of Entomology, University of California, Riverside, Riverside, CA 92521, USA of Hertfordshire, Hertfortshire AL109AB, United Kingdom
|
|
- Madeleine Jacobs
- 5 years ago
- Views:
Transcription
1 Parasitol Res () (Suppl ):S S DOI./s--- Ectopar asites Susceptibility of Adult Cat Fleas (Siphoaptera: Pulicidae) to Isecticides ad Status of Isecticide Resistace Mutatios at the Rdl ad Kockdow Resistace Loci Michael K. Rust (*), Richard Vetter, Ia Deholm, Byro Blagbur, Marti S. Williamso, Steve Kopp, Gle Colema, Joe Hostetler, Wedell Davis, Norbert Mecke, Robert Rees9, Sabria Foit, Claudia Böhm ad Kathri Tetzer Departmet of Etomology, Uiversity of Califoria, Riverside, Riverside, CA 9, USA of Hertfordshire, Hertfortshire AL9AB, Uited Kigdom Aubur Uiversity, Aubur, AL 9, USA Rothamsted Research, Harpede, ALJQ, Uited Kigdom School of Veteriary Medicie, Uiversity of Queeslad, Gatto, QLD, Australia Bayer Health Care, Aimal Health, Shawee Missio, KS, USA Bayer Aimal Health GmbH, Leverkuse, Germay 9 Bayer Health Care, Pymble, NSW, Australia Uiversity Correspodig author: Michael K. Rust * michael.rust@ucr.edu Abstract The susceptibility of field-collected isolates ad laboratory strais of fleas, Cteocephalides felis was determied by topical appliio of some of the isecticides used as o-aimal therapies to cotrol them. I the tested field-collected flea isolates the LD values for fiproil ad imidacloprid raged from.9 to. g/flea ad. to.9 g/ flea, respectively, ad were cosistet with baselie figures published previously. The extet of variatio i respose to four pyrethroid isecticides differed betwee compouds with the LD values for deltamethri ragig from. to. g/ flea, etofeprox ragig from. to. g/flea, permethri ragig from. to. g/flea, ad d-pheothri ragig from. to g/flea. A compariso with earlier data for permethri ad deltamethri implied a level of pyrethroid resistace i all isolates ad strais. LD values for tetrachlorviphos raged from. to. g/flea. The rdl mutatio (coferrig target-site resistace S
2 Ectopar asites to cyclodiee isecticides) was preset i most field-collected ad laboratory strais, but had o discerible effect o resposes to fiproil, which acts o the same receptor protei as cyclodiees. The kdr ad skdr mutatios coferrig target-site resistace to pyrethroids but segregated i oppositio to oe aother, precludig the formatio of geotypes homozygous for both mutatios. Itroductio The developmet of resistace by pest orgaisms poses a costat threat to the performace of oaimal applied isecticides registered as veteriary medicial products. Moitorig for chages i respose requires access to sesitive bioassays appropriate to the chemicals ad species uder cosideratio. For example, to provide scietifically soud data o resposes of the flea (Cteocephalides felis) to the isecticide imidacloprid, a larval bioassay was developed ad evaluated, ad field-collected isolates from three cotiets have bee tested sice (Blagbur et al. ; Rust et al.,, ). Over the last years, there have bee a umber of reports of isecticide resistace i the C. felis. Bossard et al. (99) provided a extesive review of resistace studies with adult fleas, most studies reportig o oly a sigle flea isolate ad some studies lackig comparisos with susceptible referece strais. May studies utilized a brief cotact exposure test o filter paper followig the recommeded WHO method (WHO 9), but subsequet studies icluded substrates such as ylo carpet ad glass for the bioassays (Bossard et al. ). However, the activity of the isecticide varied greatly depedig o the method used to test for resistace. A larval bioassay with imidacloprid ad fiproil has provided cosistet results (Rust et al., ), ad topical appliio of isecticides o the cuticle of adult fleas, which eables the testig of idividual fleas, has also provided S reliable levels of sesitivity (Moyses 99). Topical appliio bioassays of isecticides to idividuals of a sigle flea strai were reported by Moyses ad Gfellar (). The objective of this study was to re-examie the susceptibility of field-collected isolates of fleas to some of the isecticides ow commoly beig used to cotrol them o pets usig a topical appliio bioassay. We compare our results with those previously reported ad discuss the possible future impliios for cotrol. We also report o the occurrece of mutatios kow to cofer target-site resistace to cyclodiee ad pyrethroid isecticides. Materials ad Methods Origi of Field Isolates ad Laboratory Strais The field-derived isolates used for this study were collected betwee ad by veteriary cliics throughout Australia, Europe, ad the Uited States (Table ). Cats or dogs were placed i cages for a period of to h to obtai flea eggs. A sheet of paper was placed beeath the floor walks i each cage. At the ed of the collectio period, the aimals were brushed or combed getly to remove hair coat debris, icludig ay remaiig flea eggs. Flea eggs ad hair coat debris were the passed through a sieve ad fuel ad collected i a glass tube. The glass tube was packaged i a Styrofoam cooler cotaiig several layers of isulatio, moisteed gauze pads, ad ice packs to promote safe shipmet. A questioaire was provided to all participatig cliics; iformatio requested icluded household ad pet iformatio, such as the umber pets o the premises, use of evirometal ad o-aimal flea cotrol products, level of flea ifestatio, ad whether fleas were a recurrig or first-time problem (Blagbur et al. ). The flea eggs were shipped overight from the cliics to laboratories i Australia, Germay ad the USA, ad placed i rearig medium the followig
3 Ectopar asites Table Iformatio regardig the field-collected isolates ad the laboratory strais tested Locality Collectio date a Cat or dog Aubur Soquel, CA 9 () Ukow KS Mahatta, KS 99 () Ukow Moheim Haover, Germay 99 () Ukow Strai/isolate Previous Treatmets Palo Alto, CA 9 Ukow FI Brisbae, Australia 9 dog Ukow FI New Orleas, LA // dog Frotlie Plus FI Queeslad, Australia // dog several ukow Frotlie Combo, Frotlie Plus Jefferso City, MO // FI Birmigham, AL // Capstar Charlesto, SC //9 dog Frotlie Jacksoville, FL // Ukow FI Rochester, NY //9 oe Aubur, AL dog uspecified fiproil FI Jacksoville, FL //9 Advatage Multi FI Mout Dora, FL //9 dog Advatage FI Housto, TX /9/9 oe a Date i paretheses is the date whe the lab strai was received at. day. Isolates ot iitially established at Uiversity of Califoria Riverside () were subsequetly trasferred to where the bioassays reported here were coducted. Sice there has ever bee a uiversally-adopted susceptible strai of C. felis used for isecticide testig, the study also icluded four strais that have bee used as log-stadig referece strais i differet laboratories (Table ). The Aubur strai was origially collected i 9 ad established at i. The KS (Kasas ) strai was started from fleas collected from s ad dogs at a aimal shelter i Mahatta, Kasas i 99 ad was trasferred to i. The Moheim strai as origially obtaied from the veteriary school i Haover, Germay i 99. It was subsequetly maitaied by Bayer Aimal Health at Moheim ad was set to i. The strai was origially obtaied from Staford Research Istitute i Palo Alto, Califoria i 9. Noe of these four strais had bee exposed to isecticides durig their history of laboratory culture. Maiteace of Flea Isolates Laboratory isolates of fleas were maitaied o idividual s accordig to a procedure modified from Metzger ad Rust (99). The s were housed i double cages stacked o top of oe aother to help prevet cross cotamiatio of the isolates. Three differet rooms were used whe possible, to maitai the s ad isolates. Cats with differet isolates were ot exercised together. The s were maitaied uder a protocol approved by the UC Riverside Istitutioal Aimal Care ad Use Committee. Flea eggs were collected from trays udereath the s, supportig each field-collected or laboratory isolate. The eggs ad debris were passed through a series of four sieves (,,, ad mesh) with the eggs beig retaied o the mesh scree. The eggs were placed o a larval flea rearig medium ( part utritive medium [. dried beef blood (America s Laboratories, # NK SD Hemoglobi Powder, Omaha, NE] to. groud dog chow by weight to. iactive baker s yeast [Red Star Bio Products -Nuttrex, Milwaukee, WI] to S9
