of Entomology, University of California, Riverside, Riverside, CA 92521, USA of Hertfordshire, Hertfortshire AL109AB, United Kingdom

Transcription

1 Parasitol Res () (Suppl ):S S DOI./s--- Ectopar asites Susceptibility of Adult Cat Fleas (Siphoaptera: Pulicidae) to Isecticides ad Status of Isecticide Resistace Mutatios at the Rdl ad Kockdow Resistace Loci Michael K. Rust (*), Richard Vetter, Ia Deholm, Byro Blagbur, Marti S. Williamso, Steve Kopp, Gle Colema, Joe Hostetler, Wedell Davis, Norbert Mecke, Robert Rees9, Sabria Foit, Claudia Böhm ad Kathri Tetzer Departmet of Etomology, Uiversity of Califoria, Riverside, Riverside, CA 9, USA of Hertfordshire, Hertfortshire AL9AB, Uited Kigdom Aubur Uiversity, Aubur, AL 9, USA Rothamsted Research, Harpede, ALJQ, Uited Kigdom School of Veteriary Medicie, Uiversity of Queeslad, Gatto, QLD, Australia Bayer Health Care, Aimal Health, Shawee Missio, KS, USA Bayer Aimal Health GmbH, Leverkuse, Germay 9 Bayer Health Care, Pymble, NSW, Australia Uiversity Correspodig author: Michael K. Rust * michael.rust@ucr.edu Abstract The susceptibility of field-collected isolates ad laboratory strais of fleas, Cteocephalides felis was determied by topical appliio of some of the isecticides used as o-aimal therapies to cotrol them. I the tested field-collected flea isolates the LD values for fiproil ad imidacloprid raged from.9 to. g/flea ad. to.9 g/ flea, respectively, ad were cosistet with baselie figures published previously. The extet of variatio i respose to four pyrethroid isecticides differed betwee compouds with the LD values for deltamethri ragig from. to. g/ flea, etofeprox ragig from. to. g/flea, permethri ragig from. to. g/flea, ad d-pheothri ragig from. to g/flea. A compariso with earlier data for permethri ad deltamethri implied a level of pyrethroid resistace i all isolates ad strais. LD values for tetrachlorviphos raged from. to. g/flea. The rdl mutatio (coferrig target-site resistace S

2 Ectopar asites to cyclodiee isecticides) was preset i most field-collected ad laboratory strais, but had o discerible effect o resposes to fiproil, which acts o the same receptor protei as cyclodiees. The kdr ad skdr mutatios coferrig target-site resistace to pyrethroids but segregated i oppositio to oe aother, precludig the formatio of geotypes homozygous for both mutatios. Itroductio The developmet of resistace by pest orgaisms poses a costat threat to the performace of oaimal applied isecticides registered as veteriary medicial products. Moitorig for chages i respose requires access to sesitive bioassays appropriate to the chemicals ad species uder cosideratio. For example, to provide scietifically soud data o resposes of the flea (Cteocephalides felis) to the isecticide imidacloprid, a larval bioassay was developed ad evaluated, ad field-collected isolates from three cotiets have bee tested sice (Blagbur et al. ; Rust et al.,, ). Over the last years, there have bee a umber of reports of isecticide resistace i the C. felis. Bossard et al. (99) provided a extesive review of resistace studies with adult fleas, most studies reportig o oly a sigle flea isolate ad some studies lackig comparisos with susceptible referece strais. May studies utilized a brief cotact exposure test o filter paper followig the recommeded WHO method (WHO 9), but subsequet studies icluded substrates such as ylo carpet ad glass for the bioassays (Bossard et al. ). However, the activity of the isecticide varied greatly depedig o the method used to test for resistace. A larval bioassay with imidacloprid ad fiproil has provided cosistet results (Rust et al., ), ad topical appliio of isecticides o the cuticle of adult fleas, which eables the testig of idividual fleas, has also provided S reliable levels of sesitivity (Moyses 99). Topical appliio bioassays of isecticides to idividuals of a sigle flea strai were reported by Moyses ad