mendel Father of Genetics, whose work with pea plants led

More information

Genetics Practice Problems. 1. For each genotype, indicate whether it is heterozygous (HE) or homozygous (HO) AA Bb Cc Dd.

Genetics Practice Problems. 1. For each genotype, indicate whether it is heterozygous (HE) or homozygous (HO) AA Bb Cc Dd. Name Period Genetics Practice Problems 1. For each genotype, indicate whether it is heterozygous (HE) or homozygous (HO) AA Bb Cc Dd Ee ff GG HH Ii Jj kk Ll Mm nn OO Pp 2. For each of the genotypes below,

More information

7. Describe the following with words and give an example: Heterozygous, homozygous recessive, homozygous dominant

7. Describe the following with words and give an example: Heterozygous, homozygous recessive, homozygous dominant Name: Genetics UNIT EXAM Review Below are review questions for each of the 5 learning goals we have addressed during this unit. This is the majority of the science content we covered. However, as a disclaimer

More information

Genetics & Punnett Square Notes

Genetics & Punnett Square Notes Genetics & Punnett Square Notes Essential Question What is Genetics and how are punnett squares used? History of Genetics Gregor Mendel Father of modern genetics Studied pea plants Found that plants that

More information

Monohybrid Cross Video Review

Monohybrid Cross Video Review Name: Period: Monohybrid Cross Video Review 1. What is the name of the little boxes used in order to predict offspring without having to breed? 2. Define Punnett Square: 3. Define a monohybrid cross: 4.

More information

Unit 5 Guided Notes Genetics

Unit 5 Guided Notes Genetics Gregor Mendel Modern genetics began in the mid-1800s in an abbey garden, where a monk named documented inheritance in peas Medel s Work What is inheritance: used good experimental design used analysis

More information

Sex-linked/incomplete dominance/codominance quiz

Sex-linked/incomplete dominance/codominance quiz 1. What is the difference between genotype and phenotype? a. Genotype is the physical characteristics; phenotype is the genetic make-up. b. Genotype is the genetic make-up; phenotype is the physical characteristics.

More information

Seed color is either. that Studies Heredity. = Any Characteristic that can be passed from parents to offspring

Seed color is either. that Studies Heredity. = Any Characteristic that can be passed from parents to offspring Class Notes Genetic Definitions Trait = Any Characteristic that can be passed from parents to offspring Heredity The passing of traits from parent to offspring - Blood Type - Color of our Hair - Round

More information

Beyond Mendel. Extending Mendelian Genetics. Incomplete Dominance. Think about this. Beyond Mendel. Chapter 12

Beyond Mendel. Extending Mendelian Genetics. Incomplete Dominance. Think about this. Beyond Mendel. Chapter 12 Beyond Mendel Extending Mendelian Genetics Chapter 12 Mendel s work did, however, provide a basis for discovering the passing of traits in other ways including: Incomplete Dominance Codominance Polygenic

More information

Bell Ringer. Which features do you have that match your mother? Your father? Which of the following features do you have?

Bell Ringer. Which features do you have that match your mother? Your father? Which of the following features do you have? Bell Ringer Which features do you have that match your mother? Your father? Which of the following features do you have? Widow s Peak? Ability to roll your tongue? Attached earlobes? Simple Genetics Exploring

More information

+ Karyotypes. Does it look like this in the cell?

+ Karyotypes. Does it look like this in the cell? + Human Heredity + Karyotypes A genome is the full set of genetic information that an organism carries in its DNA. Karyotype: Shows the complete diploid set of chromosomes grouped together in pairs, arranged

More information

Yes, heterozygous organisms can pass a dominant allele onto the offspring. Only one dominant allele is needed to have the dominant genotype.

Yes, heterozygous organisms can pass a dominant allele onto the offspring. Only one dominant allele is needed to have the dominant genotype. Name: Period: Unit 4: Inheritance of Traits Scopes 9-10: Inheritance and Mutations 1. What is an organism that has two dominant alleles for a trait? Homozygous dominant Give an example of an organism with

More information

Different versions of a single gene are called allleles, and one can be dominant over the other(s).