4 Ectopar asites three parts mesh silica sad by volume) ad held at % RH ad ± C. Larvae completed developmet withi d ad the cocoos ad larval medium were passed through a mesh sieve to separate cocoos. Adults emerged about to d after egg collectio. To maitai the isolates o each, about male ad female adult fleas were placed o each every wks. Typically, to geeratios of rearig were required before sufficiet umbers of adult fleas were preset for testig. Topical appliio bioassays Topical appliios of acetoe solutios of the followig techical grade isecticides were applied to adult fleas: deltamethri (9. %, AccuStadard New Have, CT), d-pheothri (9. %, MGK Co., Mieapolis, MN), etofeprox (9. %, Pestaal Sigma-Aldrich, St. Louis, MO), fiproil (9. %, Pestaal D-9 Seelze), imidacloprid (9. % Bayer Aimal Health GmbH, Moheim, Germay), permethri (9. % MGK Co., Mieapolis, MN) ad tetrachlorviphos (99. % Chem Service, West Chester, PA). Droplets (. μl) were deposited o the cuticle of adult fleas usig a gauge eedle o a glass tuberculi syrige (Becto, Dickiso ad Co., Rutherford, NJ). The tip of the eedle was removed so that the opeig was level istead of tapered as is commo with hypodermic eedles. This allowed solvet to bead up at the ed of the syrige. Precise appliio was made with a Isco Model M Microapplior (Istrumetatio Specialties, Seward, NE). Acetoe aloe was used as a cotrol treatmet. Adult fleas were tested whe they were to d from the egg collectio date. They were poured ito test tubes (9 mm x mm diam.), about to fleas per test tube by ivertig the rearig jar ad pourig them dow the glass fuel, ad the placed i a refrigerator at C. Fleas were immobile after mi whe the first test tube was removed ad fleas poured ito a plastic Petri dish ( mm diam x mm depth) sittig o a chill plate (#9, S Bioquip, Racho Domiguez, CA) ad covered with the plastic Petri dish lid. Coverig the Petri dishes was importat because despite the chillig, some fleas retaied eough mobility to kick ad propel themselves out of the Petri dish. The chillig table was maitaied at aroud -. C. Test tubes were removed from the refrigerator as eeded. We detected o detrimetal effect of additioal refrigeratio o survival of the later-dosed fleas. A small droplet of test solutio was iitially forced out of the syrige to esure flow; despite the small aperture of the syrige opeig, some evaporatio occurred iside the eedle shaft betwee trials. After the test droplet was forced out ad wiped off with a Kimwipe tissue, a secod droplet was forced out. A immobilized flea was removed from the Petri dish with fie forceps ad the flea brought to the tip of the syrige. The flea was the placed i a clea test tube. Te fleas were dosed ad placed per test tube after which a strip of filter paper (Whatma #, approximately mm wide by 9 mm log, tapered at oe ed) was placed iside the test tube, tapered ed dow, to give the treated fleas a vertical substrate oto which they could crawl. The test tube was the covered with a small square of parafilm to cofie the fleas. The test tubes ad fleas were placed iside a evirometal chamber held at C ad % RH. Fleas were checked h later for survival. A flea was recorded as affected if it was either immobile at the bottom of the vial or if it could ot right itself ad crawl upward o the piece of filter paper. A series of doses was admiistered from lowest to highest cocetratio with a correspodig cotrol batch before ad after each isecticide series. All test solutios were made up fresh from a stock solutio about h before use. The stock solutios were refrigerated for storage ad allowed to reach room temperature prior to the makig of ew solutios. Bioassays were doe i three simultaeous trials such that the cotrol treatmets were applied first to three batches of fleas, followed by icreasig order of cocetratio. After applyig the highest
5 Ectopar asites dose, the syrige (glass pluger, glass body, metal eedle) was dismatled ad thoroughly cleaed with acetoe ad allowed to soak to mi i acetoe to remove isecticide. After this soakig, the syrige was reassembled, rised a few more times ad the three more batches of fleas were dosed with acetoe aloe. Typically, these later-dosed cotrols showed o discerible icrease i mortality such that the fial cleaig process was deemed successful i removig remat isecticide. However, imidacloprid proved to adhere more teaciously to the syrige tha the other compouds, leadig to higher mortality i the later cotrol cohorts. Cosequetly, after the highest dose of imidacloprid, the syrige received several additioal active risig ad was soaked i the acetoe approximately mi. This was sufficiet to reduce the later cotrol mortality to ormal levels (i.e., to %). I additio, to further decrease potetial cotamiatio, oe syrige was specifically dedied to use oly with imidacloprid. TaqMa PCR assays The TaqMa assay is a PCR method that uses short oligoucleotide probes that are dual labelled with a fluorescet reporter dye at the ed ad a quecher molecule at the ed. Amplifiio of the probe-specific product durig PCR causes cleavage of the probe, geeratig a icrease i reporter fluorescece as the reporter dye is released away from the quecher. By usig differet reporter dyes (ormally VIC ad -FAM), cleavage of two allelespecific probes ca be detected i a sigle PCR. Three separate assays were desiged that would eable geotypig for the previously reported resistace mutatios, rdl (Bass et al. a), kdr ad super-kdr (skdr, Bass et al. b). For geotype testig, DNA was extracted from adult fleas usig DNAzol reaget (Life Techologies). Idividual fleas were placed i.ml microtubes, sap-froze i liquid itroge ad groud to a powder usig tight-fittig plastic pestles (Burkard Scietific Ltd). DNAzol reaget (. ml) was added, homogeised usig the pestle ad DNA recovered by ethaol precipitatio. DNA pellets were dissolved i µl water ad.µl aliquots take for each TaqMa assay. Primer ad probe sequeces for the taqma PCR assays were desiged agaist gee sequeces flakig either: ) the rdl mutatio (AS) withi the flea GABA receptor ad coferrig target-site resistace to cyclodiees (Bass et al. a) ad ) kdr (LF) or ) super-kdr (T99V) mutatios withi the flea voltage-gated sodium chael, both of which cofer target-site resistace to pyrethroids (Bass et al. b). For each assay, forward ad reverse ulabelled primers together with VIC (wild-type allele) ad -FAM (mutat allele) labelled probes were desiged usig Primer Express software v.. (Life Techologies). The VIC ad FAM labelled probes also cotaied a o-fluorescet quecher (NFQ) ad mior groove bider (MGB) at their eds. Primer ad probe sequeces are as follows ( to ): rdl assay, forward primer = GTTTTGGCTGAATCGTAATGCTACA, reverse primer = CATGGTCAACACAGTGGTCACT, wildtype probe = VIC-TCGAGTCGCTCTCG-NFQ, mutat probe = FAM-CTCGAGTCTCTCTCG-NFQ; kdr assay, forward primer = GGTGATGTCAGCTGTATTCCTTTCT, reverse primer = ACTATATATTAAAATGTCGTTGGCATTAGC, wild-type probe = VIC-CTTACCACAAGATTACCA-NFQ, mutat probe = FAM-CTTACCACAAAATTACCA-NFQ; skdr assay, forward primer = CTTATATCCATTATGGGTCGAACGAT, reverse primer = CATTACGGCGAATATGAAGATGATAATAC, wild-type probe = VIC-CACAAACGTTAGATTAC-NFQ, mutat probe = FAM-CACAAACACTAGATTAC-NFQ. PCR assay reactios ( μl) cotaied. μl of geomic DNA, μl of SesiMix Probe kit (Biolie Reagets Ltd), M of each primer ad M of each probe. Reactios were ru o a Rotor-Gee (Corbett Research) usig temperature cyclig coditios of mi at 9 C, followed by cycles of 9 C for s ad C for s. The icrease i VIC ad FAM fluorescece was moitored i real S