Gfellar (). The objective of this study was to re-examie the susceptibility of field-collected isolates of fleas to some of the isecticides ow commoly beig used to cotrol them o pets usig a topical appliio bioassay. We compare our results with those previously reported ad discuss the possible future impliios for cotrol. We also report o the occurrece of mutatios kow to cofer target-site resistace to cyclodiee ad pyrethroid isecticides. Materials ad Methods Origi of Field Isolates ad Laboratory Strais The field-derived isolates used for this study were collected betwee ad by veteriary cliics throughout Australia, Europe, ad the Uited States (Table ). Cats or dogs were placed i cages for a period of to h to obtai flea eggs. A sheet of paper was placed beeath the floor walks i each cage. At the ed of the collectio period, the aimals were brushed or combed getly to remove hair coat debris, icludig ay remaiig flea eggs. Flea eggs ad hair coat debris were the passed through a sieve ad fuel ad collected i a glass tube. The glass tube was packaged i a Styrofoam cooler cotaiig several layers of isulatio, moisteed gauze pads, ad ice packs to promote safe shipmet. A questioaire was provided to all participatig cliics; iformatio requested icluded household ad pet iformatio, such as the umber pets o the premises, use of evirometal ad o-aimal flea cotrol products, level of flea ifestatio, ad whether fleas were a recurrig or first-time problem (Blagbur et al. ). The flea eggs were shipped overight from the cliics to laboratories i Australia, Germay ad the USA, ad placed i rearig medium the followig

3 Ectopar asites Table Iformatio regardig the field-collected isolates ad the laboratory strais tested Locality Collectio date a Cat or dog Aubur Soquel, CA 9 () Ukow KS Mahatta, KS 99 () Ukow Moheim Haover, Germay 99 () Ukow Strai/isolate Previous Treatmets Palo Alto, CA 9 Ukow FI Brisbae, Australia 9 dog Ukow FI New Orleas, LA // dog Frotlie Plus FI Queeslad, Australia // dog several ukow Frotlie Combo, Frotlie Plus Jefferso City, MO // FI Birmigham, AL // Capstar Charlesto, SC //9 dog Frotlie Jacksoville, FL // Ukow FI Rochester, NY //9 oe Aubur, AL dog uspecified fiproil FI Jacksoville, FL //9 Advatage Multi FI Mout Dora, FL //9 dog Advatage FI Housto, TX /9/9 oe a Date i paretheses is the date whe the lab strai was received at. day. Isolates ot iitially established at Uiversity of Califoria Riverside () were subsequetly trasferred to where the bioassays reported here were coducted. Sice there has ever bee a uiversally-adopted susceptible strai of C. felis used for isecticide testig, the study also icluded four strais that have bee used as log-stadig referece strais i differet laboratories (Table ). The Aubur strai was origially collected i 9 ad established at i. The KS (Kasas ) strai was started from fleas collected from s ad dogs at a aimal shelter i Mahatta, Kasas i 99 ad was trasferred to i. The Moheim strai as origially obtaied from the veteriary school i Haover, Germay i 99. It was subsequetly maitaied by Bayer Aimal Health at Moheim ad was set to i. The strai was origially obtaied from Staford Research Istitute i Palo Alto, Califoria i 9. Noe of these four strais had bee exposed to isecticides durig their history of laboratory culture. Maiteace of Flea Isolates Laboratory isolates of fleas were maitaied o idividual s accordig to a procedure modified from Metzger ad Rust (99). The s were housed i double cages stacked o top of oe aother to help prevet cross cotamiatio of the isolates. Three differet rooms were used whe possible, to maitai the s ad isolates. Cats with differet isolates were ot exercised together. The s were maitaied uder a protocol approved by the UC Riverside Istitutioal Aimal Care ad Use Committee. Flea eggs were collected from trays udereath the s, supportig each field-collected or laboratory isolate. The eggs ad debris were passed through a series of four sieves (,,, ad mesh) with the eggs beig retaied o the mesh scree. The eggs were placed o a larval flea rearig medium ( part utritive medium [. dried beef blood (America s Laboratories, # NK SD Hemoglobi Powder, Omaha, NE] to. groud dog chow by weight to. iactive baker s yeast [Red Star Bio Products -Nuttrex, Milwaukee, WI] to S9

