Coinfection with Clostridium piliforme and Felid herpesvirus 1 in a kitten
|
|
- Easter Lambert
- 6 years ago
- Views:
Transcription
1 593600VDIXXX / FHV-1 and Tyzzer s disease in a kittenneto et al. research-article2015 Brief Communication Coinfection with Clostridium piliforme and Felid herpesvirus 1 in a kitten Journal of Veterinary Diagnostic Investigation 2015, Vol. 27(4) The Author(s) Reprints and permissions: sagepub.com/journalspermissions.nav DOI: / jvdi.sagepub.com Rachel T. Neto, Francisco A. Uzal, Emir Hodzic, Michele Persiani, Shazia Jolissaint, Ana Alcaraz, Francisco R. Carvallo 1 Abstract. A 1-month-old Domestic Shorthair kitten was submitted for autopsy, with a history of upper respiratory tract infection and diarrhea. This was the third kitten from the same litter that had died with similar clinical findings within a period of 1 month. Severe conjunctivitis, rhinitis, tracheitis, and bronchointerstitial pneumonia were present, together with lymphohistiocytic colitis. Respiratory lesions were caused by infection with Felid herpesvirus 1. Colonic lesions were associated with the presence of long filamentous bacteria, identified as Clostridium piliforme, in the cytoplasm of epithelial cells. Our report describes a case of concurrent C. piliforme infection (Tyzzer s disease) and feline rhinotracheitis in a kitten. Key words: Colitis; feline; rhinotracheitis; Tyzzer s disease. Tyzzer s disease is caused by Clostridium piliforme, a long, filamentous, flagellated, spore-forming, Gram-negative, and obligate intracellular rod-shaped bacterium. 3,14 Tyzzer s disease has been described in mice, rats, rabbits, dogs, cats, cattle, pigs, monkeys, rarely in birds, and sporadically in wild species. 9,14 C. piliforme has been detected in a Human immunodeficiency virus 1 positive human patient. 13 The pathogenesis of Tyzzer s disease includes ingestion of spores and/or vegetative forms of C. piliforme, followed by replication in the ileo-ceco-colic area. 9,18 In animals with a permissive immune system, the organisms are absorbed and may then travel to the liver and occasionally the systemic circulation, reaching the heart. 11 The typical triad of lesions includes hepatitis, enterocolitis, and myocarditis, although hepatic lesions are seen much more frequently than those in the gastrointestinal tract or the heart. Frequently, the disease results in sudden death, although nonspecific clinical signs such as depression, ruffled hair coat, and diarrhea can be observed before death; the severity of these clinical signs can be highly variable among individuals. 4 Although the incubation period in spontaneous infections is unknown, the disease has an extremely acute clinical course in all animal species. Species Felid herpesvirus 1 (FHV-1; order Herpesvirales, family Herpesviridae, subfamily Alphaherpesvirinae, genus Varicellovirus) is a DNA virus responsible for feline rhinotracheitis, a very prevalent disease in kittens from shelters. 1,15 FHV-1 replicates in the upper respiratory tract epithelium, resulting in necrosis and inflammation because of its cytolytic activity. The acute form of feline rhinotracheitis has an incubation period of 2 6 days. Major clinical signs include sneezing, coughing, oculo-nasal discharge, ulcers on corneal and conjunctival epithelium, weight loss, and fever. In extreme and sporadic cases in kittens up to 4 weeks of age, fatal bronchopneumonia may occur. 6,7 Viruses of the Alphaherpesvirinae subfamily remain latent in nervous and lymphoid tissues. FHV-1 is commonly latent in the trigeminal ganglion, and its reactivation in adult cats results mainly from stress, with consequent virus shedding within 4 11 days. 7 Tyzzer s disease and feline rhinotracheitis have been described separately in cats. However, coinfection by these 2 diseases has not been reported to our knowledge. A 1-month-old, female, nursing Domestic Shorthair kitten was submitted for autopsy to the California Animal Health and Food Safety (CAHFS) Laboratory, University of California Davis, San Bernardino branch. The kitten belonged to a shelter and had exhibited dyspnea and marked purulent nasal discharge, diarrhea, and dehydration for ~2 weeks before death, despite treatment with parenteral cefovecin sodium and penicillin, gentamicin eye drops, intravenous Lactated Ringer solution, and kitten milk replacement supplementation via tube feeding. This was the third kitten from the same litter of 3 animals that had died with similar clinical findings within a period of 1 month. The shelter housed 75 cats. Thirty of the kittens became ill (morbidity 40%) over the same Veterinary Pathology Laboratory, Veterinary Medicine and Agronomy College, University of Brasilia, Brasilia, Federal District, Brazil (Neto); California Animal Health and Food Safety Laboratory System, San Bernardino, CA (Uzal, Carvallo); Veterinary Medicine Teaching Hospital, School of Veterinary Medicine, University of California Davis, Davis, CA (Hodzic); Electron Microscopy section, California Animal Health and Food Safety Laboratory System, Davis, CA (Persiani); and College of Veterinary Medicine, Western University of Health Sciences, Pomona, CA (Jolissaint, Alcaraz). 1 Corresponding Author: Francisco R. Carvallo, California Animal Health and Food Safety Laboratory, San Bernardino Branch, 105 W. Central Avenue, San Bernardino, CA fcarvallo@ucdavis.edu
2 548 Neto et al. period. Twelve of the affected kittens died (mortality 16%). The adult cats present in the shelter, including the dam of the kitten described herein, were clinically healthy. Serological tests for Feline leukemia virus (FeLV) and Feline immunodeficiency virus (FIV) were negative for all cats in the shelter. A routine autopsy was performed, and representative samples of the conjunctivas, trachea, lungs, heart, liver, spleen, kidneys, pancreas, small and large intestine, and brain were collected and fixed in 10% neutral buffered formalin; 4-µm thick, hematoxylin and eosin (H&E) sections were prepared. Selected sections were also stained with Gram, Giemsa, and Steiner stains. Immunohistochemistry (IHC) for feline panleukopenia virus (FPV) on jejunum, FeLV on jejunum and colon, and FHV-1 on trachea was performed following standard operating procedures of the Veterinary Teaching Hospital of the School of Veterinary Medicine, University of California Davis. Briefly, antigen