Different versions of a single gene are called allleles, and one can be dominant over the other(s). Answer KEY 1 Different versions of a single gene are called allleles, and one can be dominant over the other(s). 2 Describe genotype and phenotype in your own words. A genotype is the genetic makeup of

More information

Genetics Problem Set

Genetics Problem Set AP Biology - Unit 6: Patterns of Inheritance Name: Genetics Problem Set Independent Assortment Problems 1. One gene has alleles A and a. Another has alleles B and b. For each genotype listed, what type(s)

More information

Unit Calendar: Subject to Change

Unit Calendar: Subject to Change NAME : Block : Notes Page 6-1 SOL Objectives LS 12, Genetics By the end of this unit, the students should understand that organisms reproduce and transmit genetic information to new generations: a) the

More information

Patterns of Inheritance. What are the different ways traits can be inherited?

Patterns of Inheritance. What are the different ways traits can be inherited? Patterns of Inheritance What are the different ways traits can be inherited? Review: Patterns of Inheritance we know already 1. Autosomal dominant: If an individual is heterozygous, only one allele is

More information

Chapter 11-2 Probability and Punnett Squares Notes

Chapter 11-2 Probability and Punnett Squares Notes Chapter 11-2 Probability and Punnett Squares Notes Every time Mendel performed a cross with his pea plants, he carefully counted the offspring (over 20,000 plants) his why he noticed there was a pattern!

More information

Genetics (6 th -8 th )

Genetics (6 th -8 th ) Genetics (6 th -8 th ) Essential Question Why is the study of genetics such an important aspect of conservation? Ojectives 1. See a general overview of the study of genetics. 2. Demonstrate that the physical

More information

Blue is the New Black How genes can influence appearance.

Blue is the New Black How genes can influence appearance. Blue is the New Black How genes can influence appearance. Backstory Humans have selectively bred plants and animals for thousands of years in order to create variations most useful to our purposes. This

More information

Name period date assigned date due date returned. The Genetics of Garden Peas

Name period date assigned date due date returned. The Genetics of Garden Peas Name period date assigned date due date returned ollow instructions 1-4. ross 1. Place the parents genotypes in the Punnett Square and fill in the offspring s genotypes. Parent 2 Parent 1 Genotype Results

More information

Punnett square practice Honors KEY

Punnett square practice Honors KEY Punnett square practice Honors KEY 1) Yellow seeds are dominant over recessive green seeds. Cross a homozygous dominant yellow seeded-plant with a green-seeded plant. What are the odds of getting a plant

More information

Station 1. Using the cards, match the vocabulary word with its definition. If there are any words you do not know, write them down if you have time!

Station 1. Using the cards, match the vocabulary word with its definition. If there are any words you do not know, write them down if you have time! Station 1 Using the cards, match the vocabulary word with its definition. If there are any words you do not know, write them down if you have time! Station 2 Answer the following questions on a separate

More information

Patterns of heredity can be predicted.

Patterns of heredity can be predicted. Page of 6 KEY CONCEPT Patterns of heredity can be predicted. BEFORE, you learned Genes are passed from parents to offspring Offspring inherit genes in predictable patterns NOW, you will learn How Punnett

More information

Genetics Since Mendel. At dog and cat shows, an animal s owner may be asked to show its pedigree. What do you think a pedigree shows?