4 Ectopar asites three parts mesh silica sad by volume) ad held at % RH ad ± C. Larvae completed developmet withi d ad the cocoos ad larval medium were passed through a mesh sieve to separate cocoos. Adults emerged about to d after egg collectio. To maitai the isolates o each, about male ad female adult fleas were placed o each every wks. Typically, to geeratios of rearig were required before sufficiet umbers of adult fleas were preset for testig. Topical appliio bioassays Topical appliios of acetoe solutios of the followig techical grade isecticides were applied to adult fleas: deltamethri (9. %, AccuStadard New Have, CT), d-pheothri (9. %, MGK Co., Mieapolis, MN), etofeprox (9. %, Pestaal Sigma-Aldrich, St. Louis, MO), fiproil (9. %, Pestaal D-9 Seelze), imidacloprid (9. % Bayer Aimal Health GmbH, Moheim, Germay), permethri (9. % MGK Co., Mieapolis, MN) ad tetrachlorviphos (99. % Chem Service, West Chester, PA). Droplets (. μl) were deposited o the cuticle of adult fleas usig a gauge eedle o a glass tuberculi syrige (Becto, Dickiso ad Co., Rutherford, NJ). The tip of the eedle was removed so that the opeig was level istead of tapered as is commo with hypodermic eedles. This allowed solvet to bead up at the ed of the syrige. Precise appliio was made with a Isco Model M Microapplior (Istrumetatio Specialties, Seward, NE). Acetoe aloe was used as a cotrol treatmet. Adult fleas were tested whe they were to d from the egg collectio date. They were poured ito test tubes (9 mm x mm diam.), about to fleas per test tube by ivertig the rearig jar ad pourig them dow the glass fuel, ad the placed i a refrigerator at C. Fleas were immobile after mi whe the first test tube was removed ad fleas poured ito a plastic Petri dish ( mm diam x mm depth) sittig o a chill plate (#9, S Bioquip, Racho Domiguez, CA) ad covered with the plastic Petri dish lid. Coverig the Petri dishes was importat because despite the chillig, some fleas retaied eough mobility to kick ad propel themselves out of the Petri dish. The chillig table was maitaied at aroud -. C. Test tubes were removed from the refrigerator as eeded. We detected o detrimetal effect of additioal refrigeratio o survival of the later-dosed fleas. A small droplet of test solutio was iitially forced out of the syrige to esure flow; despite the small aperture of the syrige opeig, some evaporatio occurred iside the eedle shaft betwee trials. After the test droplet was forced out ad wiped off with a Kimwipe tissue, a secod droplet was forced out. A immobilized flea was removed from the Petri dish with fie forceps ad the flea brought to the tip of the syrige. The flea was the placed i a clea test tube. Te fleas were dosed ad placed per test tube after which a strip of filter paper (Whatma #, approximately mm wide by 9 mm log, tapered at oe ed) was placed iside the test tube, tapered ed dow, to give the treated fleas a vertical substrate oto which they could crawl. The test tube was the covered with a small square of parafilm to cofie the fleas. The test tubes ad fleas were placed iside a evirometal chamber held at C ad % RH. Fleas were checked h later for survival. A flea was recorded as affected if it was either immobile at the bottom of the vial or if it could ot right itself ad crawl upward o the piece of filter paper. A series of doses was admiistered from lowest to highest cocetratio with a correspodig cotrol batch before ad after each isecticide series. All test solutios were made up fresh from a stock solutio about h before use. The stock solutios were refrigerated for storage ad allowed to reach room temperature prior to the makig of ew solutios. Bioassays were doe i three simultaeous trials such that the cotrol treatmets were applied first to three batches of fleas, followed by icreasig order of cocetratio. After applyig the highest