retrieval was performed with target retrieval solution a for FeLV in a steamer for 20 min at 95 C, and proteinase K b for 7 min for FPV and FHV-1 samples. The following primary mouse antibodies were applied to tissue sections: anti FHV-1 (dilution 1:400), c anti-felv (dilution 1:300), d and anti-fpv (dilution 1:500). e Goat anti-mouse immunoglobulins conjugated to peroxidase-labeled dextran polymer f were used as a secondary reagent. All reactions were visualized with NovaRed for peroxidase. g Sections were counterstained with Mayer hematoxylin and coverslipped. Negative mouse serum was used instead of the primary antibodies mentioned above in negative control sections. Positive controls included bone marrow, lymph node, and liver from a FeLV-positive cat, small intestine from a kitten with FPV infection, and nasal epithelium of a cat with FHV-1 infection. Fresh tissue samples of lung and trachea were submitted to polymerase chain reaction (PCR) analysis for FHV-1, Feline calicivirus, Bordetella bronchiseptica, Chlamydophila felis, and Mycoplasma felis. For extraction of total nucleic acid, an automated system h was used according to the manufacturer s instructions. For each target gene, 2 primers and an internal, fluorescent-labeled probe were designed using commercial software, i or locked nucleic acid probes were used. Real-time PCR assays targeted the following genes: 1) conserved region of the glycoprotein B (gb) gene of FHV-1 (GenBank accession S ), forward primer 5 -AGAGGCTAACGGAC CATCGA, reverse primer 5 -GCCCGTGGTGGCTCTA AAC, and probe 5-6FAM-TATATGTGTCCAC CACCTTCAGGATCTACTGTCGT; 2) ORF1 gene (genome polyprotein) of Feline calicivirus (GenBank accession AY560117); 3) Bordetella bronchiseptica adhesin ( fhab) gene (GenBank accession BX640446); 4) major outer membrane protein A (ompa) of Chlamydophila felis (GenBank accession AB468956); and 5) 16S rrna gene of Mycoplasma felis (GenBank accession AY274253). For electron microscopy, a small section of the colon was fixed in 10% neutral buffered formalin from which smaller Figure 1. Lung. Alveolar septa are thickened with numerous mononuclear cells. Syncytial cells were present occasionally in alveoli, and contained eosinophilic intranuclear inclusion bodies (arrows). Hematoxylin and eosin subsamples were obtained and transferred into modified Karnovsky fixative (1% paraformaldehyde j and 2% glutaraldehyde k ) overnight and processed for transmission electron microscopy per the CAHFS Laboratory standard operating procedure. A transmission electron microscope l was used at 80 kv accelerating voltage for observation. Images were captured with a side-mounted digital camera m using imaging software. n At autopsy, the carcass was in poor nutritional condition, with no fat reserves and generalized muscle atrophy. The conjunctivas were reddened and covered by large amounts of yellow, fibrinopurulent exudate. The nasal cavity and trachea contained fibrinopurulent exudate, most of adhered loosely to the mucosa, and the lungs were multifocally reddened and firm. The colon was slightly dilated with green, soft contents. Histologic examination revealed fibrinonecrotizing conjunctivitis, rhinitis, tracheitis, bronchitis, and bronchointerstitial pneumonia, with occasional intranuclear eosinophilic inclusion bodies. In particular, pulmonary lesions were characterized by alveolar wall necrosis, with intraluminal necrotic and desquamated cells, a moderate exudate composed of neutrophils and macrophages, and epithelial syncytial cell formation, with numerous intranuclear eosinophilic inclusion bodies within bronchiolar epithelium and syncytial cells (Fig. 1). Inclusion bodies occupied most of the nuclei and displaced the chromatin to the periphery. Histopathological changes outside the respiratory tract included severe colonic lesions, characterized by expansion of the lamina propria and separation of the crypts by a moderate inflammatory infiltrate, composed of macrophages, lymphocytes, and fewer plasma cells. Numerous crypts were dilated and lined with a low cuboidal to markedly attenuated epithelium, and contained necrotic cell debris and viable and degenerate neutrophils (Fig. 2). Many surface and crypt enterocytes, and goblet cells, contained intracytoplasmic bundles of slender, long
3 FHV-1 and Tyzzer s disease in a kitten 549 Figure 2. Colon. The lamina propria is markedly expanded by macrophages, lymphocytes, and fewer plasma cells. Abundant necrotic debris is present in crypts. Hematoxylin and eosin (HE) Inset: in some epithelial cells, faintly staining elongated bacteria are identified (arrow). HE Figure 4. Trachea. Necrotic tracheal epithelial cells have strong cytoplasmic immunopositivity against Felid herpesvirus 1 (FHV-1). Mouse anti FHV-1 (1:400) immunohistochemistry, Mayer hematoxylin counterstain Figure 3. Colon. Numerous argyrophilic, elongated bacteria are present in the cytoplasm of epithelial cells and in the lumen of crypts. Steiner stain rods ~15 20 µm long and 1 µm wide, arranged in a crisscross pattern (Fig. 2, inset). These rods were Gram-negative but stained strongly with Steiner (Fig. 3) and slightly with Giemsa stains. In the submucosa, there was a mild diffuse inflammatory infiltrate composed of lymphocytes, plasma cells, and macrophages. No lesions were identified in the other organs examined. Immunohistochemistry for FHV-1 was strongly positive within the cytoplasm of several epithelial cells of bronchi, bronchioles, conjunctiva, and trachea (Fig. 4), and of lung syncytial cells. All other IHC tests were negative. Samples of trachea and lung were positive for FHV-1 by PCR, and negative for all of the other agents included in the PCR panel. Figure 5. Colon. A crypt enterocyte contains numerous transverse, longitudinal, and oblique sections of both vegetative (arrows) and spore (arrowheads) bacterial forms. Uranyl acetate and lead citrate staining. 7,750. Transmission electron microscopy of the colon revealed numerous transverse, longitudinal, and oblique sections of both vegetative bacterial forms and spores in the cytoplasm of enterocytes (Fig. 5). Cross-sections of vegetative forms measured µm in diameter, with cell walls ~25 nm thick. Spore forms ranged in diameter from 0.6 to 1.4 µm and contained spore coats that were nm thick. The vegetative forms had numerous peritrichous flagella that measured nm in diameter (Fig. 6).