6 Ectopar asites Table The miimum lethal dose of deltamethri (g/flea) required to kill adult C. felis Strai/isolate LD (9 % CL) LD9 (9 % CL) RR (isolate/ Aubur) Aubur. ±.. (..). (..) --- Moheim.9 ±. 9. (..). (. ).. ±.. (..). (9. 9). FI.9 ±.. (.9.). (. 9.). FI. ±..9 (.9 9.). (..9)..9 ±.. (.9.). (. )..9 ±.. (..) (. 9).9. ±.. (9..). (. ). FI. ±.. (..). (. ).. ±.. (..9).9 (. 9.). FI. ±..9 (..9) (. ). FI. ±.. (.9.). (. 9.). FI.9 ±.. (. 9) (ot computable) 9. Table The miimum lethal dose of etofeprox (g/flea) required to kill adult C. felis Strai/isolate LD9 (9 % CL) RR (isolate/ ). ±.. (..) ( ) --- FI. ±.. (..) 9. (. ). FI. ±.. (. 9.) ( )..9 ±.. (..) ( ).. ±.9.9 (..) (. ). FI. ±.. (..) (99. ).9. ±.. (. 9.) ( 9). FI. ±.. (. 9.) ( ). FI. ±.. (..9) (9. ). FI. ±.9. (. ) ( ).9 time by acquirig each cycle o the yellow chael ( m excitatio ad m emissio) ad gree chael ( m excitatio ad emissio) of the Rotor-Gee, respectively. To assist with assigig geotypes, the edpoit fluorescece values for the two dyes were plotted agaist each other i bivariate ster plots to give clusterig of samples i three groups correspodig to wild-type homozygotes (SS), resistace homozygotes (RR) ad the heterozygous geotype (RS). Statistical Aalyses Dose-mortality lies for each strai ad isecticide were determied usig Polo software (LeOra Software, Melo Park, CA; Robertso ad Preisler S LD (9 % CL) 99). The laboratory strai with the lowest LD was selected as the baselie referece strai for each isecticide tested. Results Bioassays with pyrethroid isecticides Of the laboratory strais maitaied at, Aubur was the most susceptible to deltamethri (Table ). The RR ratios of the field-collected isolates raged from. to 9.. The regressio lies for,, FI, ad FI had very shallow slopes (< ), requirig extremely high doses to kill 9 % of the fleas ad implyig that these isolates showed
7 Ectopar asites Table The miimum lethal dose of permethri (g/flea) required to kill adult C. felis LD (9 % CL) LD9 (9 % CL) RR (isolate/ ) a Aubur.9 ±.. (..) (9. ). KS.9 ±.. (..) (. ). Moheim. ±.. (. 9.) ( ). Strai/isolate.9 ±.. (..). (.9.) --- FI. ±.. (..9) (. ). FI.9 ±..9 (..) ( ). FI. ±. 9. (. 99.) 9 ( 9).. ±.. (. ) ( ).9 FI 9. ±.. (..) 9. (. ). 9.9 ±.. (. 9.) ( ).. ±. 9. (. 9.) 9 ( 9). FI. ±.. (. ) (9 ).9. ±.9. ( ) ( 99). FI. ±.. (..) 9 ( ). FI. ±..9 (. ) 9 ( ot computable). FI. ±.. (..) (. ). the greatest iteral heterogeeity i respose. Resposes to the o-ester pyrethroid etofeprox were more cosistet with LDs ragig oly threefold from. to. g/flea (Table ). The fieldcollected isolates ad FI had shallower slopes (< ) tha the remaider, resultig i the highest LD9s of ad g/flea, respectively. The LDs of permethri raged from. to. g/ flea, represetig a five-fold variatio i respose (Table ). The field-collected isolates, FI,, FI,, FI, ad FI had shallow slopes (< ) requirig the highest doses to kill all of the fleas. The fieldcollected isolates, FI, ad had sigifily higher LDs to d-pheothri tha did the laboratory strais Aubur, Moheim, ad, although the total rage of variatio was less tha four-fold (Table ). The regressio equatios for FI, FI,, FI, ad FI had slopes <, requirig high doses to provide 9 % kill. Bioassays with o-pyrethroid isecticides All of the strais ad isolates had similar resposes to tetrachlorviphos, except FI which showed -fold resistace at LD compared to Aubur (Table ). However, the slope of the regressio equatio was typically < for most of the strais ad isolates ad substatially higher doses were required to kill 9 % of fleas compared with Aubur. All of the strais ad isolates respoded similarly to fiproil at LD ad LD9 (Table ). The field-collected isolates FI,, ad FI had regressio slopes <. There were also very cosistet resposes to imidacloprid (Table ). As little as. g/flea killed % of the adult fleas i several field-collected isolates. Noe of the strais or isolates had a regressio slope <. Geotypig assays The isolates varied substatially i geetic compositio at the rdl locus. All of the Aubur ad isects tested were homozygous susceptible, whereas all FI ad FI isects were homozygous for the resistace allele (Table 9). All the other isolates cotaied a mixture of geotypes. The isolates also varied substatially i frequecies of the kdr ad skdr mutatios (Tables ad ). Iterestigly, for most isolates the distributio S
8 Ectopar asites Table The miimum lethal dose of d-pheothri (g/flea) required to kill adult C. felis Strai/isolate LD (9 % CL) LD9 (9 % CL) RR (isolate/ ) Aubur. ±.. (..). (. ). KS 9.9 ±. 9. (..) (9. 9). Moheim.99 ±.. (. 9.) 9 ( ).. ±.. (..). (. 9.9) --- FI. ±.. (. 9.) ( ). FI.9 ±.. (..) ( ).9 FI. ±.. (. 9.) 9 ( ).. ±.. (..) ( ).. ±.. (..9). (. ).9.99 ±. (9. ) ( 9). FI. ±. (. ) ( ).9.9 ±. (9. ) 9 (9 ). FI. ±.. (..9) (ot computable). FI. ±.. (..) ( ). FI. ±.. (..) ( ). Table The miimum lethal dose of tetrachlorviphos (g/flea) required to kill adult C. felis Strai/isolate LD (9 % CL) LD9 (9 % CL) Aubur. ±.. (..). (. 9.) --- Moheim. ±.. (..) ( 9).. ±.. (. 99.) 9 ( 9). FI 9.9 ±..9 (. 9.) (. 9.).. FI. ±. ( ) 9 ( ). ±.. (..). (. ). 9. ±.. (. ) ( ). FI 9. ±..9 (..) (. ). 9. ±.. (.9.) (. ). FI. ±.. (.9.) 9 ( ). FI. ±. 9. (..) ( ). FI.9 ±.. (..) (9 ). of geotypes for kdr was the reverse of that for skdr. Thus, seve FI isects were homozygous susceptible for kdr but oe were homozygous resistat for this mutatio. For skdr, the reverse was the case with seve beig homozygous resistat ad oe beig homozygous susceptible. Five isects were heterozygous for both mutatios. The cosistecy of this patter across isolates implies that the two mutatios i the sodium chael were segregatig i oppositio to oe aother ad that alleles cotaiig both mutatios are abset or very rare. S RR (isolate/ Aubur) Discussio The topical appliio of isecticides to the cuticle of adult C. felis provided a sesitive ad precise method of determiig the susceptibility of fleas. This method was first used for fleas by Moyses (99) ad Moyses ad Gefeller (), who provided data for a umber of isecticides agaist oe well characterised laboratory flea strai, the Daish Pest Ifestatio Laboratory (DPIL) strai. Despite some mior differeces i methodology, our results
9 Ectopar asites Table The miimum lethal dose of fiproil (g/flea) required to kill adult C. felis RR (isolate/ Aubur) Strai/isolatea LD (9 % CL) LD9 (9 % CL) Aubur. ±.9. (.9.). (..) ---- KS. ±..9 (..). (..). Moheim.9 ±.. (..). (..).. ±.. (.9.). (..99). FI. ±..9 (..).9 (.9.). FI. ±.. (..). (..). FI. ±.. (..). (..9).. ±.. (..). (..9).9.9. ±.. (..). (.9 9.). ±.. (..). (..9). FI.9 ±.. (.9.). (..9).. ±.. (..). (..9). FI. ±.. (..). (..). FI. ±.. (..). (..). FI. ±.. (..99). (..). Table The miimum lethal dose of imidacloprid (g/flea) required to kill adult C. felis Strai/isolatea LD (9 % CL) LD9 (9 % CL) RR (isolate/ KS). Aubur.9 ±.. (..). (..) KS.9 ±.. (..9). (.9.9) --- Moheim.9 ±.. (..9). (..).. ±.. (..). (.9.). FI. ±.. (..). (..). FI. ±.. (..). (.99.). FI. ±.. (..). (.9.).. ±.. (..). (.9.). FI 9. ±..9 (..). (..)..9 ±.9. (..9). (..9). FI. ±.9. (..). (..).. ±.. (..). (.9.). FI. ±.. (..). (..9). FI. ±.9. (..). (..). FI. ±.9. (..). (..). for fiproil ad imidacloprid tested agaist four laboratory referece strais ad a diverse rage of field isolates are broadly very cosistet with those obtaied with DPIL (Moyses ad Gefeller ). However, most of the field-collected isolates were sigifily less susceptible to deltamethri ad permethri compared with the DPIL strai tested i. Whe DPIL was tested agaist the orgaophosphates diazio, fethio, ad malathio, the slopes of the regressio lies were steep >. ad LD s raged from. to µg/flea (Moyses ad Gefeller ). I our study with tetrachlorviphos, the slopes were shallow < ad dosages > µg/flea required to kill % of the fleas. With the exceptio of the FI isolate (which cotaied oly skdr), all of the strais ad isolates possessed both the kdr ad skdr mutatios. Thus, S