5 Ectopar asites dose, the syrige (glass pluger, glass body, metal eedle) was dismatled ad thoroughly cleaed with acetoe ad allowed to soak to mi i acetoe to remove isecticide. After this soakig, the syrige was reassembled, rised a few more times ad the three more batches of fleas were dosed with acetoe aloe. Typically, these later-dosed cotrols showed o discerible icrease i mortality such that the fial cleaig process was deemed successful i removig remat isecticide. However, imidacloprid proved to adhere more teaciously to the syrige tha the other compouds, leadig to higher mortality i the later cotrol cohorts. Cosequetly, after the highest dose of imidacloprid, the syrige received several additioal active risig ad was soaked i the acetoe approximately mi. This was sufficiet to reduce the later cotrol mortality to ormal levels (i.e., to %). I additio, to further decrease potetial cotamiatio, oe syrige was specifically dedied to use oly with imidacloprid. TaqMa PCR assays The TaqMa assay is a PCR method that uses short oligoucleotide probes that are dual labelled with a fluorescet reporter dye at the ed ad a quecher molecule at the ed. Amplifiio of the probe-specific product durig PCR causes cleavage of the probe, geeratig a icrease i reporter fluorescece as the reporter dye is released away from the quecher. By usig differet reporter dyes (ormally VIC ad -FAM), cleavage of two allelespecific probes ca be detected i a sigle PCR. Three separate assays were desiged that would eable geotypig for the previously reported resistace mutatios, rdl (Bass et al. a), kdr ad super-kdr (skdr, Bass et al. b). For geotype testig, DNA was extracted from adult fleas usig DNAzol reaget (Life Techologies). Idividual fleas were placed i.ml microtubes, sap-froze i liquid itroge ad groud to a powder usig tight-fittig plastic pestles (Burkard Scietific Ltd). DNAzol reaget (. ml) was added, homogeised usig the pestle ad DNA recovered by ethaol precipitatio. DNA pellets were dissolved i µl water ad.µl aliquots take for each TaqMa assay. Primer ad probe sequeces for the taqma PCR assays were desiged agaist gee sequeces flakig either: ) the rdl mutatio (AS) withi the flea GABA receptor ad coferrig target-site resistace to cyclodiees (Bass et al. a) ad ) kdr (LF) or ) super-kdr (T99V) mutatios withi the flea voltage-gated sodium chael, both of which cofer target-site resistace to pyrethroids (Bass et al. b). For each assay, forward ad reverse ulabelled primers together with VIC (wild-type allele) ad -FAM (mutat allele) labelled probes were desiged usig Primer Express software v.. (Life Techologies). The VIC ad FAM labelled probes also cotaied a o-fluorescet quecher (NFQ) ad mior groove bider (MGB) at their eds. Primer ad probe sequeces are as follows ( to ): rdl assay, forward primer = GTTTTGGCTGAATCGTAATGCTACA, reverse primer = CATGGTCAACACAGTGGTCACT, wildtype probe = VIC-TCGAGTCGCTCTCG-NFQ, mutat probe = FAM-CTCGAGTCTCTCTCG-NFQ; kdr assay, forward primer = GGTGATGTCAGCTGTATTCCTTTCT, reverse primer = ACTATATATTAAAATGTCGTTGGCATTAGC, wild-type probe = VIC-CTTACCACAAGATTACCA-NFQ, mutat probe = FAM-CTTACCACAAAATTACCA-NFQ; skdr assay, forward primer = CTTATATCCATTATGGGTCGAACGAT, reverse primer = CATTACGGCGAATATGAAGATGATAATAC, wild-type probe = VIC-CACAAACGTTAGATTAC-NFQ, mutat probe = FAM-CACAAACACTAGATTAC-NFQ. PCR assay reactios ( μl) cotaied. μl of geomic DNA, μl of SesiMix Probe kit (Biolie Reagets Ltd), M of each primer ad M of each probe. Reactios were ru o a Rotor-Gee (Corbett Research) usig temperature cyclig coditios of mi at 9 C, followed by cycles of 9 C for s ad C for s. The icrease i VIC ad FAM fluorescece was moitored i real S