4 550 Neto et al. Figure 6. Colon. Cytoplasm of a crypt enterocyte. Bacterial vegetative forms measure nm and have numerous peritrichous flagella ~10 15 nm in diameter (arrows), characteristic of Clostridium piliforme. Uranyl acetate and lead citrate staining. 60,000. A diagnosis of concurrent Tyzzer s disease and feline viral rhinotracheitis was established in our case based on gross and microscopic changes, IHC, molecular test results, and ultrastructural features. Additional support for this diagnosis came from ruling out other common respiratory and digestive feline pathogens. Clostridium piliforme is well known as a cause of severe, fatal enteric, hepatic, and/or cardiac disease in several animal species. Young animals are the most susceptible, and predisposing factors include stressful situations, such as overcrowding, transportation, and poor sanitation. 4 Viral infections can also trigger enough immunosuppression to alter host susceptibility. 12 Despite extensive studies in animal models, little is known about the pathogenesis and immune response in Tyzzer s disease. The virulence factors of C. piliforme have not been fully characterized although virulence is thought to be related to toxins. Different C. piliforme isolates seem to vary in their degree of cytotoxicity, suggesting that different C. piliforme strains may cause different clinical forms of the disease. The host immune system plays a role in an individual s susceptibility and disease severity. Interleukin-12 is expressed after C. piliforme inoculation in mice, but its level is substantially higher in resistant murine strain C57BL/6 compared to the susceptible strain DBA/2. 16 This suggests an important role of natural killer (NK) cells and Th1 response during infection and mediation of an immune response. The ingestion of sporulated forms of C. piliforme is crucial for development of the disease, the source of which is usually feces of wild rodents or rabbits. No lesions caused by C. piliforme were seen outside the alimentary tract in the kitten presented in our report, which may be related to low bacterial strain virulence. Our case is similar to 2 previously described cases of Tyzzer s disease in kittens, one of which was concurrent with feline panleukopenia, in which no hepatic or cardiac lesions were observed. 5,9 The stress factors intrinsic to a shelter environment may be sufficient to trigger physiological stress and consequent immunosuppression. 1 Immunity in neonatal or very young animals is very dependent on passive transfer of maternal antibodies. Exposure to pathogens during this vulnerable period may result in infections with life-threatening outcomes. We hypothesize that environmental factors led to stress-induced immunosuppression in this kitten and most likely also in its littermates. The immunosuppression must have been serious enough to allow concurrent viral and bacterial infection and severe clinical manifestations that led to death. 12,15 The histopathological presentation of FHV-1 infection in our case supports this hypothesis, given that bronchointerstitial pneumonia and syncytial cell formation are not commonly seen in classic feline rhinotracheitis. The abundant intraepithelial, intranuclear inclusion bodies also indicate an acute disease that developed concurrently with C. piliforme colonization and intestinal damage. It is also possible that FHV-1 infection acted as a stressor for these animals, making them more susceptible to other pathogens, including C. piliforme. The diagnosis of C. piliforme can be challenging and depends on recognition of clusters of intracellular bacilli in tissue sections using appropriate staining methods, such as Giemsa and Steiner. 4,10 Serology using whole bacterial lysates as antigens, and isolation by inoculation of embryonated hen egg or cell cultures, have been reported. 10 Additional testing used to diagnose this disease are IHC and PCR. 3,8,10 PCR can be done from organs and feces and is mainly based on the 16S rrna gene sequence of C. piliforme. 2,8 Electron microscopy is another useful ancillary technique that allows identification of vegetative forms, spores, and flagella of specific shape and size, all of which were recognized in the tissues examined in our study. 5,9 Such ultrastructural features are highly compatible with a diagnosis of C. piliforme infection. 4,9 Tyzzer s disease should be included in the differential diagnosis of feline enterocolitis, 17 especially when present in young domestic cats from shelters and/or subject to stressful factors, such as overcrowding, transportation, or virus-induced stress or immunosuppression. Acknowledgments We acknowledge Mrs. ME Uzal for the English review of this manuscript. Authors contributions RT Neto, FA Uzal, and FR Carvallo contributed to conception and design of the study. E Hodzic and M Persiani contributed to
5 FHV-1 and Tyzzer s disease in a kitten 551 conception of the study. S Jolissaint and A Alcaraz contributed to design of the study. FR Carvallo contributed to acquisition of data. All authors contributed to analysis and interpretation of data; drafted the manuscript; critically revised the manuscript; gave final approval; and agree to be accountable for all aspects of the work in ensuring that questions relating to the accuracy or integrity of any part of the work are appropriately investigated and resolved. Sources and manufacturers a. Target retrieval solution (ph 9), Dako Denmark A/S, Glostrup, Denmark. b. Proteinase K, Dako North America Inc., Carpinteria, CA. c. Clone 7-7 (FHV 7-7), Custom Monoclonal International, West Sacramento, CA. d. Clone p27 (PF12J-10A), Custom Monoclonal International, West Sacramento, CA. e. CPV1-2A1, Custom Monoclonal International, West Sacramento, CA. f. Envision+ system-hrp mouse K4001, Dako North America Inc., Carpinteria, CA. g. SK-4800, Vector Laboratories Inc., Burlingame, CA. h. CAS-1820 X-tractor Gene, Qiagen GmbH, Hilden, Germany. i. Applied Biosystems Primer Express software, Life Technologies, Grand Island, NY. j. Product no , Ted Pella Inc., Redding, CA. k. Product no , Ted Pella Inc., Redding, CA. l. Zeiss LEO 906E, Carl Zeiss MicroImaging GmbH, Göttingen, Germany. m. DVC-2000, Thorlabs Inc., Newton, NJ. n. AMT Imaging software, Advanced Microscopy Techniques Corp., Woburn, MA. Declaration of conflicting interests The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article. Funding The author(s) received no financial support for the research, authorship, and/or publication of this article. References 1. Bannasch MJ, Foley JE. Epidemiologic evaluation of multiple respiratory pathogens in cats in animal shelters. J Feline Med Surg 2005;7: Feldman SH, et al. Ribosomal RNA sequences of Clostridium piliforme isolated from rodent and rabbit: re-examining the phylogeny of Tyzzer s disease agent and development of a diagnostic polymerase chain reaction assay. J Am Assoc Lab Anim Sci 2006;45: Furukawa T, et al. Detection by PCR of the Tyzzer s disease organism (Clostridium piliforme) in feces. Exp Anim 2002;51: Ganaway JR, et al. Tyzzer s disease. Am J Pathol 1971;64: Ikegami T, et al. Enterocolitis associated with dual infection by Clostridium piliforme and feline panleukopenia virus in three kittens. Vet Pathol 1999;36: López A. Respiratory system, mediastinum, and pleurae. In: Zachary JF, McGavin D, eds. Pathologic Basis of Veterinary Disease. 5th ed. St. Louis, MO: Elsevier, 2012: Maes R. Felid herpesvirus type 1 infection in cats: a natural host model for alphaherpesvirus pathogenesis. ISRN Vet Sci 2012; Niepceron A, Licois D. Development of a high-sensitivity nested PCR assay for the detection of Clostridium piliforme in clinical samples. Vet J 2010;185: Nimmo Wilkie JS, Barker IK. Colitis due to Bacillus piliformis in two kittens. Vet Pathol 1985;22: Percy DH, Barthold SW. Mouse. In: Percy DH, Barthold SW, eds. Pathology of Laboratory Rodents and Rabbits. 3rd ed. Ames, IA: Blackwell, 2007: Poonacha KB. Naturally occurring Tyzzer s disease in a serval (Felis capensis). J Vet Diagn Invest 1997;9: Rouse BT, Horohov DW. Immunosuppression in viral infections. Rev Infect Dis 1986;8: Smith KJ, et al. Bacillus piliformis infection (Tyzzer s disease) in a patient infected with HIV-1: confirmation with 16S ribosomal RNA sequence analysis. J Am Acad Dermatol 1996;34: Swerczek TW. Tyzzer s disease in foals: retrospective studies from 1969 to Can Vet J 2013;54: Tanaka A, et al. Associations among weight loss, stress, and upper respiratory tract infection in shelter cats. J Am Vet Med Assoc 2012;240: Van Andel RA, et al. Interleukin-12 has a role in mediating resistance of murine strains to Tyzzer s disease. Infect Immun 1998;66: Van Kruiningen HJ, et al. The classification of feline colitis. J Comp Pathol 1983;93: Young JK, et al. Naturally occurring Tyzzer s disease in a puppy. Vet Pathol 1995;32:63 65.