10 Ectopar asites Table 9 Rdl geotypes of laboratory ad field-collected isolates of C. felis. isolate S/S S/R R/R Aubur FI FI FI FI FI FI FI Table Kdr geotypes of laboratory ad field-collected isolates of C. felis. isolate S/S S/R R/R Aubur FI FI FI FI FI FI FI Table Skdr geotypes of laboratory ad field-collected isolates of C. felis. isolate S/S S/R R/R Aubur FI FI FI FI FI FI FI it seems ulikely that we tested a strai or isolate that was truly susceptible to pyrethroids. The amio-acid substitutio uderpiig kdr (LF) is S thought to cofer fold resistace to a broad rage of pyrethroid molecules (Farham et al. 9) whereas that uderpiig skdr (T99V)
11 Ectopar asites may result i very high resistace ratios (Roditakis et al. ). The ubiquity of kdr ad skdr alleles i log-stadig laboratory strais as well as field-collected isolates from Australia ad the USA is surprisig, give that the former have had o exposure to pyrethroids for at least years, ad implies that they have persisted ad cofer o fitess cost o their carriers uder laboratory rearig coditios. The distributio of these mutatios across isolates shows that fully susceptible alleles (ie. oes lackig both mutatios) are ucommo. Oly the FI isolate, which was cosistetly homozygous susceptible for kdr ad cotaied heterozygotes for skdr ca be implied as possessig a completely wildtype allele, ad uder Medelia rules we assume that testig more idividuals from this isolate would disclose fleas homozygous susceptible for both mutatios. I additio, the mutatios segregate i oppositio ad we foud o evidece of a allele cotaiig both mutatios, which is a prerequisite for geeratig fleas homozygous for both kdr ad skdr. The rdl mutatio causig a coformatioal chage to the GABA-gated chloride chael is well kow to cofer sigifi, ecoomically damagig levels of resistace to a rage of cyclodiee isecticides (Ffrech-Costat 99). Cyclodiees share this target site with fiproil ad there has bee much debate over the likelihood of the rdl mutatio, selected through prior exposure to cyclodiees, coferrig cross-resistace to fiproil (Bass et al. b). It ca be cocluded from this study, ecompassig isolates i which rdl is evidetly rare (eg. Aubur) ad oes i which it appears ubiquitous (eg. FI), yet which exhibit very similar resposes to fiproil, that the extet of such cross-resistace is egligible (see also Bruet et al. 9). This of course does t preclude the appearace of ew alleles capable of substatial reductios i receptor bidig by fiproil leadig to a potet resistace pheotype (Le Goff ). The susceptibility of field-collected isolates of C. felis from Europe, Australia ad the USA to imidacloprid has bee ivestigated sice by exposig larvae to a diagostic cocetratio of isecticide i a diet-impregatio bioassay (Rust et al.,, ; Schroeder et al, ). To date, testig of over, idividuals from over isolates has disclosed o evidece for a directioal shift i respose or a declie is susceptibility (Rust et al, ; Kopp et al. ). However, it could be argued that over-reliace o a larval bioassay, despite its operatioal advatages for resistace moitorig, could disguise the emergece of a resistace pheotype expressed oly i adults. The lack of sigifi variatio i susceptibility to imidacloprid i adults through topical appliio is therefore reassurig ad vidies the desig of the ogoig resistace moitorig programme. Ackowledgemets We thak Lucio Rodriguez (Uiversity of Califoria Riverside) for rearig ad maitaiig the flea isolates. Ethical stadards The study was performed i compliace with curret atioal laws ad regulatios. Fudig The study was i part supported by a grat from Bayer Aimal Health GmbH, Germay, Coflict of iterest Norbert Mecke, Sabria Foit ad Kathri Tetzer are employed by Bayer Aimal Health GmbH. Wedell Davis was, Joe Hostedler ad Robert Rees are employed by Bayer Health Care. All other authors are employed by their respective Uiversity istitutios ad declare o coflict of iterests. S
12 Ectopar asites Refereces Bass C, Schroeder I, Turberg A, Field LM, Williamso MS (a) Idetifiio of mutatios associated with pyrethroid resistace i the para-type sodium chael of the flea, Cteocephalides felis. Isect Biochem Mol Biol : Bass C, Schroeder I, Turberg A, Field LM, Williamso MS (b) Idetifiio of the Rdl mutatio i laboratory ad field strais of the flea, Cteocephalides felis (Siphoaptera: Pulicidae). Pest Maage Sci : Blagbur BL, Dryde MW, Paye P, Rust MK, Jacobs DE, Bod R, Hutchiso MJ, Deholm I, Mehlhor H, Vaugh MB, Mecke N, Schroeder I, Hostetler J, Edrizzi M () New methods ad strategies for moitorig susceptibility of fleas to curret flea cotrol products. Vet Ther : 9 Bossard RL, Dryde MW, Broce AB () Isecticide susceptibilities of fleas (Siphoaptera: Pulicidae) from several regios of the Uited States. J Med Etomol 9: Bossard RL, Hikle NC, Rust MK (99) Review of isecticide resistace i fleas (Siphoaptera: Pulicidae). J Med Etomol : Bruet S, Le Meter C, Murray M, Soll M, Audoet J-C (9) Rdl gee polymorphism ad sequece aalysis ad relatio to i vivo fiproil susceptibility i strais of the flea. J Eco Etomol : Farham AW, Murray AWA, Sawicki RM, Deholm I, White JC (9) Characterisatio of the structure-activity relatioship of kdr ad two variats of super-kdr to pyrethroids i the housefly (Musca domestica L.). Pestic Sci 9: 9. Ffrech-Costat RH (99) The molecular ad populatio geetics of cyclodiee isecticide resistace. Isect Biochem Molec Biol : Kopp S, Blagbur B, Colema G, Davis W, Deholm I, Field C, Hostetler J, Mecke N, Rees R, Rust M, Schroeder I, Tetzer K, Williamso M () Moitorig field susceptibility to imidacloprid i the flea: a world-first iitiative twelve years o. Parasitol Res :S S Le Goff G, Hamo A, Berge J-B, Amichot, M () Resistace to fiproil i Drosophila simulas: ifluece of two poit mutatios i the RDL GABA receptor subuit. J Neurochem 9: 9 S Metzger ME, Rust MK (99) Egg productio ad emergece of adult fleas (Siphoaptera: Pulicidae) exposed to differet photoperiods. J Med Etomol : Moyses EW (99) Measuremet of isecticide resistace i adult flea, pp.. I R.W. Meola [ed.], Proceedigs of the Third Iteratioal Symposium o Ectoparasites of Pets, April 99, College Statio, TX. Texas A&M Uiversity, College Statio, TX Moyses EW, Gfeller FJ () Topical appliio as a method for comparig the effectiveess of isecticides agaist flea (Siphoaptera: Pulicidae). J. Med Etomol :9 9 Robertso J L, Preisier HK (99) Pesticide Bioassays with Arthropods. Boca Rato, FL, CRC Press Roditakis E, Tsagkarakou A, Votas J () Idetifiio of mutatios i the para sodium chael of Bemisia tabaci from Crete, associated with resistace to pyrethroids. Pestic Biochem Physiol : Rust MK, Deholm I, Dryde MW, Paye P, Jacobs DE, Bod R, Mecke N, Schroeder I, Westo S, Vaugh M, Colema G, Kopp S () Large-scale moitorig of imidacloprid susceptibility i the flea, Cteoceophalides felis. Med Vet Etomol : Rust MK, Deholm I, Dryde MW, Paye P, Williamso M, Blagbur B, Jacobs DE, Mecke N, Schroeder I, Vaugh MB, Mehlhor M, Hikle NC () Determiig a diagostic dose for imidacloprid susceptibility testig of field collected isolates of fleas (Siphoaptera: Pulicidae). J Med Etomol : Rust MK, Waggoer M, Hikle NC, Mecke N, Hase O, Vaugh M, Dryde MW, Paye P, Blagbur BL, Jacobs DE, Bach T, Bledsoe D, Hopkis T, Mehlhor H, Deholm I () Developmet of a larval bioassay for susceptibility of fleas (Siphoaptera: Pulicidae) to imidacloprid. J Med. Etomol 9: Schroeder I, Blagbur BL, Bledsoe DL, Bod R, Deholm I, Dryde MW, Jacobs DE, Mehlhor H, Mecke N, Paye P, Rust, MK, Vaugh MB () Progress of the iteratioal work of the Imidacloprid flea susceptibility moitorig team. Parsitol Res 9:S S. WHO (9) Isecticide resistace ad vector cotrol. Wld Hlth Org Tech Ser No..
Effect of the genealogic line on milk production and prolificacy of the ewes from Synthetic Population Bulgarian Milk
158 Bulgaria Joural of Agricultural Sciece, 19 (No 1) 2013, 158-162 Agricultural Academy Effect of the geealogic lie o milk productio ad prolificacy of the ewes from Sythetic Populatio Bulgaria Milk T.