Genetics Since Mendel. At dog and cat shows, an animal s owner may be asked to show its pedigree. What do you think a pedigree shows? chapter 35 Heredity section 2 Genetics Since Mendel Before You Read At dog and cat shows, an animal s owner may be asked to show its pedigree. What do you think a pedigree shows? What You ll Learn how

More information

Please keep all extra notes and practice problems neatly organized in your notebook so that may reference them as needed This information is covered

Please keep all extra notes and practice problems neatly organized in your notebook so that may reference them as needed This information is covered Please keep all extra notes and practice problems neatly organized in your notebook so that may reference them as needed This information is covered in 6.3, 6.4, 6.5 and chapter 7 of your textbook Study

More information

Mendelian Genetics Part 4: Dihybrid Cross

Mendelian Genetics Part 4: Dihybrid Cross Mendelian Genetics Part 4: Dihybrid Cross Name Terms and Explanations Explain the following terms and concepts, using both a diagram and an explanation in sentences or statements: Monohybrid cross Meiosis

More information

DO NOT WRITE ON THIS TEST Unit 6 Assessment Genetics Objective 3.2.2

DO NOT WRITE ON THIS TEST Unit 6 Assessment Genetics Objective 3.2.2 DO NOT WRITE ON THIS TEST Unit 6 Assessment Objective 3.2.2 Vocabulary Matching + 1 point each 1. dominant 2. recessive 3. genotype 4. phenotype 5. heterozygous 6. homozygous 7. incomplete dominance 8.

More information

Genetics Worksheet. Name

Genetics Worksheet. Name Genetics Worksheet Name Section A: Vocabulary 1. Identify if the alleles are homozygous (Ho) or heterozygous (He). a. DD b. Ee c. tt d. Hh 2. For each genotype below, determine the phenotype. a. Purple

More information

Genetics. What s Genetics? An organism s heredity is the set of characteristics it receives from its parents.

Genetics. What s Genetics? An organism s heredity is the set of characteristics it receives from its parents. Genetics Why don t you look exactly like your parents? Pull How are traits passed to the next generation? Pull What s Genetics? An organism s heredity is the set of characteristics it receives from its

More information

Name Date Hour Table # 1i1iPunnett Squares

Name Date Hour Table # 1i1iPunnett Squares 1i1iPunnett Squares A Punnett square is a chart which shows/predicts all possible gene combinations in a cross of parents (whose genes are known). Punnett squares are named for an English geneticist, Reginald

More information

Study of genes and traits and how they are passed on.

Study of genes and traits and how they are passed on. Mendel Single Trait Experiments _ Genetics _ Biology.mp4 Heredity Meet the Super Cow [www.keepvid Study of genes and traits and how they are passed on. Law of Segregation Alleles pairs separate during

More information

Heredity and Genetics Noteguide (Spring Semester)

Heredity and Genetics Noteguide (Spring Semester) Heredity and Genetics Noteguide (Spring Semester) **Your test over this unit will include all in this packet and the one from last semester.** Multiple Alleles- A set of control a trait. Example: Blood

More information

Cross Application Problems

Cross Application Problems Cross Application Problems Name: Period: Objective: To practice solving genetics problems by setting up both monohybrid and dihybrid crosses. Part I Genotypes and Phenotypes: 1. How many traits are investigated

More information

Punnett Squares. and Pedigrees. How are patterns of inheritance studied? Lesson ESSENTIAL QUESTION. J S7L3.b Reproduction and genetic variation

Punnett Squares. and Pedigrees. How are patterns of inheritance studied? Lesson ESSENTIAL QUESTION. J S7L3.b Reproduction and genetic variation Lesson 5 Punnett Squares and Pedigrees ESSENTIAL QUESTION How are patterns of inheritance studied? By the end of this lesson, you should be able to explain how patterns of heredity can be predicted by

More information

Homework Packet. Interactive Notebook. Unit Assessments. Exam-Genetics 100. Lab-Baby Reebops 25. Project: Genetic Disorders Planner 35

Homework Packet. Interactive Notebook. Unit Assessments. Exam-Genetics 100. Lab-Baby Reebops 25. Project: Genetic Disorders Planner 35 NAME PERIOD Points Homework Packet Principles of Heredity 2 Chromosome Mapping 2 Probability and Activities (#1-11) 2 Simple Genetics Problem (#12-15) 2 Practice Crosses (#16-24) 2 Dihybrid: You Try Problems