4-year-old neutered male American domestic shorthair cat with a locally extensive area of swelling ulceration and crusting over the nasal planum.
4-year-old neutered male American domestic shorthair cat with a locally extensive area of swelling ulceration and crusting over the nasal planum. Which of the following is the most likely disease? 1. Squamous
More informationVaccines for Cats. 2. Feline viral rhinotracheitis, FVR caused by FVR virus, also known as herpes virus type 1, FHV-1
Vaccines for Cats Recent advances in veterinary medical science have resulted in an increase in the number and type of vaccines that are available for use in cats, and improvements are continuously being
More informationCanine Distemper Virus
Photo: LE Carmichael, MJ Appel Photo: LE Carmichael, MJ Appel Photo: LE Carmichael, MJ Appel Canine Distemper Virus Canine Distemper (CD) is a highly contagious infectious disease of dogs worldwide caused
More informationFeline Vaccines: Benefits and Risks
Feline Vaccines: Benefits and Risks Deciding which vaccines your cat should receive requires that you have a complete understanding of the benefits and risks of the procedure. For this reason, it is extremely
More informationCanine and Feline Distemper. Description. The following chart indicates the animals which are susceptible to infection by canine and feline distemp
Canine and Feline Distemper Description Canine and feline distemper are diseases affecting many wild and domestic carnivo The following chart indicates the animals which are susceptible to infection by
More informationEnteric Clostridia 10/27/2011. C. perfringens: general. C. perfringens: Types & toxins. C. perfringens: Types & toxins
C. perfringens: general Enteric Clostridia Formerly called C. welchii Thick rods, forming spores Non motile Grow fast Habitats: Soil and sewage and in the intestines of animals and humans Double zone hemolysis
More informationEnteric Clostridia. C. perfringens: general
Enteric Clostridia C. perfringens: general Formerly called C. welchii Thick rods, forming spores Non motile Grow fast Habitats: Soil and sewage and in the intestines of animals and humans Toxins More than
More informationPanleuk Basics Understanding, preventing, and managing feline parvovirus infections in animal shelters
Panleuk Basics Understanding, preventing, and managing feline parvovirus infections in animal shelters Your Presenter Stephanie Janeczko, DVM, MS, DABVP, CAWA Senior Director of Shelter Medical Programs
More informationHistologic and Molecular Correlation in Shelter Cats with Acute Upper Respiratory Infection
JOURNAL OF CLINICAL MICROBIOLOGY, July 2011, p. 2454 2460 Vol. 49, No. 7 0095-1137/11/$12.00 doi:10.1128/jcm.00187-11 Copyright 2011, American Society for Microbiology. All Rights Reserved. Histologic
More informationHISTOPATHOLOGY. Introduction:
Introduction: HISTOPATHOLOGY Goats and sheep are the major domestic animal species in India. Much of the economy of the country has been depend upon the domestication of these animals. Especially economy
More informationHow to stop the snotty noses: Preventing feline upper respiratory infections. Staci Cannon, DVM, MPH, DACVPM, DABVP (Shelter Medicine Practice)
How to stop the snotty noses: Preventing feline upper respiratory infections Staci Cannon, DVM, MPH, DACVPM, DABVP (Shelter Medicine Practice) Why is URI so hard to control? Multiple pathogens Chronic
More informationVACCINATION GUIDELINES
WHY VACCINATE? VACCINATION GUIDELINES Vaccines help prepare the body's immune system to fight the invasion of disease-causing organisms. Vaccines contain antigens, which look like the disease-causing organism
More informationUpdate on diagnosis of feline infectious peritonitis (FIP)
Update on diagnosis of feline infectious peritonitis (FIP) Séverine Tasker RCVS Specialist in Feline Medicine The Feline Centre Langford Veterinary Services University of Bristol http://www.felinecentre.co.uk/
More informationTYZZER'S DISEASE AS A COMPLICATION OF CANINE DISTEMPER IN A RACCOON
TYZZER'S DISEASE AS A COMPLICATION OF CANINE DISTEMPER IN A RACCOON Authors: Zbigniew W. Wojcinski, and Ian K. Barker Source: Journal of Wildlife Diseases, 22(1) : 55-59 Published By: Wildlife Disease
More informationProceeding of the SEVC Southern European Veterinary Conference
www.ivis.org Proceeding of the SEVC Southern European Veterinary Conference Oct. 17-19, 2008 Barcelona, Spain http://www.sevc.info Reprinted in the IVIS website with the permission of the SEVC www.ivis.org
More informationBOVINE RESPIRATORY DISEASE COMPLEX. Kristen Mierzwiak LCS 630
BOVINE RESPIRATORY DISEASE COMPLEX Kristen Mierzwiak LCS 630 Ring... You are called out to the farm of one of your regular dairy clients because some of the replacement heifers they bought at a public
More informationFeline Respiratory Infections in Animal Shelters
Maddie s Shelter Medicine Program 2015 SW 16 th Avenue College of Veterinary Medicine PO Box 100126 Gainesville, FL 32610 352-273-8660 352-392-6125 Fax Overview Feline Respiratory Infections in Animal
More informationFELINE INFECTIOUS PERITONITIS Visions Beyond the Tip of the Iceberg!