6 Ectopar asites Table The miimum lethal dose of deltamethri (g/flea) required to kill adult C. felis Strai/isolate LD (9 % CL) LD9 (9 % CL) RR (isolate/ Aubur) Aubur. ±.. (..). (..) --- Moheim.9 ±. 9. (..). (. ).. ±.. (..). (9. 9). FI.9 ±.. (.9.). (. 9.). FI. ±..9 (.9 9.). (..9)..9 ±.. (.9.). (. )..9 ±.. (..) (. 9).9. ±.. (9..). (. ). FI. ±.. (..). (. ).. ±.. (..9).9 (. 9.). FI. ±..9 (..9) (. ). FI. ±.. (.9.). (. 9.). FI.9 ±.. (. 9) (ot computable) 9. Table The miimum lethal dose of etofeprox (g/flea) required to kill adult C. felis Strai/isolate LD9 (9 % CL) RR (isolate/ ). ±.. (..) ( ) --- FI. ±.. (..) 9. (. ). FI. ±.. (. 9.) ( )..9 ±.. (..) ( ).. ±.9.9 (..) (. ). FI. ±.. (..) (99. ).9. ±.. (. 9.) ( 9). FI. ±.. (. 9.) ( ). FI. ±.. (..9) (9. ). FI. ±.9. (. ) ( ).9 time by acquirig each cycle o the yellow chael ( m excitatio ad m emissio) ad gree chael ( m excitatio ad emissio) of the Rotor-Gee, respectively. To assist with assigig geotypes, the edpoit fluorescece values for the two dyes were plotted agaist each other i bivariate ster plots to give clusterig of samples i three groups correspodig to wild-type homozygotes (SS), resistace homozygotes (RR) ad the heterozygous geotype (RS). Statistical Aalyses Dose-mortality lies for each strai ad isecticide were determied usig Polo software (LeOra Software, Melo Park, CA; Robertso ad Preisler S LD (9 % CL) 99). The laboratory strai with the lowest LD was selected as the baselie referece strai for each isecticide tested. Results Bioassays with pyrethroid isecticides Of the laboratory strais maitaied at, Aubur was the most susceptible to deltamethri (Table ). The RR ratios of the field-collected isolates raged from. to 9.. The regressio lies for,, FI, ad FI had very shallow slopes (< ), requirig extremely high doses to kill 9 % of the fleas ad implyig that these isolates showed

7 Ectopar asites Table The miimum lethal dose of permethri (g/flea) required to kill adult C. felis LD (9 % CL) LD9 (9 % CL) RR (isolate/ ) a Aubur.9 ±.. (..) (9. ). KS.9 ±.. (..) (. ). Moheim. ±.. (. 9.) ( ). Strai/isolate.9 ±.. (..). (.9.) --- FI. ±.. (..9) (. ). FI.9 ±..9 (..) ( ). FI. ±. 9. (. 99.) 9 ( 9).. ±.. (. ) ( ).9 FI 9. ±.. (..) 9. (. ). 9.9 ±.. (. 9.) ( ).. ±. 9. (. 9.) 9 ( 9). FI. ±.. (. ) (9 ).9. ±.9. ( ) ( 99). FI. ±.. (..) 9 ( ). FI. ±..9 (. ) 9 ( ot computable). FI. ±.. (..) (. ). the greatest iteral heterogeeity i respose. Resposes to the o-ester pyrethroid etofeprox were more cosistet with LDs ragig oly threefold from. to. g/flea (Table ). The fieldcollected isolates ad FI had shallower slopes (< ) tha the remaider, resultig i the highest LD9s of ad g/flea, respectively. The LDs of permethri raged from. to. g/ flea, represetig a five-fold variatio i respose (Table ). The field-collected isolates, FI,, FI,, FI, ad FI had shallow slopes (< ) requirig the highest doses to kill all of the fleas. The fieldcollected isolates, FI, ad had sigifily higher LDs to d-pheothri tha did the laboratory strais Aubur, Moheim, ad, although the total rage of variatio was less tha four-fold (Table ). The regressio equatios for FI, FI,, FI, ad FI had slopes <, requirig high doses to provide 9 % kill. Bioassays with o-pyrethroid isecticides All of the strais ad isolates had similar resposes to tetrachlorviphos, except FI which showed -fold resistace at LD compared to Aubur (Table ). However, the slope of the regressio equatio was typically < for most of the strais ad isolates ad substatially higher doses were required to kill 9 % of fleas compared with Aubur. All of the strais ad isolates respoded similarly to fiproil at LD ad LD9 (Table ). The field-collected isolates FI,, ad FI had regressio slopes <. There were also very cosistet resposes to imidacloprid (Table ). As little as. g/flea killed % of the adult fleas i several field-collected isolates. Noe of the strais or isolates had a regressio slope <. Geotypig assays The isolates varied substatially i geetic compositio at the rdl locus. All of the Aubur ad isects tested were homozygous susceptible, whereas all FI ad FI isects were homozygous for the resistace allele (Table 9). All the other isolates cotaied a mixture of geotypes. The isolates also varied substatially i frequecies of the kdr ad skdr mutatios (Tables ad ). Iterestigly, for most isolates the distributio S