More information

Mendelian Genetics SI

Mendelian Genetics SI Name Mendelian Genetics SI Date 1. In sheep, eye color is controlled by a single gene with two alleles. When a homozygous brown-eyed sheep is crossed with a homozygous green-eyed sheep, blue-eyed offspring

More information

1 st Type basic vocabulary and setting up Punnett Squares:

1 st Type basic vocabulary and setting up Punnett Squares: Genetics Punnett Square Review Questions Work booklet Name: There are several types of questions that involve the use of Punnett Squares in this unit. Here s the break down or summary of those problems.

More information

Genetics Problems. Character Dominant Recessive

Genetics Problems. Character Dominant Recessive Genetics Problems 1. A rooster with gray feathers is mated with a hen of the same phenotype. Among their offspring, 15 chicks are gray, 6 are black, and 8 are white. What is the simplest explanation for

More information

Heredity and Genetics Notes- Enriched

Heredity and Genetics Notes- Enriched Heredity and Genetics Notes- Enriched Def: Law of Segregation or independent assortment Def: Ex: BB Bb bb Dominance and recessive Traits Traits Stem length Seed shape Seed colour Seed coat colour Pod shape

More information

Bio 111 Study Guide Chapter 14 Genetics

Bio 111 Study Guide Chapter 14 Genetics Bio 111 Study Guide Chapter 14 Genetics BEFORE CLASS: Reading: Read the whole chapter from p. 267-288. It might also be helpful to read before class the Tips for Genetics Problems section on p.290. Definitely

More information

13) PHENOTYPE: the set of observable characteristics of an individual resulting from the interaction of its genotype with the environment.

13) PHENOTYPE: the set of observable characteristics of an individual resulting from the interaction of its genotype with the environment. 12) GENOTYPE: the genetic makeup of an organism with reference to a single trait, set of traits, or the entire complex of traits. 13) PHENOTYPE: the set of observable characteristics of an individual resulting

More information

Name period date assigned date due date returned. The Genetics of Garden Peas

Name period date assigned date due date returned. The Genetics of Garden Peas Name period date assigned date due date returned Follow instructions 1-4. ross 1. Place the parents genotypes in the Punnett Square and fill in the offspring s genotypes. Results of ross Was parent 1 homozygous

More information

Simple Genetics Quiz

Simple Genetics Quiz Simple Genetics Quiz Matching: Match the terms below to their correct definition. (1 point each) 1. heterozygous 2. homozygous 3. dominant 4. recessive 5. phenotype 6. Cystic Fibrosis 7. Sickle Cell Anemia

More information

9-2 Probability and Punnett. Squares Probability and Punnett Squares. Slide 1 of 21. Copyright Pearson Prentice Hall

9-2 Probability and Punnett. Squares Probability and Punnett Squares. Slide 1 of 21. Copyright Pearson Prentice Hall 9-2 Probability and Punnett 11-2 Probability and Punnett Squares Squares 1 of 21 11-2 Probability and Punnett Squares Genetics and Probability How do geneticists use the principles of probability? 2 of

More information

Problem 1. What is the simplest explanation for the inheritance of these colors in chickens?

Problem 1. What is the simplest explanation for the inheritance of these colors in chickens? Problem 1 A rooster with gray feathers is mated with a hen of the same phenotype. Among their offspring, 15 chicks are gray, 6 are black, and 8 are white. What is the simplest explanation for the inheritance

More information

Problem 1. What is the simplest explanation for the inheritance of these colors in chickens?