FELINE INFECTIOUS PERITONITIS Visions Beyond the Tip of the Iceberg! Richard B. Ford, DVM, MS, Dipl. ACVIM Professor of Medicine North Carolina State University Richard_Ford@ncsu.edu As long as we've known
More informationPathomorphological and Molecular Studies on an Outbreak of Feline Parvo Viral Infection in a Colony of Cats
International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 7 Number 06 (2018) Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2018.706.214
More informationAbove: life cycle of toxoplasma gondii. Below: transmission of this infection.
Toxoplasmosis PDF This article is based on a paid for research paper dated 1972 of similar title and authored by J.K.Frenkel and J.P. Dubey. It was published by The Journal of Infectious Diseases Vol.
More informationAntibody Test Kit for Feline Calici, Herpes and Panleukopenia Viruses (2011)
Sensitivity-specificity and accuracy of the ImmunoComb Feline VacciCheck Antibody Test Kit for Feline Calici, Herpes and Panleukopenia Viruses (2011) Mazar S 1, DiGangi B 2, Levy J 2 and Dubovi E 3 1 Biogal,
More informationParvovirus Type 2c An Emerging Pathogen in Dogs. Sanjay Kapil, DVM, MS, PhD Professor Center for Veterinary Health Sciences OADDL Stillwater, OK
Parvovirus Type 2c An Emerging Pathogen in Dogs Sanjay Kapil, DVM, MS, PhD Professor Center for Veterinary Health Sciences OADDL Stillwater, OK Properties of Canine Parvovirus Single-stranded DNA virus
More informationFELINE VIRAL UPPER RESPIRATORY DISEASE Why it Persists!
FELINE VIRAL UPPER RESPIRATORY DISEASE Why it Persists! Richard B. Ford, DVM, MS Diplomate ACVIM and ACVPM (Hon) North Carolina State University There is little argument among veterinarians that feline
More informationFeline zoonoses. Institutional Animal Care and Use Committee 12/09
Feline zoonoses Institutional Animal Care and Use Committee 12/09 Cat scratch disease Bacterial infection caused by Bartonella henselae Associated with a cat bite or scratch Infection at point of injury,
More informationHurricane Animal Hospital 2120 Mount Vernon Road Hurricane, WV or
Hurricane Animal Hospital 2120 Mount Vernon Road Hurricane, WV 25526 304-757-5937 or 304-757-2287 www.hurricaneanimalhospital.com Feline Leukemia Virus (FELV) This information handout is designed as a
More informationFungal Disease. What is a fungus?
Fungal Disease What is a fungus? A fungus is a living organism. It goes through a complicated life cycle and is able to spread in the environment by producing large numbers of spores that are easily dispersed
More informationNursing the feline patient with upper respiratory tract disease
Vet Times The website for the veterinary profession https://www.vettimes.co.uk Nursing the feline patient with upper respiratory tract disease Author : Sam Frogley Categories : RVNs Date : April 1, 2011
More informationOverview. There are commonly found arrangements of bacteria based on their division. Spheres, Rods, Spirals
Bacteria Overview Bacteria live almost everywhere. Most are microscopic ranging from 0.5 5 m in size, and unicellular. They have a variety of shapes when viewed under a microscope, most commonly: Spheres,
More informationA Lymphosarcoma in an Atlantic Salmon (Salmo salar)
A Lymphosarcoma in an Atlantic Salmon (Salmo salar) Authors: Paul R. Bowser, Marilyn J. Wolfe, and Timothy Wallbridge Source: Journal of Wildlife Diseases, 23(4) : 698-701 Published By: Wildlife Disease
More informationClinical Manifestations and Treatment of Plague Dr. Jacky Chan. Associate Consultant Infectious Disease Centre, PMH
Clinical Manifestations and Treatment of Plague Dr. Jacky Chan Associate Consultant Infectious Disease Centre, PMH Update of plague outbreak situation in Madagascar A large outbreak since 1 Aug 2017 As
More informationIndex. Note: Page numbers of article titles are in boldface type.
Index Note: Page numbers of article titles are in boldface type. A Abdominal viscera, examination of, in investigation of emerging infectious diseases of food animals, 6 American Veterinary Medical Association,
More informationInduction of Immunity to Feline Caliciviral Disease
INFECTION AND IMMUNITY, May 1975, p. 1003-1009 Copyright 0 1975 American Society for Microbiology Vol. 11. No. 5 Printed in U.S.A. Induction of Immunity to Feline Caliciviral Disease DONALD E. KAHN,* EDWARD
More informationKITTEN & ADULT HEALTH PROGRAM AND VACCINATION SCHEDULE
OTTERKILL ANIMAL HOSPITAL 258 Maybrook Rd. Campbell Hall, NY 10916 Phone: (845)427-2854 Fax: (845)427-2344 www.otterkill.com KITTEN & ADULT HEALTH PROGRAM AND VACCINATION SCHEDULE Congratulations on the
More informationCase Report A Case of Enzootic Nasal Adenocarcinoma in a Ewe
Case Reports in Veterinary Medicine Volume 2012, Article ID 347193, 4 pages doi:10.1155/2012/347193 Case Report A Case of Enzootic Nasal Adenocarcinoma in a Ewe DevorahMarksStowe,KevinL.Anderson,JamesS.Guy,
More informationINFECTIOUS HEPATITIS, PARVOVIRUS & DISTEMPER
Canine VacciCheck INFECTIOUS HEPATITIS, PARVOVIRUS & DISTEMPER IgG ANTIBODY TEST KIT INSTRUCTION MANUAL Sufficient for 12/120 assays 13 JUL 2015 Biogal Galed Laboratories Acs. Ltd., tel: 972-4-9898605.
More informationINFECTIOUS DISEASES IN COMPANION ANIMALS ONLINE TRAINING PLATFORM
INFECTIOUS DISEASES IN COMPANION ANIMALS User name Password Log in User name Log out MY PAGE USER GUIDE WELCOME TO THE INFECTIOUS DISEASES IN COMPANION ANIMALS Main infectious diseases in dogs and cats
More informationRapid Diagnostic Test for pet
In vitro Diagnostic Rapid Diagnostic Test for pet Canine / Feline Rapid Test offers highly sensitive and specificity for the detection of antigen and antibody from various kinds of easily obtainable specimen.