More informationIntroduction. Experimental Approach
Primig Effect of Melegestrol Acetate (MGA) ad Moesi o Puberty ad Subsequet Reproductive Performace i Crossbred Beef Heifers J. L. Roberts, R. P. Del Vecchio, G. T. Getry, Jr., D. Saders, P. E. Humes ad
More informationSelectively Breeding Sheep
Selectively Breedig Sheep ame Part 1: atural Selectio ad Selective Breedig What is atural selectio? What is selective breedig? What are the advatages of selective breedig? Give a example of selective breedig
More informationSikafloor Solutions for Industrial, Commercial and Public Building Areas
Sikafloor Solutios for Idustrial, Commercial ad Public Buildig Areas Iovatio & sice Cosistecy 1 9 1 0 Sikafloor Solutios for Idustrial ad Commercial Areas Highly Floorig Solutios for the Highest Aesthetic
More informationBreeding, paternal behavior, and their interruptionin Betta splendens
Aimal Learig & Behavior 1982,10 (2),145-151 Breedig, pateral behavior, ad their iterruptioi Betta spledes PAUL M. BRONSTEIN Uiversity ofmichiga, Flit, Michiga Seve experimets examied the reproductive activities
More informationDavid J. Lewkowicz. Robert Lickliter. New "fork State Institute for Basic Research in Developmental Disabilities
Developmetal Psychology 9, Vol. 31. No. 4, 9-18 Copyright 9 by the America Psychological Associatio, Ic. OI2-149/9/S3.OO Itersesory Experiece ad Early Perceptual Developmet: Atteuated Preatal Sesory Stimulatio
More informationNiche Overlap and Diffuse Competition
Proc. Nat. Acad. Sci. USA Vol. 71, No. 5, pp. 21412145, May 1974 Niche Overlap ad Diffuse Competitio (desert lizards/resource partitioig/commuity structure/species diversity) ERIC R. PIANKA Departmet of
More informationCharacterization of CO 2 Laser Photoacoustic Spectrometer Intracavity Configuration and Its Application in Measuring Acetone Gas in Human Breath
Proceedigs of the Pakista Academy of Scieces: A. Physical ad Computatioal Scieces 54 (3): 319 327 (2017) Copyright Pakista Academy of Scieces ISSN: 2518-4245 (prit), 2518-4253 (olie) Pakista Academy of
More informationPlasma homeostasis and cloacal urine composition in Crocodylus porosus caught along a salinity gradient
Plasma homeostasis ad cloacal urie compositio i Crocodylus porosus caught alog a saliity gradiet Gordo C. Grigg Zoology, A08, Uiversity of Sydey, Sydey, N.S.W. 2006, Australia Accepted April l, 1981 Summary.
More informationGame Programming. Bing-Yu Chen National Taiwan University
Game Programmig Big-Yu Che Natioal Taiwa Uiversity Search o Blid search Breadth-First Search Depth-First Search o Heuristic search A* o Adversary search MiMax 2 Itroductio to Search o o Usig tree diagram
More informationIntestinal Apicomplexans
Itestial Apicomplexas Cystoisospora (= Isospora) Protozoa Groups Historically, protozoa have bee grouped by mode of motility. Flagellates Hemoflagellates Trypaosoma cruzi Leishmaia ifatum Mucoflagellates
More informationResidential Aged Care Antibiogram Jan - Dec 2018 Residential Aged Care Antibiogram Jan - Dec 2018
Page: 1 Cumulative atibiograms specific for idividual health care facilities ca be a useful resource for local atimicrobial stewardship groups to iform empirical therapy recommedatios ad formulary maagemet.
More informationAccelerate Your Antibody Discovery with High throughput Array SPR
ccelerate Your tibod Discover with High throughput rra SPR December 10, 2018 Daiel ediger, PhD Seior Field pplicatios Scietist, Carterra Carterra Fouded i 2005, Salt Lake Cit, UT, as Wasatch Microfluidics
More informationResidential Aged Care Antibiogram Jan - Dec 2017 Residential Aged Care Antibiogram Jan - Dec 2017
Page: 1 Cumulative atibiograms specific for idividual health care facilities ca be a useful resource for local atimicrobial stewardship groups to iform empirical therapy recommedatios ad formulary maagemet.
More informationDetermining a Diagnostic Dose for Imidacloprid Susceptibility Testing of Field-Collected Isolates of Cat Fleas (Siphonaptera: Pulicidae)
VECTOR CONTROL, PEST MANAGEMENT, RESISTANCE, REPELLENTS Determining a Diagnostic Dose for Imidacloprid Susceptibility Testing of Field-Collected Isolates of Cat Fleas (Siphonaptera: Pulicidae) M. K. RUST,
More informationApril, 2018 vs. April, 2017
Parterig with: The Isider s Isight Bechmark Report is a publicatio provided by the Veteriary Hospital Maagers Associatio (VHMA). The report tracks key ecoomic idicators to determie how VHMA member practices
More informationControl of parasite burdens in wild red grouse Lagopus
Ecology 2002 39, Cotrol of parasite burdes i wild red grouse Lagopus Blackwell Sciece, Ltd lagopus scoticus through the idirect applicatio of athelmitics D. NEWBORN ad R. FOSTER The Game Coservacy Trust
More informationCat owners survey Prepared for: Prepared by: Date of issue: Pam Whetnall Project Officer Dog and Cat Management Board
Cat owers survey 2014 Prepared for: Pam Whetall Project Officer Dog ad Cat Maagemet Board Prepared by: Natasha Kapulski Research Associate for Marketig Sciece T. (08) 8302 0137 Date of issue: 7 April 2014
More informationBacteraemia in Maiduguri Metropolis, Nigeria: A 2005 to 2009 study of some causative pathogens and fluoroquinolones activities against them
ISSN: 2231-3354 Received o: 14-09-2011 Revised o: 18-09-2011 Accepted o: 21-09-2011 Bacteraemia i Maiduguri Metropolis, Nigeria: A 2005 to 2009 study of some causative pathoges ad fluoroquioloes activities
More informationSolutions with Sika Systems. No more vibration
Solutios with Sika Systems No more vibratio ost effective techology Faster placig with reduced labour ad equipmet No vibratio ad less fiishig Reduced oise i the eviromet Improved health ad safety coditio
More informationThe effects of diet upon pupal development and cocoon formation by the cat flea (Siphonaptera: Pulicidae)
June, 2002 Journal of Vector Ecology 39 The effects of diet upon pupal development and cocoon formation by the cat flea (Siphonaptera: Pulicidae) W. Lawrence and L. D. Foil Department of Entomology, Louisiana
More informationKuroda s Identities. We find that Kuroda s Identities can be very useful in making the implementation of Richard s transformations more practicable.
4//7 Kurodas Idetities 1/7 Kuroda s Idetities We fid that Kuroda s Idetities ca be very useful i makig the implemetatio of Richard s trasformatios more practicable. Kuroda s Idetities essetially provide
More information300 :: -: E _ 0 o 250- l P AZ- IOO-
Codor, 8:285-289 The Cooper Orithological Society 1978 SNOW CONDITIONS AND THE ONSET OF BREEDING IN THE MOUNTAIN WHITE-CROWNED SPARROW MARTIN L. MORTON Sice the summer of 1968, my studets ad I have bee
More informationB Handoko Daeng*, Analis Wisnu Wardhana**, Aris Widodo***, Hidayat Sujuti***, Karyono Mintaroem***, Edi Widjajanto***
Plasma CRH Level Differece Betwee Wistar Rats Exosed To Acute Stress Due To Predator ORIGINAL ARTICLE PLASMA CORTICOTROPINE RELEASING HORMONE (CRH) LEVEL DIFFERENCE BETWEEN WISTAR RATS EXPOSED TO ACUTE
More informationFeline herpesvirus 1 (FeHV-1) and feline
Joural of Felie Medicie ad Surgery (2009) 11, 1023e1027 doi:10.1016/j.jfms.2009.05.023 SHORT COMMUNICATION Felie herpesvirus 1 ad felie calicivirus ifectios i a heterogeeous cat populatio of a rescue shelter
More informationThe effects of Cosynch-56 protocol on pregnancy rates of cows and heifers presynchronized with a single dose of PGF 2α
90 KACAR (C.) AND COLLABORATORS The effects of Cosych-56 protocol o pregacy rates of cows ad heifers presychroized with a sigle dose of C. KACAR 1, N. C. LEHIMCIOGLU 2, H. ORAL 1, S. YILDIZ 2, S. KAYA
More informationEffect of mastitis and related-germ on milk yield and composition during naturally-occurring udder infections in dairy cows
Aim. Res. 51 (2002) 383 393 INRA, EDP Scieces, 2002 DOI: 10.1051/aimres:2002031 383 Origial article Effect of mastitis ad related-germ o milk yield ad compositio durig aturally-occurrig udder ifectios
More informationAll Hospitals Antibiogram Jan - Dec 2018 All Hospitals Antibiogram Jan - Dec 2018
Page: 1 Cumulative atibiograms specific for idividual health care facilities ca be a useful resource for local atimicrobial stewardship groups to iform empirical therapy recommedatios ad formulary maagemet.