Problem 1. What is the simplest explanation for the inheritance of these colors in chickens? Problem 1 A rooster with gray feathers is mated with a hen of the same phenotype. Among their offspring, 15 chicks are gray, 6 are black, and 8 are white. What is the simplest explanation for the inheritance

More information

Step 4: All of the offspring will be rw. So the genotypic ratio is: 4 : 0 : 0 rw ww rr

Step 4: All of the offspring will be rw. So the genotypic ratio is: 4 : 0 : 0 rw ww rr Part 7: Incomplete Dominance or Codominance In Four o clock flowers the alleles for flower color are both equal therefore neither dominates over the other. We call this condition incomplete dominance or

More information

January 30, Genetics.notebook

January 30, Genetics.notebook 1). Make a list of all the genetic traits you can think of. What makes you different from everyone else? How did you get the traits you have? Why do some children look totally different from both of their

More information

Exceptions to Mendel. Beyond Mendel. Beyond Mendel

Exceptions to Mendel. Beyond Mendel. Beyond Mendel Exceptions to Mendel Complex Patterns of Inheritance Think about this You are walking around outside and you notice a bush with two distinctly colored flowers: red and white. However, you notice a pink

More information

Mendelian Genetics 1

Mendelian Genetics 1 Mendelian Genetics 1 Genetic Terminology Trait - any characteristic that can be passed from parent to offspring Heredity - passing of traits from parent to offspring Genetics - study of heredity 2 Gregor

More information

Problem 1. What is the simplest explanation for the inheritance of these colors in chickens?

Problem 1. What is the simplest explanation for the inheritance of these colors in chickens? Problem 1 A rooster with gray feathers is mated with a hen of the same phenotype. Among their offspring, 15 chicks are gray, 6 are black, and 8 are white. What is the simplest explanation for the inheritance

More information

GENETICS PRACTICE 1: BASIC MENDELIAN GENETICS

GENETICS PRACTICE 1: BASIC MENDELIAN GENETICS Period Date GENETICS PRACTICE 1: BASIC MENDELIAN GENETICS Solve these genetics problems. Be sure to complete the Punnett square to show how you derived your solution. 1. In humans the allele for albinism

More information

Science 10-Biology Activity 17 Worksheet on More Complex Genetics

Science 10-Biology Activity 17 Worksheet on More Complex Genetics Science 10-Biology Activity 17 Worksheet on More Complex Genetics 10 Name Due Date Show Me Hand In Correct and Hand In Again By NOTE: This worksheet is based on material from pages 398-404 in Science Probe.

More information

Understanding Heredity one example

Understanding Heredity one example 204 Understanding Heredity one example We ve learned that DNA affects how our bodies work, and we have learned how DNA is passed from generation to generation. Now we ll see how small DNA differences,

More information

We are learning to analyze data to solve basic genetic problems

We are learning to analyze data to solve basic genetic problems Gene 3 We are learning to analyze data to solve basic genetic problems Success Criteria: I can - use Punnett squares to solve basic genetic problems involving monohybrid crosses, incomplete dominance,

More information

Furry Family Genetics

Furry Family Genetics Furry Family Genetics Name: Period: Directions: Log on to http://vital.cs.ohiou.edu/steamwebsite/downloads/furryfamily.swf and complete your Furry Family. In the tables provided, list the genotypes and

More information

Incomplete Dominance, Co-Dominance, and Sex-linked dominance NON-MENDELIAN GENETICS

Incomplete Dominance, Co-Dominance, and Sex-linked dominance NON-MENDELIAN GENETICS Incomplete Dominance, Co-Dominance, and Sex-linked dominance NON-MENDELIAN GENETICS INCOMPLETE DOMINANCE INCOMPLETE DOMINANCE Two alleles dominant and recessive Genotypes are the same as simple Mendelian

More information

If you take the time to follow the directions below, you will be able to solve most genetics problems.