More informationVETERINARY BACTERIOLOGY FROM THE DARK AGES TO THE PRESENT DAY
VETERINARY BACTERIOLOGY FROM THE DARK AGES TO THE PRESENT DAY D.J.TAYLOR MA PhD VetMB DipECPHM DipECVPH MRCVS EMERITUS PROFESSOR OF VETERINARY BACTERIOLOGY AND PUBLIC HEALTH UNIVERSITY OF GLASGOW INTRODUCTION
More informationDomestic Turkey Diseases
Domestic Turkey Diseases Mohammad Soltani Board Certified in Poultry Diseases, Faculty of Veterinary Medicine, University of Tehran. Classification Managemental and Nutritional Infectious Parasitic Metabolic
More informationAcute Hemorrhagic Diarrhea Syndrome (AHDS) A Cause of Bloody Feces in Dogs
Acute Hemorrhagic Diarrhea Syndrome (AHDS) A Cause of Bloody Feces in Dogs No dog parent wants to clean up diarrhea. Cleaning up bloody diarrhea is even more unpleasant. Unfortunately, the development
More informationProviding links to additional websites for more information:
Over Vaccinating you pets can kill them! There is much information available online concerning new guidelines for vaccinating your pets and we highly encourage you to do some additional research on this
More informationCanine Anaplasmosis Anaplasma phagocytophilum Anaplasma platys
Canine Anaplasmosis Anaplasma phagocytophilum Anaplasma platys It takes just hours for an infected tick to transmit Anaplasma organisms to a dog. What is canine anaplasmosis? Canine anaplasmosis is a disease
More informationEquine Diseases. Dr. Kashif Ishaq. Disease Management
Equine Diseases Dr. Kashif Ishaq Disease Management Prevention is the singularly most important aspect Vaccinate regularly Keep horse areas cleaned up and sanitized Proper feeds and feeding management
More informationFELINE URI: STATE OF THE ART PREVENTION AND TREATMENT
FELINE URI: STATE OF THE ART PREVENTION AND TREATMENT ELIZABETH BERLINER, DVM DABVP (SHELTER MEDICINE, CANINE/FELINE PRACTICE) JANET L. SWANSON DIRECTOR OF SHELTER MEDICINE MADDIE S SHELTER MEDICINE PROGRAM
More informationMedical Bacteriology- Lecture 14. Gram negative coccobacilli. Zoonosis. Brucella. Yersinia. Francesiella
Medical Bacteriology- Lecture 14 Gram negative coccobacilli Zoonosis Brucella Yersinia Francesiella 1 Zoonosis: A disease, primarily of animals, which is transmitted to humans as a result of direct or
More informationFeedlot AIP: What the Heck Causes It?
Feedlot AIP: What the Heck Causes It? Amelia Woolums, DVM MVSc PhD DACVIM DACVM Department of Pathobiology and Population Medicine Mississippi State University amelia.woolums@msstate.edu Acknowledgements
More informationAuthor - Dr. Josie Traub-Dargatz
Author - Dr. Josie Traub-Dargatz Dr. Josie Traub-Dargatz is a professor of equine medicine at Colorado State University (CSU) College of Veterinary Medicine and Biomedical Sciences. She began her veterinary
More informationField necropsy techniques in mammal and poultry
Field necropsy techniques in mammal and poultry Kidsadagon Pringproa, DVM, MS, PhD Department of Veterinary Biosciences and Veterinary Public Health Faculty of Veterinary Medicine Chiang Mai University
More informationWhat s Your Diagnosis? By Sohaila Jafarian, Class of 2018
Signalment: Greeley, 3 yo MC DSH Presenting Complaint: ADR History: What s Your Diagnosis? By Sohaila Jafarian, Class of 2018 Patient is an indoor/outdoor cat. Previously healthy and up to date on vaccines
More informationEnzootic abortion in sheep and its economic consequences
Vet Times The website for the veterinary profession https://www.vettimes.co.uk Enzootic abortion in sheep and its economic consequences Author : Louise Silk Categories : Farm animal, Vets Date : February
More informationBright Eyes & Bushy Tails
Bright Eyes & Bushy Tails Housecall and Full-Service Veterinary Clinic 3005 Highway 1 NE Iowa City, IA 52240 (319) 351-4256 December 1, 2000 Quarterly Newsletter Jennifer Berger, DVM Allan Berger DVM,
More informationPORCINE CIRCOVIRUS - 2 AN EMERGING DISEASE OF CROSSBRED PIGS IN TAMIL NADU, INDIA
International Journal of Science, Environment and Technology, Vol. 3, No 3, 2014, 1268 1272 ISSN 2278-3687 (O) PORCINE CIRCOVIRUS - 2 AN EMERGING DISEASE OF CROSSBRED PIGS IN TAMIL NADU, INDIA S. Krishna
More informationBiological Threat Fact Sheets
Biological Threat Fact Sheets Anthrax Agent: Bacillus anthracis There are three clinical forms of B. anthracis which are determined by route of entry: Pulmonary or Inhalation BT implications Cutaneous
More informationWINN FELINE FOUNDATION For the Health and Well-being of All Cats
Ending FIP, Is There Hope? A Summary of Dr. Niels Pedersen s Presentation at the Winn Feline Foundation Symposium Chicago July 29 th, 2017 Carol Johnson DVM, Ph.D and Heather Lorimer Ph.D. Additional information
More informationVeterinary Diagnostics Portfolio Overview. Complete solutions for veterinary testing and pathogen research
Veterinary Diagnostics Portfolio Overview Complete solutions for veterinary testing and pathogen research Sample preparation products Cat. no. (number of preps) Target analyte Product Short description
More informationElectron Microscopic Observations on Ciliated Epithelium of Tracheal Organ Cultures Infected with Bordetella bronchiseptica
Microbiol. Immunol. Vol. 33 (2), 111-121, 1989 Electron Microscopic Observations on Ciliated Epithelium of Tracheal Organ Cultures Infected with Bordetella bronchiseptica Kachiko SEKIYA,*,1 Yutaka FUTAESAKU,2
More informationInternational Journal of Science, Environment and Technology, Vol. 5, No 5, 2016,
International Journal of Science, Environment and Technology, Vol. 5, No 5, 2016, 3249 3253 ISSN 2278-3687 (O) 2277-663X (P) HISTOPATHOLOGICAL STUDY OF PULMONARY ANTHRACOSIS IN SHEEP Amaravathi M* 1, Satheesh
More informationFOSTERING CATS. Behavioral Issues
FOSTERING CATS Fostering an adult cat may not require as much time and attention as kittens, but it is equally rewarding! The following information will help you familiarize yourself with some of the common
More information////////////////////////////////////////// Shelter Medicine
////////////////////////////////////////// Shelter Medicine To Test or Not to Test Confronting feline leukemia and feline immunodeficiency virus By Lila Miller, D.V.M. Just because a cat tests positive