8 Ectopar asites Table The miimum lethal dose of d-pheothri (g/flea) required to kill adult C. felis Strai/isolate LD (9 % CL) LD9 (9 % CL) RR (isolate/ ) Aubur. ±.. (..). (. ). KS 9.9 ±. 9. (..) (9. 9). Moheim.99 ±.. (. 9.) 9 ( ).. ±.. (..). (. 9.9) --- FI. ±.. (. 9.) ( ). FI.9 ±.. (..) ( ).9 FI. ±.. (. 9.) 9 ( ).. ±.. (..) ( ).. ±.. (..9). (. ).9.99 ±. (9. ) ( 9). FI. ±. (. ) ( ).9.9 ±. (9. ) 9 (9 ). FI. ±.. (..9) (ot computable). FI. ±.. (..) ( ). FI. ±.. (..) ( ). Table The miimum lethal dose of tetrachlorviphos (g/flea) required to kill adult C. felis Strai/isolate LD (9 % CL) LD9 (9 % CL) Aubur. ±.. (..). (. 9.) --- Moheim. ±.. (..) ( 9).. ±.. (. 99.) 9 ( 9). FI 9.9 ±..9 (. 9.) (. 9.).. FI. ±. ( ) 9 ( ). ±.. (..). (. ). 9. ±.. (. ) ( ). FI 9. ±..9 (..) (. ). 9. ±.. (.9.) (. ). FI. ±.. (.9.) 9 ( ). FI. ±. 9. (..) ( ). FI.9 ±.. (..) (9 ). of geotypes for kdr was the reverse of that for skdr. Thus, seve FI isects were homozygous susceptible for kdr but oe were homozygous resistat for this mutatio. For skdr, the reverse was the case with seve beig homozygous resistat ad oe beig homozygous susceptible. Five isects were heterozygous for both mutatios. The cosistecy of this patter across isolates implies that the two mutatios i the sodium chael were segregatig i oppositio to oe aother ad that alleles cotaiig both mutatios are abset or very rare. S RR (isolate/ Aubur) Discussio The topical appliio of isecticides to the cuticle of adult C. felis provided a sesitive ad precise method of determiig the susceptibility of fleas. This method was first used for fleas by Moyses (99) ad Moyses ad Gefeller (), who provided data for a umber of isecticides agaist oe well characterised laboratory flea strai, the Daish Pest Ifestatio Laboratory (DPIL) strai. Despite some mior differeces i methodology, our results

9 Ectopar asites Table The miimum lethal dose of fiproil (g/flea) required to kill adult C. felis RR (isolate/ Aubur) Strai/isolatea LD (9 % CL) LD9 (9 % CL) Aubur. ±.9. (.9.). (..) ---- KS. ±..9 (..). (..). Moheim.9 ±.. (..). (..).. ±.. (.9.). (..99). FI. ±..9 (..).9 (.9.). FI. ±.. (..). (..). FI. ±.. (..). (..9).. ±.. (..). (..9).9.9. ±.. (..). (.9 9.). ±.. (..). (..9). FI.9 ±.. (.9.). (..9).. ±.. (..). (..9). FI. ±.. (..). (..). FI. ±.. (..). (..). FI. ±.. (..99). (..). Table The miimum lethal dose of imidacloprid (g/flea) required to kill adult C. felis Strai/isolatea LD (9 % CL) LD9 (9 % CL) RR (isolate/ KS). Aubur.9 ±.. (..). (..) KS.9 ±.. (..9). (.9.9) --- Moheim.9 ±.. (..9). (..).. ±.. (..). (.9.). FI. ±.. (..). (..). FI. ±.. (..). (.99.). FI. ±.. (..). (.9.).. ±.. (..). (.9.). FI 9. ±..9 (..). (..)..9 ±.9. (..9). (..9). FI. ±.9. (..). (..).. ±.. (..). (.9.). FI. ±.. (..). (..9). FI. ±.9. (..). (..). FI. ±.9. (..). (..). for fiproil ad imidacloprid tested agaist four laboratory referece strais ad a diverse rage of field isolates are broadly very cosistet with those obtaied with DPIL (Moyses ad Gefeller ). However, most of the field-collected isolates were sigifily less susceptible to deltamethri ad permethri compared with the DPIL strai tested i. Whe DPIL was tested agaist the orgaophosphates diazio, fethio, ad malathio, the slopes of the regressio lies were steep >. ad LD s raged from. to µg/flea (Moyses ad Gefeller ). I our study with tetrachlorviphos, the slopes were shallow < ad dosages > µg/flea required to kill % of the fleas. With the exceptio of the FI isolate (which cotaied oly skdr), all of the strais ad isolates possessed both the kdr ad skdr mutatios. Thus, S