If you take the time to follow the directions below, you will be able to solve most genetics problems. Genetics Worksheet Part 1 Introduction: 1. Describe the genotypes given (use your notes). The first two are already done. A. DD homozygous, dominant D. ss B. Dd _heterozygous E. Yy C. dd F. WW 2. In humans,

More information

Non-Mendelian Genetics

Non-Mendelian Genetics Non-Mendelian Genetics Jan 3 rd Non-Mendelian Genetics Incomplete Dominance Codominance Practice handout Jan 4 th Multiple Alleles Polygenic Traits Sex-Linked Traits Jan 5 th Quiz Chromosome structure,

More information

Genetics and Probability

Genetics and Probability Genetics and Probability Genetics and Probability The likelihood that a particular event will occur is called probability. The principles of probability can be used to predict the outcomes of genetic crosses.

More information

1. For each genotype, indicate whether it is heterozygous (HE) or homozygous (HO) Ii Jj kk Ll

1. For each genotype, indicate whether it is heterozygous (HE) or homozygous (HO) Ii Jj kk Ll Simple Genetics Practice Problems 1. For each genotype, indicate whether it is heterozygous (HE) or homozygous (HO) AA Bb Cc Dd Ee ff GG HH Ii Jj kk Ll Mm nn OO Pp 2. For each of the genotypes below, determine

More information

Slide 1 / 43. Mendelian Genetics. Slide 2 / Where do you get your traits from? Slide 3 / True or False: Only animal cells contain DNA.

Slide 1 / 43. Mendelian Genetics. Slide 2 / Where do you get your traits from? Slide 3 / True or False: Only animal cells contain DNA. Slide 1 / 43 Mendelian Genetics 1 Where do you get your traits from? Slide 2 / 43 2 True or False: Slide 3 / 43 Only animal cells contain DNA. 3 What is the difference between the products in mitosis and

More information

Complex Patterns of Inheritance Puzzle Stations Station #1: Multiple alleles, blood types

Complex Patterns of Inheritance Puzzle Stations Station #1: Multiple alleles, blood types Station #1: Multiple alleles, blood types (Remember, the possible multiple alleles for blood are written as I A, I B, i, with types A and B being codominant, and O being recessive.) 1. A man with blood

More information

Lesson Overview. Human Chromosomes. Lesson Overview Human Chromosomes

Lesson Overview. Human Chromosomes. Lesson Overview Human Chromosomes Lesson Overview 14.1 Karyotypes To find what makes us uniquely human, we have to explore the human genome. A genome is the full set of genetic information that an organism carries in its DNA. A study of

More information

Genetics Review Name: Block:

Genetics Review Name: Block: Genetics Review Name: Block: Part 1: One Trait Crosses 1. Describe the genotypes below using vocabulary terms given in class. a. DD: b. Dd: c. dd: 2. In humans, brown eye color (B) is dominant over blue

More information

The Dihybrid Problem Solve

The Dihybrid Problem Solve DIHYBRID CROSSES (MENDELIAN) Amoeba Sisters Video Recap: Dihybrid Crosses (Mendelian Inheritance) Vocabulary practice! You probably have had enough of cats with our video. On to peas! In pea plants, yellow

More information

a. Which members of the family above are afflicted with Huntington s disease?

a. Which members of the family above are afflicted with Huntington s disease? GROUP A 1. a. Which members of the family above are afflicted with Huntington s disease? b. There are no carriers (heterozygotes) for Huntington s Disease you either have it or you don t. with this in

More information

HEREDITARY STUDENT PACKET # 5

HEREDITARY STUDENT PACKET # 5 HEREDITARY STUDENT PACKET # 5 Name: Date: Big Idea 16: Heredity and Reproduction Benchmark: SC.7.L.16.1: Understand and explain that every organism requires a set of instructions that specifies its traits,

More information

UNIT 6 Genes and Inheritance sciencepeek.com

UNIT 6 Genes and Inheritance sciencepeek.com Part 1 - Inheritance of Genes Name Date Period 1. Fill in the charts below on the inheritance of genes. 2. In a diploid cell, there are copies of each chromosome present. 3. Each human diploid cell has