More informationEvaluating the Role of MRSA Nasal Swabs
Evaluating the Role of MRSA Nasal Swabs Josh Arnold, PharmD PGY1 Pharmacy Resident Pharmacy Grand Rounds February 28, 2017 2016 MFMER slide-1 Objectives Identify the pathophysiology of MRSA nasal colonization
More informationASVCP quality assurance guidelines: veterinary immunocytochemistry (ICC)
ASVCP quality assurance guidelines: veterinary immunocytochemistry (ICC) Version 1.0 (Approved 11/2017) Developed by the American Society for Veterinary Clinical Pathology (ASVCP) Quality Assurance and
More informationTreatment of Respiratory Tract Infections Prof. Mohammad Alhumayyd Dr. Aliah Alshanwani
Treatment of Respiratory Tract Infections Prof. Mohammad Alhumayyd Dr. Aliah Alshanwani 30-1-2018 1 Objectives of the lecture At the end of lecture, the students should be able to understand the following:
More informationCourse Curriculum for Master Degree in Poultry Diseases/Veterinary Medicine
Course Curriculum for Master Degree in Poultry Diseases/Veterinary Medicine The Master Degree in Poultry Diseases /Veterinary Medicine, is awarded by the Faculty of Graduate Studies at Jordan University
More informationBacterial Pneumonia in Sheep, The Domestic Bighorn Sheep Interface, and Research at ADRU
Bacterial Pneumonia in Sheep, The Domestic Bighorn Sheep Interface, and Research at ADRU USAHA Committee on Sheep and Goats Providence, RI October 27, 2015 PLC M. A. Highland, DVM, DACVP, PhD candidate
More informationVaccination FAQs. Strategies for vaccination in a rescue (multiple cat) environment will be different from those of the privately owned cat.
Vaccination FAQs Some general information about vaccination is included below. The sections in italics relate specifically to Cats Protection (CP)'s current preferred vaccine product. To find which vaccine
More informationMalignant Catarrhal Fever in a Red Angus Cow B Y : L A U R E N R I C E R O V C
Malignant Catarrhal Fever in a Red Angus Cow B Y : L A U R E N R I C E R O V C 2 0 1 5 History & Signalment Three year old Red Angus Cow Complaint: Blindness From 15 Red Angus Cow Herd Managed on Pasture
More informationFeline and Canine Internal Parasites
Feline and Canine Internal Parasites Internal parasites are a very common problem among dogs. Almost all puppies are already infected with roundworm when still in the uterus, or get the infection immediately
More informationOutbreaks of bovine herpesvirus 2 infections in calves causing ear and facial skin lesions
704480VDIXXX10.1177/1040638717704480Watanabe et al.bohv-2 infection causing facial and ear crusts and alopecia research-article2017 Brief Communication Outbreaks of bovine herpesvirus 2 infections in calves
More informationCanine Distemper Virus
Canine Distemper Virus Sandra Newbury, DVM National Shelter Medicine Extension Veterinarian Koret Shelter Medicine Program Center for Companion Animal Health U C Davis School of Veterinary Medicine www.sheltermedicine.com
More informationPLASMODIUM MODULE 39.1 INTRODUCTION OBJECTIVES 39.2 MALARIAL PARASITE. Notes
Plasmodium MODULE 39 PLASMODIUM 39.1 INTRODUCTION Malaria is characterized by intermittent fever associated with chills and rigors in the patient. There may be enlargement of the liver and spleen in the
More informationCONTAGIOUS BOVINE PLEURO- PNEUMONIA steps towards control of the disease. Rose Matua -Department of Veterinary Services, Kenya
CONTAGIOUS BOVINE PLEURO- PNEUMONIA steps towards control of the disease Rose Matua -Department of Veterinary Services, Kenya Introduction CBPP is a highly contagious acute, subacute or chronic disease
More informationProceedings of the Southern European Veterinary Conference and Congreso Nacional de AVEPA
www.ivis.org Proceedings of the Southern European Veterinary Conference and Congreso Nacional de AVEPA Oct. 18-21, 2012 - Barcelona, Spain Next Conference: Oct. 17-19, 2013 - Barcelona, Spain Reprinted
More informationZOONOTIC ALERT What is zoonosis and why should you care? FECAL TESTING = INTESTINAL PARASITE SCREEN
ZOONOTIC ALERT What is zoonosis and why should you care? Zoonosis refers to a parasite, bacteria, or virus (such as rabies), that can be passed directly from animals to humans. Members of your family can
More informationAttorneys for Plaintiffs Hells Canyon Preservation Council and The Wilderness Society UNITED STATES DISTRICT COURT FOR THE DISTRICT OF IDAHO
Lauren M. Rule (ISB # 6863 ADVOCATES FOR THE WEST PO Box 1612 Boise ID 83701 (208 342-7024 lrule@advocateswest.org Attorney for Plaintiff Western Watersheds Project Jennifer R. Schemm (OSB #97008 602 O
More informationWhy Do Animals Need Foster Care? There are several reasons an animal might become part of our foster program. Some of them are:
Fostering with P.A.W.S. Fostering is essential to our success here at P.A.W.S. Foster parents provide temporary care for kittens, puppies, cats and dogs in an environment that is less stressful for the
More informationGeneral Health Care & Diseases
General Health Care & Diseases 4-H Cats Unit 2: Chapter 6 I. Daily Health Check Health care for your cat begins with daily attention. Why daily grooming is important: Keeps coat shiny & tangle free Gets
More informationDiagnosis, treatment and control: dealing with coccidiosis in cattle
Vet Times The website for the veterinary profession https://www.vettimes.co.uk Diagnosis, treatment and control: dealing with coccidiosis in cattle Author : Adam Martin Categories : Vets Date : January
More informationA Simply Smart Choice for Point-of-Care Testing
A Simply Smart Choice for Point-of-Care Testing The entire WITNESS line of canine and feline diagnostics tests are accurate, affordable, and easy to use WITNESS HEARTWORM WITNESS LH WITNESS RELAXIN Canine
More informationWhat is a disease. Any condition that results in deviation from normal function
What is a disease Any condition that results in deviation from normal function How do diseases occur? AGENT HOST ENVIRONMENT ETIOLOGY Infectious Agents Bacteria Viruses Parasites Fungi Non-infectious agents