More informationSome Physical Characteristics of Sambar Deer (Cervus unicolar)
PertaikaJ. Trop. Agric. Sci. 23(): 55-59 (2000) ISSN: 5-370 Uiversiti Putra Malaysia Press Some Physical Characteristics of Sambar Deer (Cervus uicolar) ISMAIL IDRIS, SAIDI MOIN 2, SAMTO SULAH 3 ad DAWEND
More informationDOMESTIC CATS AS PREDATORS AND FACTORS IN WINTER SHORTAGES OF RAPTOR PREY
DOMESTIC CATS AS PREDATORS AND FACTORS IN WINTER SHORTAGES OF RAPTOR PREY WILLIAM G. GEORGE The domestic cat (FeZis catus) was itroduced ito the Uited States over 150 years ago. Imported i small umbers
More informationNationwide Residues of Organochlorine Pesticides in Wings of Mallards and Black Ducks
Uiversity of Nebraska Licol DigitalCommos@Uiversity of Nebraska Licol US Fish & Wildlife Publicatios US Fish & Wildlife Service 91969 Natiowide Residues of Orgaochlorie Pesticides i Wigs of Mallards ad
More informationPet Friendly Shelter Marion County, Florida. Jill Lancon, Animal Center Director
Pet Friedly Shelter Mario Couty, Florida Jill Laco, Aimal Ceter Director jill.laco@mariocoutyfl.org 352-671-8709 Whe Disaster Strikes We ll Be Ready PURPOSE Provide a safe have for pet owers ad their domestic
More informationEffect of time and depth of insemination on fertility of Bharat Merino sheep inseminated trans-cervical with frozen-thawed semen
Kumar ad Naqvi Joural of Aimal Sciece ad Techology 2014, 56:8 RESEARCH Ope Access Effect of time ad depth of isemiatio o fertility of Bharat Merio sheep isemiated tras-cervical with froze-thawed seme Davedra
More informationVeterinary Parasitology 112 (2003)
Veterinary Parasitology 112 (2003) 249 254 Comparative speed of kill between nitenpyram, fipronil, imidacloprid, selamectin and cythioate against adult Ctenocephalides felis (Bouché) on cats and dogs R.
More informationMucoflagellates. Trichomonads & Giardia
Mucoflagellates Trichomoads & Giardia Protozoa Groups Historically, protozoa have bee grouped by mode of motility. Flagellates Hemoflagellates Trypaosoma cruzi Leishmaia ifatum Mucoflagellates Tritrichomoas
More informationThink Rabbit. Virtual Manual 2014
Thik Rabbit Virtual Maual 2014 Cotets Itroductio Thik Rabbit i the waitig room Thik Rabbit i the cosultig room Thik Rabbit i the operatig room Thik Rabbit durig hospitalisatio The Commercial View The Owers
More informationSouth Carolina. VETERINARIAN UPDATE SOUTH CAROLINA ASSOCIATION OF VETERINARIANS NEWSLETTER Advancing the Science and Art of Veterinary Medicine
South Carolia VETERINARIAN UPDATE SOUTH CAROLINA ASSOCIATION OF VETERINARIANS NEWSLETTER Advacig the Sciece ad Art of Veteriary Medicie Volume 13, Issue 3 Autum 2015 I This Issue... SCAV Holds Aual Coferece
More informationit s hard to believe that my first year as a veterinarian
michiga veteriary medical associatio i this issue... 2 Bovie Leukemia Virus 5 Power of Te Leadership Academy 6 The Uauthorized Practice of Veteriary Medicie 10 MAHF Fuds Three Research Grats 12 Compaio
More informationREPORT TITLE Efficacy of A-SNE Nature-Cide Insecticidal Dust. STUDY Product Development 15
REPORT TITLE Efficacy of Nature-Cide Insecticidal Dust STUDY Product Development 15 TRIALS CTECFE / RHIPSA / CIMXLE / BLTTGE / MONOPH / MUSCDO / SOLEIN EXPERIMENTAL START DATE April 23, 2015 EXPERIMENTAL
More informationINFLUENCES OF HOUSING SYSTEMS AND SLAUGHTER WEIGHT ON THE MARKET REALIZATION OF SLAUGHTER PIGS BY SEUROP CLASSIFICATION
ACTA UNIVERSITATIS AGRICULTURAE ET SILVICULTURAE MENDELIANAE BRUNENSIS Volume 66 42 Number 2, 2018 https://doi.org/10.11118/actau201866020389 INFLUENCES OF HOUSING SYSTEMS AND SLAUGHTER WEIGHT ON THE MARKET
More informationComparative Evaluation of the Speed of Flea Kill of Imidacloprid and Selamectin on Dogs*
R. Everett, J. Cunningham, R. Arther, D. L. Bledsoe, and N. Mencke Comparative Evaluation of the Speed of Flea Kill of Imidacloprid and Selamectin on Dogs* Ronald Everett, PhD a Jerry Cunningham, MS a
More informationOrthopteran communities in the conifer-broadleaved woodland zone of the Russian Far East
Eur J Etomol 105: 673 680, 2008 http://wwwejecz/scripts/viewabstractphp?abstract=1384 ISSN 1210-5759 (prit), 1802-8829 (olie) Orthoptera commuities i the coifer-broadleaved woodlad zoe of the Russia Far
More informationFlea Control Challenges: How Your Clients Can Win the Battle
Flea Control Challenges: How Your Clients Can Win the Battle Understanding and controlling fleas in the "red-line" home Michael Dryden DVM, MS, PhD Professor of Veterinary Parasitology Department of Diagnostic
More informationLufenuron. Technical Profile
Lufenuron Technical Profile Lufenuron Virbac is proud to have the insect growth regulator (IGR) lufenuron as part of its parasiticide portfolio. Lufenuron is also referred to as an insect development inhibitor
More informationSERIES OF MISCELLANEOUS PUBLICATIONS UNIVERSITY OF AMSTERDAM. Atherurus F. Cuvier, D.J. van Weers. Abstract INTRODUCTION
Iformatio about this material is preseted ad the status of te specific ad subspecific ames Beaufortia SERIES OF MISCELLANEOUS PUBLICATIONS INSTITUTE OF TAXONOMIC ZOOLOGY (ZOOLOGICAL MUSEUM) UNIVERSITY
More information2016 UAH Antibiograms
2016 UAH Atibiograms Uiversity of Alberta Hospital Cross Cacer Istitute Stollery Childre s Hospital Departmet of Laboratory Medicie ad Pathology Itroductio The atibiograms preseted herei represet cumulative
More informationLaboratory 7 The Effect of Juvenile Hormone on Metamorphosis of the Fruit Fly (Drosophila melanogaster)
Laboratory 7 The Effect of Juvenile Hormone on Metamorphosis of the Fruit Fly (Drosophila melanogaster) (portions of this manual were borrowed from Prof. Douglas Facey, Department of Biology, Saint Michael's
More informationLIFE HISTORY OF PLESIONIKA EDWARDSI (CRUSTACEA, DECAPODA, PANDALIDAE) AROUND THE CANARY ISLANDS, EASTERN CENTRAL ATLANTIC
S. Afr. J. mar. Sci. 18: 39 48 1997 39 LIFE HISTORY OF PLESIONIKA EDWARDSI (CRUSTACEA, DECAPODA, PANDALIDAE) AROUND THE CANARY ISLANDS, EASTERN CENTRAL ATLANTIC J. I. SANTANA*, J. A. GONZÁLEZ*, I. J. LOZANO
More informationCHARTING THE LATE CRETACEOUS SEAS: MOSASAUR RICHNESS AND MORPHOLOGICAL DIVERSIFICATION
Joural of Vertebrate Paleotology 29(2):409 416, Jue 2009 # 2009 by the Society of Vertebrate Paleotology ARTICLE CHARTING THE LATE CRETACEOUS SEAS: MOSASAUR RICHNESS AND MORPHOLOGICAL DIVERSIFICATION MARCUS
More informationAction Plan for North America. Sustainable Trade in Parrots
Actio Pla for North America Sustaiable Trade i Parrots Sustaiablefor Trade i Parrots:Cooperatio Actio Pla for North America Commissio Evirometal a Please cite as: CEC. 2017. Sustaiable Trade i Parrots:
More informationCase 2:14-cv KJM-KJN Document 2-5 Filed 02/03/14 Page 1 of 6 EXHIBIT E
Case 2:14-cv-00341-KJM-KJN Document 2-5 Filed 02/03/14 Page 1 of 6 EXHIBIT E Case 2:14-cv-00341-KJM-KJN Document 2-5 Filed 02/03/14 Page 2 of 6 1 EGG ECONOMICS UPDATE #338, Poultry Specialist (emeritus),
More informationComparison of Lufenuron and Nitenpyram Versus Imidacloprid for Integrated Flea Control*
P. F. Miller, B. A. Peters, and C. A. Hort Comparison of Lufenuron and Nitenpyram Versus Imidacloprid for Integrated Flea Control* Peter F. Miller, MSc, PhD a Bryce A. Peters, B. App Sc a Colin A. Hort,
More informationSTEPHEN N. WHITE, PH.D.,
June 2018 The goal of the American Sheep Industry Association and the U.S. sheep industry is to eradicate scrapie from our borders. In addition, it is ASI s objective to have the United States recognized
More informationEffects of an Ivermectin Otic Suspension on Egg Hatching of the Cat Ear Mite, Otodectes cynotis, in Vitro*
D. D. Bowman, S. Kato, and E. A. Fogarty Effects of an Ivermectin Otic Suspension on Egg Hatching of the Cat Ear Mite, Otodectes cynotis, in Vitro* Dwight D. Bowman, PhD Satomi Kato, DVM, MS Elizabeth
More information//////////////////////////////////////////////////////////////////101
//////////////////////////////////////////////////////////////////101 Aimal CSI: Gatherig the Evidece By Julie Miller Dowlig This article is writte for ew cruelty ivestigators ad ca also be used as a referece
More informationProtocol for fabrication of microcompartments for long-term culture and imaging of small C. elegans larvae. Henrik Bringmann, March 2011.