More information

AYCI: Do NOT use your notes. This fish picture is an example of codominance. IN YOUR OWN WORDS, write an explanation of codominance based on what you

AYCI: Do NOT use your notes. This fish picture is an example of codominance. IN YOUR OWN WORDS, write an explanation of codominance based on what you AYCI: Do NOT use your notes. This fish picture is an example of codominance. IN YOUR OWN WORDS, write an explanation of codominance based on what you have learned so far. RR x WW are parents. Based on

More information

Genetics Worksheet # 1 Answers name:

Genetics Worksheet # 1 Answers name: Genetics Worksheet # 1 Answers name: Blood type inheritance is somewhat complicated, with three forms of the gene and 4 possible phenotypes. Refer to class notes for more information. 1. Suppose that a

More information

Practice Study Guide Genetics:

Practice Study Guide Genetics: Name: Period: Date: Practice Study Guide Genetics: Solve the following questions: Problem 1: a. What is the most likely mode of inheritance for this pedigree? Why? Problem 2: Assume that the individual

More information

3) DEFINITIONS: multiple alleles: polygenic traits: codominance: incomplete dominance: gene: allele: homozygous: heterozygous: autosomal: sex-linked:

3) DEFINITIONS: multiple alleles: polygenic traits: codominance: incomplete dominance: gene: allele: homozygous: heterozygous: autosomal: sex-linked: WLHS / Biology / Unit 6 Genetics / Monson Name Date Per 1) Compare the processes of MITOSIS and MEIOSIS: How many daughter cells are produced? If the parent cell has 22 chromosomes, how many chromosomes

More information

Understanding how our genes are passed down And how to calculate the probabilities of our traits.

Understanding how our genes are passed down And how to calculate the probabilities of our traits. Calculating the probability of our genetics Understanding how our genes are passed down And how to calculate the probabilities of our traits. Leading questions: 1. What do Punnett Squares mean? 2. How

More information

Notes 8.3: Types of Inheritance. How do living organisms pass traits from one generation to the next? Pages 184, 237,

Notes 8.3: Types of Inheritance. How do living organisms pass traits from one generation to the next? Pages 184, 237, Notes 8.3: Types of Inheritance How do living organisms pass traits from one generation to the next? Pages 184, 237, 242-244 Think about it You have a purple flower, you know purple is the dominate allele,

More information

Student Exploration: Mouse Genetics (One Trait)

Student Exploration: Mouse Genetics (One Trait) Name: Date: Student Exploration: Mouse Genetics (One Trait) Vocabulary: allele, DNA, dominant allele, gene, genotype, heredity, heterozygous, homozygous, hybrid, inheritance, phenotype, Punnett square,

More information

Genes and Alleles Genes - Genes PIECE CHROMOSOME CODE TRAIT HAIR COLOUR LEFT HANDEDNESS CHARACTERISTIC GENE

Genes and Alleles Genes - Genes PIECE CHROMOSOME CODE TRAIT HAIR COLOUR LEFT HANDEDNESS CHARACTERISTIC GENE Genes and Alleles S1-1-14 Explain the inheritance of sex-linked traits in humans and use a pedigree to track the inheritance of a single trait. Examples: colour blindness, hemophilia Genes - Genes are

More information

Name: Period: Student Exploration: Mouse Genetics (One Trait)

Name: Period: Student Exploration: Mouse Genetics (One Trait) Directions: 1) Go to Explorelearning.com; 2) Login using your assigned user name and password. USER NAME: 1C772 PASSWORD: RAIN515 3) Find the MOUSE GENETICS ONE TRAIT Gizmo and click Launch Gizmo Name:

More information

Genetics Extra Practice Show all work!