10 Ectopar asites Table 9 Rdl geotypes of laboratory ad field-collected isolates of C. felis. isolate S/S S/R R/R Aubur FI FI FI FI FI FI FI Table Kdr geotypes of laboratory ad field-collected isolates of C. felis. isolate S/S S/R R/R Aubur FI FI FI FI FI FI FI Table Skdr geotypes of laboratory ad field-collected isolates of C. felis. isolate S/S S/R R/R Aubur FI FI FI FI FI FI FI it seems ulikely that we tested a strai or isolate that was truly susceptible to pyrethroids. The amio-acid substitutio uderpiig kdr (LF) is S thought to cofer fold resistace to a broad rage of pyrethroid molecules (Farham et al. 9) whereas that uderpiig skdr (T99V)

11 Ectopar asites may result i very high resistace ratios (Roditakis et al. ). The ubiquity of kdr ad skdr alleles i log-stadig laboratory strais as well as field-collected isolates from Australia ad the USA is surprisig, give that the former have had o exposure to pyrethroids for at least years, ad implies that they have persisted ad cofer o fitess cost o their carriers uder laboratory rearig coditios. The distributio of these mutatios across isolates shows that fully susceptible alleles (ie. oes lackig both mutatios) are ucommo. Oly the FI isolate, which was cosistetly homozygous susceptible for kdr ad cotaied heterozygotes for skdr ca be implied as possessig a completely wildtype allele, ad uder Medelia rules we assume that testig more idividuals from this isolate would disclose fleas homozygous susceptible for both mutatios. I additio, the mutatios segregate i oppositio ad we foud o evidece of a allele cotaiig both mutatios, which is a prerequisite for geeratig fleas homozygous for both kdr ad skdr. The rdl mutatio causig a coformatioal chage to the GABA-gated chloride chael is well kow to cofer sigifi, ecoomically damagig levels of resistace to a rage of cyclodiee isecticides (Ffrech-Costat 99). Cyclodiees share this target site with fiproil ad there has bee much debate over the likelihood of the rdl mutatio, selected through prior exposure to cyclodiees, coferrig cross-resistace to fiproil (Bass et al. b). It ca be cocluded from this study, ecompassig isolates i which rdl is evidetly rare (eg. Aubur) ad oes i which it appears ubiquitous (eg. FI), yet which exhibit very similar resposes to fiproil, that the extet of such cross-resistace is egligible (see also Bruet et al. 9). This of course does t preclude the appearace of ew alleles capable of substatial reductios i receptor bidig by fiproil leadig to a potet resistace pheotype (Le Goff ). The susceptibility of field-collected isolates of C. felis from Europe, Australia ad the USA to imidacloprid has bee ivestigated sice by exposig larvae to a diagostic cocetratio of isecticide i a diet-impregatio bioassay (Rust et al.,, ; Schroeder et al, ). To date, testig of over, idividuals from over isolates has disclosed o evidece for a directioal shift i respose or a declie is susceptibility (Rust et al, ; Kopp et al. ). However, it could be argued that over-reliace o a larval bioassay, despite its operatioal advatages for resistace moitorig, could disguise the emergece of a resistace pheotype expressed oly i adults. The lack of sigifi variatio i susceptibility to imidacloprid i adults through topical appliio is therefore reassurig ad vidies the desig of the ogoig resistace moitorig programme. Ackowledgemets We thak Lucio Rodriguez (Uiversity of Califoria Riverside) for rearig ad maitaiig the flea isolates. Ethical stadards The study was performed i compliace with curret atioal laws ad regulatios. Fudig The study was i part supported by a grat from Bayer Aimal Health GmbH, Germay, Coflict of iterest Norbert Mecke, Sabria Foit ad Kathri Tetzer are employed by Bayer Aimal Health GmbH. Wedell Davis was, Joe Hostedler ad Robert Rees are employed by Bayer Health Care. All other authors are employed by their respective Uiversity istitutios ad declare o coflict of iterests. S