More informationManagement of infectious diseases in shelters
Management of infectious diseases in shelters The following recommendations concentrate on infectious diseases in rescue shelters (places where cats are kept temporarily to facilitate finding their legal
More informationHydatid Cyst Dr. Nora L. El-Tantawy
Hydatid Cyst Dr. Nora L. El-Tantawy Ass. Prof. of Parasitology Faculty of Medicine, Mansoura university, Egypt Echinococcus granulosus Geographical Distribution: cosmopolitan especially in sheep raising
More informationCanine and Feline Parvovirus in Animal Shelters
Maddie s Shelter Medicine Program 2015 SW 16 th Avenue College of Veterinary Medicine PO Box 100126 Gainesville, FL 32610 352-273-8660 352-392-6125 Fax Overview Canine and Feline Parvovirus in Animal Shelters
More informationNDSU Veterinary Diagnostic Laboratory
NDSU Veterinary Diagnostic Laboratory February 2015, Vol. 2, No. 1 In This Issue Welcome Flat-rate, One-day Shipping for $7 Pooled Tritrichomonas Testing Now Available Bacteriology Changes for 2015 Noteworthy
More informationSystemic Apicomplexans. Toxoplasma
Systemic Apicomplexans Toxoplasma Protozoan Groups Historically, protozoa have been grouped by mode of motility. Flagellates Hemoflagellates Trypanosoma cruzi Leishmania infantum Mucoflagellates Tritrichomonas
More informationPrescribing Guidelines for Outpatient Antimicrobials in Otherwise Healthy Children
Prescribing Guidelines for Outpatient Antimicrobials in Otherwise Healthy Children Prescribing Antimicrobials for Common Illnesses When treating common illnesses such as ear infections and strep throat,
More informationPCR detection of Leptospira in. stray cat and
PCR detection of Leptospira in 1 Department of Pathology, School of Veterinary Medicine, Islamic Azad University, Shahrekord Branch, Shahrekord, Iran 2 Department of Microbiology, School of Veterinary
More informationIntroduction. Rabbit Respiratory Disease. Lecture Outline. Pre-consult. Initial presentation. History 26/01/2013
Introduction Rabbit Respiratory Disease Joanna Hedley BVM&S DZooMed (Reptilian) MRCVS Rabbit, Exotic Animal and Wildlife Clinician at R(D)SVS Obligate nasal breathers Small thorax Tendency to mask symptoms
More informationCare and Handling of Pets
Communicable Disease Outreach Program 3020 Rucker Avenue, Suite 300 Everett, WA 98201-3900 425.339.5278 Care and Handling of Pets Name of facility: WIWS Pet restrictions 1. Pets will be inaccessible to
More informationBeef... Beef Natural Contamination... Beef liver...
Human... Human Natural Contamination... Human amniotic fluid... Human bile... Human blood... Human brain... Human breast... Human breast milk... Human cervix... Human colon... Human endometrium... Human
More informationCourse Curriculum for Master Degree in Internal Medicine/ Faculty of Veterinary Medicine
Course Curriculum for Master Degree in Internal Medicine/ Faculty of Veterinary Medicine The Master Degree in Internal Medicine/Faculty of Veterinary Medicine is awarded by the Faculty of Graduate Studies
More informationHimani B. Pandya, Ph.D (medical microbiology) Tutor, S.B.K.S Medical College and Research Institute Gujarat, INDIA
Prevalence and Microbiological diagnosis of Helicobacter pylori infection and it s antibiotic resistance pattern in the patients suffering from Acid-peptic Diseases Himani B. Pandya, Ph.D (medical microbiology)
More informationCopyright is owned by the Author of the thesis. Permission is given for a copy to be downloaded by an individual for the purpose of research and
Copyright is owned by the Author of the thesis. Permission is given for a copy to be downloaded by an individual for the purpose of research and private study only. The thesis may not be reproduced elsewhere
More informationIp - Infectious & Parasitic Diseases
Ip - Infectious & Parasitic Diseases USE OF SEROLOGY FOR THE PREDICTION OF CANINE AND FELI- NE CORE VACCINE NEEDS Michael R. Lappin, DVM, PhD, DACVIM Professor Department of Clinical Sciences Colorado
More informationAustralian and New Zealand College of Veterinary Scientists. Membership Examination. Small Animal Medicine Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2015 Small Animal Medicine Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer
More informationSerological Prevalence of FeLV and FIV in Cats in Peninsular Malaysia
6 th Proceedings of the Seminar on Veterinary Sciences, 11 14 January 2011: 78-82 Serological Prevalence of FeLV and FIV in Cats in Peninsular Malaysia Nurul Ashikin Sapian, 1 Siti Suri Arshad, 2 Gurmeet
More informationDOG AND CAT VACCINE ANTIGEN SELECTION GUIDELINES
DOG AND CAT VACCINE ANTIGEN SELECTION GUIDELINES (approved by the CVMA Board of Directors January 18, 2004) The Colorado Veterinary Medical Association (CVMA) recognizes that each animal s adult basic
More informationFeline Upper Respiratory Infection: Diagnosis & Treatment. Chumkee Aziz, DVM Resident, UC-Davis
Feline Upper Respiratory Infection: Diagnosis & Treatment Chumkee Aziz, DVM Resident, UC-Davis Etiology What causes it? Pathogens: Feline herpes virus type 1 (FHV-1) Feline calicivirus (FCV) Chlamydia
More informationDomestic Bighorn Sheep Interface Problem Overview and Research. American Sheep Industry Annual Convention Reno, NV January 27-31, 2015
Domestic Bighorn Sheep Interface Problem Overview and Research American Sheep Industry Annual Convention Reno, NV January 27-31, 2015 Maggie Highland, DVM, PhDc, Dipl. ACVP PhD Veterinary Training Program
More informationProtozoan Parasites: Lecture 20 - Heteroxenous Coccidia - Part 1 Pages 39-51
Protozoan Parasites: Lecture 20 - Heteroxenous Coccidia - Part 1 Pages 39-51 Tissue cyst -forming Coccidia General Taxonomy Apicomplexa Heteroxenous Two host life cycles Asexual & sexual reproduction Intestinal
More informationANNEX I SUMMARY OF PRODUCT CHARACTERISTICS
ANNEX I SUMMARY OF PRODUCT CHARACTERISTICS 1 1. NAME OF THE VETERINARY MEDICINAL PRODUCT Purevax RCPCh lyophilisate and solvent for suspension for injection 2. QUALITATIVE AND QUANTITATIVE COMPOSITION
More information