Genetics Extra Practice Show all work! Name: # Date: Per: Genetics Extra Practice Show all work! Monohybrids 1. A cross between two pea plants hybird for a single trait produces 60 offspring. Approximately how many of the offspring would be

More information

Unit 3: DNA and Genetics Module 8: Genetics

Unit 3: DNA and Genetics Module 8: Genetics Unit 3: DNA and Genetics Module 8: Genetics NC Essential Standard: 3.2.2 Predict offspring ratios based on a variety of inheritance patterns 3.2.3 Explain how the environment can influence expression of

More information

Eastern Regional High School

Eastern Regional High School Eastern Regional High School Honors iology Name: Period: Date: Unit 13 Non-Mendelian Genetics Review Packet 1. The phenotypes for 4 o clock flowers are white, red, and pink. Cross a purebred red flower

More information

Understanding Heredity one example

Understanding Heredity one example 208 Understanding Heredity one example We ve learned that DNA affects how our bodies work, and we have learned how DNA is passed from generation to generation. Now we ll see how small DNA differences,

More information

Sample Size Adapted from Schmidt, et al Life All Around Us.

Sample Size Adapted from Schmidt, et al Life All Around Us. Lab 9, Biol-1, C. Briggs, revised Spring 2018 Sample Size Adapted from Schmidt, et al. 2006. Life All Around Us. Name: Lab day of week: Objectives Observe the benefits of large sample sizes. Instructions

More information

Topic: Traits, Genes, & Alleles. Essential Question: How are an organism s traits connected to its genes?

Topic: Traits, Genes, & Alleles. Essential Question: How are an organism s traits connected to its genes? Topic: Traits, Genes, & Alleles Essential Question: How are an organism s traits connected to its genes? The problem with the gene pool is that there is no lifeguard. - Steven Wright 2/16/16 Genetics Mendel

More information

Determining the Inheritance Patterns of Purple Eye, Lobe Eye, and Yellow Body Traits of. Drosophilia Flies. Introduction

Determining the Inheritance Patterns of Purple Eye, Lobe Eye, and Yellow Body Traits of. Drosophilia Flies. Introduction Karen Jacques and Audrey Puleio Mrs. Lajoie Honors Biology April 30, 2012 Determining the Inheritance Patterns of Purple Eye, Lobe Eye, and Yellow Body Traits of Drosophilia Flies Introduction This experiment

More information

Karyotypes Pedigrees Sex-Linked Traits Genetic Disorders

Karyotypes Pedigrees Sex-Linked Traits Genetic Disorders Karyotypes Pedigrees Sex-Linked Traits Genetic Disorders Consists of 23 pairs of chromosomes. Images are taken from diploid cells during mitosis. Chromosomes 1 through 22 are called autosomes. The X and

More information

Punnett Square Review

Punnett Square Review Punnett Square Review Complete each of the following problems to practice the 4 different types of crosses 1. In peas, yellow color (G) is dominant to green (g). What are the possible genotypes and phenotypes

More information

Text Reference, Campbell v.8, chapter 14 MENDELIAN GENETICS SINGLE TRAIT CROSS LAW OF SEGREGATION:

Text Reference, Campbell v.8, chapter 14 MENDELIAN GENETICS SINGLE TRAIT CROSS LAW OF SEGREGATION: AP BIOLOGY Text Reference, Campbell v.8, chapter 14 ACTIVITY 1.20 NAME DATE HOUR MENDELIAN GENETICS SINGLE TRAIT CROSS LAW OF SEGREGATION: TWO TRAIT CROSS LAW OF INDEPENDENT ASSORTMENT LAWS OF PROBABILITY

More information

MULTIPLE CHOICE QUESTIONS

MULTIPLE CHOICE QUESTIONS MULTIPLE CHOICE QUESTIONS 1. Mendel verified true-breeding pea plants for certain traits before undertaking his experiments. The term true-breeding refers to: A. genetically pure lines. B. organisms that

More information

Other Patterns of Inheritance:

Other Patterns of Inheritance: Biology Ms. Ye Name Date Block Other Patterns of Inheritance: Incomplete Dominance o One allele is not completely dominant over the other, resulting in a o Incomplete dominance is not support for the blending

More information