12 Ectopar asites Refereces Bass C, Schroeder I, Turberg A, Field LM, Williamso MS (a) Idetifiio of mutatios associated with pyrethroid resistace i the para-type sodium chael of the flea, Cteocephalides felis. Isect Biochem Mol Biol : Bass C, Schroeder I, Turberg A, Field LM, Williamso MS (b) Idetifiio of the Rdl mutatio i laboratory ad field strais of the flea, Cteocephalides felis (Siphoaptera: Pulicidae). Pest Maage Sci : Blagbur BL, Dryde MW, Paye P, Rust MK, Jacobs DE, Bod R, Hutchiso MJ, Deholm I, Mehlhor H, Vaugh MB, Mecke N, Schroeder I, Hostetler J, Edrizzi M () New methods ad strategies for moitorig susceptibility of fleas to curret flea cotrol products. Vet Ther : 9 Bossard RL, Dryde MW, Broce AB () Isecticide susceptibilities of fleas (Siphoaptera: Pulicidae) from several regios of the Uited States. J Med Etomol 9: Bossard RL, Hikle NC, Rust MK (99) Review of isecticide resistace i fleas (Siphoaptera: Pulicidae). J Med Etomol : Bruet S, Le Meter C, Murray M, Soll M, Audoet J-C (9) Rdl gee polymorphism ad sequece aalysis ad relatio to i vivo fiproil susceptibility i strais of the flea. J Eco Etomol : Farham AW, Murray AWA, Sawicki RM, Deholm I, White JC (9) Characterisatio of the structure-activity relatioship of kdr ad two variats of super-kdr to pyrethroids i the housefly (Musca domestica L.). Pestic Sci 9: 9. Ffrech-Costat RH (99) The molecular ad populatio geetics of cyclodiee isecticide resistace. Isect Biochem Molec Biol : Kopp S, Blagbur B, Colema G, Davis W, Deholm I, Field C, Hostetler J, Mecke N, Rees R, Rust M, Schroeder I, Tetzer K, Williamso M () Moitorig field susceptibility to imidacloprid i the flea: a world-first iitiative twelve years o. Parasitol Res :S S Le Goff G, Hamo A, Berge J-B, Amichot, M () Resistace to fiproil i Drosophila simulas: ifluece of two poit mutatios i the RDL GABA receptor subuit. J Neurochem 9: 9 S Metzger ME, Rust MK (99) Egg productio ad emergece of adult fleas (Siphoaptera: Pulicidae) exposed to differet photoperiods. J Med Etomol : Moyses EW (99) Measuremet of isecticide resistace i adult flea, pp.. I R.W. Meola [ed.], Proceedigs of the Third Iteratioal Symposium o Ectoparasites of Pets, April 99, College Statio, TX. Texas A&M Uiversity, College Statio, TX Moyses EW, Gfeller FJ () Topical appliio as a method for comparig the effectiveess of isecticides agaist flea (Siphoaptera: Pulicidae). J. Med Etomol :9 9 Robertso J L, Preisier HK (99) Pesticide Bioassays with Arthropods. Boca Rato, FL, CRC Press Roditakis E, Tsagkarakou A, Votas J () Idetifiio of mutatios i the para sodium chael of Bemisia tabaci from Crete, associated with resistace to pyrethroids. Pestic Biochem Physiol : Rust MK, Deholm I, Dryde MW, Paye P, Jacobs DE, Bod R, Mecke N, Schroeder I, Westo S, Vaugh M, Colema G, Kopp S () Large-scale moitorig of imidacloprid susceptibility i the flea, Cteoceophalides felis. Med Vet Etomol : Rust MK, Deholm I, Dryde MW, Paye P, Williamso M, Blagbur B, Jacobs DE, Mecke N, Schroeder I, Vaugh MB, Mehlhor M, Hikle NC () Determiig a diagostic dose for imidacloprid susceptibility testig of field collected isolates of fleas (Siphoaptera: Pulicidae). J Med Etomol : Rust MK, Waggoer M, Hikle NC, Mecke N, Hase O, Vaugh M, Dryde MW, Paye P, Blagbur BL, Jacobs DE, Bach T, Bledsoe D, Hopkis T, Mehlhor H, Deholm I () Developmet of a larval bioassay for susceptibility of fleas (Siphoaptera: Pulicidae) to imidacloprid. J Med. Etomol 9: Schroeder I, Blagbur BL, Bledsoe DL, Bod R, Deholm I, Dryde MW, Jacobs DE, Mehlhor H, Mecke N, Paye P, Rust, MK, Vaugh MB () Progress of the iteratioal work of the Imidacloprid flea susceptibility moitorig team. Parsitol Res 9:S S. WHO (9) Isecticide resistace ad vector cotrol. Wld Hlth Org Tech Ser No..