Protocol for fabrication of microcompartments for long-term culture and imaging of small C. elegans larvae Henrik Bringmann, March 2011. 1 Step-by-Step Protocol Step1 : Preparing a humidity dish (see illustration
More informationIntegrated Resistance Management in the control of disease transmitting mosquitoes
Pan Africa Malaria Vector Control Conference 25 29 October 2009, Zamani Zanzibar Kempinski Hotel Integrated Resistance Management in the control of disease transmitting mosquitoes Mark Hoppé Insecticide
More informationSnakebite and Spiderbite Clinical Management Guidelines Third Edition
Guidelie Miistry of Health, NSW 73 Miller Street North Sydey NSW 2060 Locked Mail Bag 961 North Sydey NSW 2059 Telephoe (02) 9391 9000 Fax (02) 9391 9101 http://www.health.sw.gov.au/policies/ Sakebite
More informationAnimal. nimals have always provided humans with food, clothing, and transportation, but today they're also
a Aimal Helpers a a! a aa a a a a aa a a a a a a o a a o a aa a t a a a a a a a a a a a a a a a a imals have always provided humas with food, clothig, ad trasportatio, but today they're also traied to
More informationPlains Leopard Frog RANA BLAIRI. Catalogueof American Amphibians and Reptiles. Rana blairi Mecham, Littlejohn, Oldham, Brown, and Brown
536.1 AMPHIBIA: ANURA: RANIDAE RANA BLAIRI Catalogueof America Amphibias ad Reptiles. Brow, L.E. 1992. Raa blairi. Raa blairi Mecham, Littlejoh, Oldham, Brow, ad Brow Plais Leopard Frog Raa blai Mecham,
More informationRESTORING VETERANS THROUGH COMPANIONSHIP THE STUDY BETWEEN RURAL AND URBAN CONTEXT ARCHITECTURE THESIS JACOB HAACK
RESTORIG VETERAS THROUGH COMPAIOSHIP THE STUDY BETWEE RURAL AD URBA COTEXT ARCHITECTURE THESIS JACOB HAACK THESIS ABSTRACT What are the benefits of a rehabilitation center located in a rural context compared
More informationAMOXICILLIN AND CLAVULANIC ACID TABLETS Draft proposal for The International Pharmacopoeia (February 2018)
February 2018 Draft for comment 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 AMOXICILLIN AND CLAVULANIC ACID TABLETS Draft
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/319/5870/1679/dc1 Supporting Online Material for Drosophila Egg-Laying Site Selection as a System to Study Simple Decision-Making Processes Chung-hui Yang, Priyanka
More informationANNEX I SUMMARY OF PRODUCT CHARACTERISTICS
ANNEX I SUMMARY OF PRODUCT CHARACTERISTICS 1 1. NAME OF THE VETERINARY MEDICINAL PRODUCT Credelio 56 mg chewable tablets for dogs (1.3 2.5 kg) Credelio 112 mg chewable tablets for dogs (>2.5 5.5 kg) Credelio
More informationFerrets. The Facts About JAN-FEB 08. animal services / rescues / shelters. Testifying for Animals Bad Cats, Bad Cats Whatcha Gonna Do?
PUBLISHED BY THE HUMANE SOCIETY OF THE UNITED STATES JAN-FEB 08 aimal services / rescues / shelters The Facts About Ferrets Testifyig for Aimals Bad Cats, Bad Cats Whatcha Goa Do? Shelter Medicie, p.53
More informationCity Unveils New Website
bulleti I f o r m a t i v e SUMMER 2013 City Uveils New Website Startig July 1, 2013, you will be able to look up your water usage history, your bill, ad pay olie. - Assistat City Maager Moica Irela cotets
More informationCENTRAL VETERINARY LABORATORY, MAFF
CENTRAL VETERINARY LABORATORY, MAFF Trial to evaluate the efficacy of Stalosan F disinfectant against coccidial oocysts o CENTRAL VETERINARY LABORATORY, MAFF REPORT TO CONTRACT, MANAGER PERIOD OF INVESTIGATION
More informationKRUUSE I. Rehabilitation Equipment KRUUSE. Rehabilitation Equipment. 3 rd Edition.
KRUUSE I Rehabilitatio Equipmet KRUUSE Rehabilitatio Equipmet 3 rd Editio KRUUSE Rehabilitatio Equipmet We are pleased to lauch the 3rd KRUUSE Rehabilitatio Equipmet catalogue cotaiig our complete rage
More informationBiology 2108 Laboratory Exercises: Variation in Natural Systems. LABORATORY 2 Evolution: Genetic Variation within Species
Biology 2108 Laboratory Exercises: Variation in Natural Systems Ed Bostick Don Davis Marcus C. Davis Joe Dirnberger Bill Ensign Ben Golden Lynelle Golden Paula Jackson Ron Matson R.C. Paul Pam Rhyne Gail
More informationExterior egg quality as affected by enrichment resources layout in furnished laying-hen cages
Open Access Asian-Australas J Anim Sci Vol. 30, No. 10:1495-1499 October 2017 https://doi.org/10.5713/ajas.16.0794 pissn 1011-2367 eissn 1976-5517 Exterior egg quality as affected by enrichment resources
More informationFELINE CORONAVIRUS (FCoV) [FIP] ANTIBODY TEST KIT
FELINE CORONAVIRUS (FCoV) [FIP] ANTIBODY TEST KIT INSTRUCTION MANUAL Sufficient for 12/120 assays 22 APR 2018 Biogal Galed Laboratories Acs Ltd. tel: 972-4-9898605. fax: 972-4-9898690 e-mail:info@biogal.co.il
More informationEfficacy of selamectin, spinosad, and spinosad/milbemycin oxime against the KS1 Ctenocephalides felis flea strain infesting dogs
Dryden et al. Parasites & Vectors 2013, 6:80 RESEARCH Efficacy of selamectin, spinosad, and spinosad/milbemycin oxime against the KS1 Ctenocephalides felis flea strain infesting dogs Michael W Dryden 1*,
More informationlarge dog lbs REPELS AND kills ticks, fleas and mosquitoes
DO NOT USE ON CATS 81356823 108 x 34 x 120 Topical Prevention and Treatment of Ticks, Fleas, Mosquitoes, Biting Flies and Lice for Monthly Use Only on Dogs and Puppies 7 Weeks of Age and Older and Weighing
More informationTHE AMAZING ANIMAL ATLAS Dr. Nick Crumpton and Gaia Bordicchia
THE AMAZING ANIMAL ATLAS Dr. Nick Crumpto ad Gaia Bordicchia Teachers Notes: IDEAS FOR LEARNING ABOUT CLASSIFICATION: Y4: LIVING THINGS AND THEIR HABITATS Pupils should be taught to: Recogise that livig
More informationEgg Marketing in National Supermarkets: Products, Packaging, and Prices Part 3
Egg Marketing in National Supermarkets: Products, Packaging, and Prices Part 3 K. W. Koelkebeck,*,1 D. D. Bell, J. B. Carey, K. E. Anderson, and M. J. Darre *Department of Animal Sciences, University of
More informationRapid LC-MS/MS Method for the Analysis of Fipronil and Amitraz Insecticides and Associated Metabolites in Egg and Other Poultry Products
Rapid LC-MS/MS Method for the Analysis of Fipronil and Amitraz Insecticides and Associated Metabolites in Egg and Other Poultry Products Ashley Sage 1, Jianru Stahl-Zeng 2, Jason Causon 1, Mike Whitmore
More informationGliding Motility Assay for P. berghei Sporozoites
Gliding Motility Assay for P. berghei Sporozoites Important Notes: 1. For all dilutions (including antibodies and sporozoites), always make slightly more than needed. For instance, if you need 200 µl sporozoites
More informationLEARN MORE ABOUT + OUR PRODUCTS
LEARN MORE ABOUT OUR PRODUCTS AVAILABLE IN 18 LANGUAGES! www.peli.com www.pelicatalogue.com www.peli.com/webiars EUROPE U.S.A. CATALOGUE MAY 2018 WATERTIGHT PROTECTOR CASES EUROPE, MIDDLE EAST & AFRICA
More informationSTANDARD OPERATING PROCEDURE #110 MOUSE ANESTHESIA
STANDARD OPERATING PROCEDURE #110 MOUSE ANESTHESIA 1. PURPOSE This Standard Operating Procedure (SOP) describes methods for anesthetizing mice. 2. RESPONSIBILITY Principal Investigators (PIs) and their
More informationCAT SWARM OPTIMIZATION FOR SINGLE STAGE SUPPLY CHAIN DISTRIBUTION SYSTEM WITH FIXED CHARGES
CAT SWARM OPTIMIZATION FOR SINGLE STAGE SUPPLY CHAIN DISTRIBUTION SYSTEM WITH FIXED CHARGES P. Maiara 1 ad V. Selladurai 2 1 Departet of Mechaical Egieerig, Kaaraj College of Egieerig ad Techology, Idia
More informationKRUUSE I. Rehabilitation Equipment KRUUSE. Rehabilitation Equipment. 4 th Edition.
KRUUSE I Rehabilitatio Equipmet KRUUSE Rehabilitatio Equipmet 4 th Editio KRUUSE I Rehabilitatio Equipmet Cotet Page KRUUSE Rehab Dog Blakets... 4 KRUUSE Rehab Joit Protectors... 6 KRUUSE Rehab Weight
More informationF l e a s. Health Department of We s t e rn Australia. adult flea egg pupa. larva
P E S T S F l e a s adult flea egg pupa larva Health Department of We s t e rn Australia F l e a s P E S T S Fleas are readily controlled provided you take a few simple steps. The majority of fleas found
More informationTopical prevention and treatment of ticks, fleas, mosquitoes, biting flies and lice for monthly use on dogs and puppies 7 weeks of age and older
BAYER HEALTHCARE LLC Animal Health Division P.O. BOX 390, SHAWNEE MISSION, KS, 66201-0390 Customer Service Tel.: 800-633-3796 Customer Service Fax: 800-344-4219 Website: www.bayer-ah.com Every effort has
More informationMedical Genetics and Diagnosis Lab #3. Gel electrophoresis
Medical Genetics and Diagnosis Lab #3 Gel electrophoresis Background Information Gel electrophoresis is the standard lab procedure for separating DNA by size (e.g. length in base pairs) for visualization
More informationlarge dog 5-way protection against: fleas/ticks/biting flies/mosquitoes/lice WARNING pack flea & tick protection KEEP OUT OF REACH OF CHILDREN
from the makers of 5-way protection against: fleas/ticks/biting flies/mosquitoes/lice Topical prevention and treatment of fleas, ticks, mosquitoes, biting flies, and lice for monthly use only on dogs and
More informationTotal Sheep and Lamb Inventory Down 5 Percent
Washington, D.C. Sheep and Goats Released January 31, 2003, by the National Agricultural Statistics Service (NASS),, U.S. Department of Agriculture. For information on "" call Scott Hollis at 202-720-4751,
More informationA solution for current veterinary challenges
A solution for current veterinary challenges 2 www.jakmarketing.co.uk Introduction The current disease challenge in veterinary practices is increasingly coming from pathogens that are resistant to both
More informationEvaluation of a repellent spot on for dog
AB7 INDUSTRIES VETERINAIRES BP 9 Contacts: Laboratory of Entomology x.martini@ab7-industries.fr 31 450 Deyme, FRANCE. Manager: Jean-Pierre Lautier: jp.lautier@ab7-industries.fr 17 th December 2009 5 pages
More informationHow to load and run an Agarose gel PSR
How to load and run an Agarose gel PSR Agarose gel electrophoresis is the most effective way of separating DNA fragments of varying sizes ranging from100 bp to 25 kb. This protocol divided into three stages:
More informationApplication of Peristaltic Filling for Flexibility and Accuracy
E03 - Aseptic Processing Technology 2008 Case Study: Application of Peristaltic Filling for Flexibility and Accuracy by Ted Kemnitz Automated Machine Technologies, Inc. AMT (919) 361 0121 Ted.Kemnitz@AMTLiquidFilling.com
More informationSENSITIVE AND -RESISTANT TUBERCLE BACILLI IN LIQUID MEDIUM SENSITIVITY TESTS
Thorax (195), 5, 162. THE BEHAVIOUR OF MIXTURES OF STREPTOMYCIN- SENSITIVE AND -RESISTANT TUBERCLE BACILLI IN LIQUID MEDIUM SENSITIVITY TESTS BY D. A. MITCHISON* From the Department of Bacteriology, Postgraduate
More informationSAMPLE NOT FOR SALE 8 Weeks and Older and 9 lbs. and Under 1 Pack x 20 x 145
8 Weeks and Older 79836945 78 x 20 x 45 9 lbs. and Under recycled paper Imidacloprid... 9. % Other Ingredients... 90.9 % Total... 00.0 % One 0.04 fl oz (0.4 ml) Tube KEEP OUT OF REACH OF CHILDREN See back
More informationRESISTANCE RISK ASSESSMENT IN FIELD-COLLECTED STRAINS OF THE GERMAN COCKROACH (DICTYOPTERA: BLATTELLIDAE) TO FIPRONIL AND INDOXACARB BAITS
307 Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East
More informationStudying Mechanisms of Inheritance using Drosophila melanogaster
Revised Fall 2018 Studying Mechanisms of Inheritance using Drosophila melanogaster Learning Objectives: 1. Describe the life cycle of Drospohilia. 2. Explain why the fruit fly is an ideal model organism
More informationmedium dog 5-way protection 3 pack medium dog WARNING medium dog flea & tick protection KEEP OUT OF REACH OF CHILDREN pack lbs DO NOT USE ON CATS
Seite 1: Layout aussen Seite 2: Layout innen Seite 3: Lack und Prägung against: fleas/ticks/biting flies/mosquitoes/lice flea & tick protection DO NOT USE ON CATS pack 3 81946450 108 x 34 x 120 11556-133_DefenseCare
More informationComplete Solutions for BROILER BREEDERS
Complete Solutions for BROILER BREEDERS Global Presence Local Commitment Feeding Drinking Climate Housing Complete Broiler Breeder Packages Broiler-Breeders We at Plasson are aware that the main goal in
More informationQuad Plate User s Manual
A part of Eurofins DQCI SSGN - SSGNC Mastitis Culture Quad Plate User s Manual Eurofins Microbiology Laboratories / Eurofins DQCI Services 5205 Quincy Street, Mounds View, MN 55112 P: 763-785-0485 F: 763-785-0584
More informationIntegration of Embryonic Zebrafish and Passive Sampling Device Extracts to Explore Mixture Toxicity
Integration of Embryonic Zebrafish and Passive Sampling Device Extracts to Explore Mixture Toxicity Margaret M. Corvi 1 R.L. Tanguay 2 K. A. Anderson 2 1 BioResource Research 2 Environmental and Molecular
More informationb Bayer Animal Health
M. W. Dryden, P. A. Payne, V. Smith, and J. Hostetler Evaluation of an Imidacloprid (8.8% w/w) Permethrin (44.0% w/w) Topical Spot-On and a Fipronil (9.8% w/w) (S )-Methoprene (8.8% w/w) Topical Spot-On
More informationextra large dog 5-way protection 3 pack extra large dog WARNING extra large dog flea & tick protection over 55 lbs KEEP OUT OF REACH OF CHILDREN pack
Seite 1: Layout aussen Seite 2: Layout innen Seite 3: Lack und Prägung against: fleas/ticks/biting flies/mosquitoes/lice flea & tick protection DO NOT USE ON CATS pack 3 81946760 108 x 34 x 120 11556-134_DefenseCare
More information