International Journal of Veterinary Science

Transcription

1 Research Article P-ISSN: ; E-ISSN: International Journal of Veterinary Science Maternal Phylogeny of Anatolıan Cats Nüket Bilgen*, Mustafa Yenal Akkurt, Özge Şebnem Çıldır, Okan Ertuğrul and Bengi Çınar Kul Ankara University, Faculty of Veterinary Medicine, Department of Genetics, Ankara, Turkey *Corresponding author: Article History: Received: November 09, 2017 Revised: November 11, 2017 Accepted: November 20, 2017 ABSTRACT Anatolia is considered the cradle of domestication for many animal species, including cats. Unlike agricultural (cattle, sheep, pig) or carrying animals (horse, donkey), cats are commensal-domesticated due to their feeding habits on rodents, which invade farm grain storage. Earliest archaeological evidence of the domestication of cats was found in Cyprus, from a period of 9,500 4,000 years ago. Despite the fact that cats are an important species, there is a lack of molecular evidence to elucidate the history of the Angora and Van cats. To shed light on domestic cat breeds of Anatolia, we investigated the Cytochrome b gene (Cytb) and control regions (CR or D loop) on mtdna by PCR and Sanger sequencing of Angora (n=29), Van (n=50) and stray cats (n=51). Phylogenetic analysis revealed that Felis silvestris lybica was major maternal origin whereas Van, Angora and stray cats also shared branch with Felis silvestris ornata. Network analysis and frequency calculations showed ~70% of the cats were represented by two major haplotypes, A and D for CR; Haplotype 10 and Haplotype 15 for CYTb. Unique sequences were found in 9.3% of the population (Van n=1; Angora n=3; stray cats n=8). Haplotype diversity of Cytb and CR region were determined to be 0.71 and 0.77, respectively. Shared haplotypes were high, thus FST statistics revealed low genetic differentiation between groups. Key words: Angora cat, CR, CYTb, mtdna, Van cat INTRODUCTION Domestic cats are among the popular companion animals, but little is known about their origins and taming process (Clutton-Brock, 1999; Vigne et al., 2004). Unlike livestock animals that have been used for agricultural production or transportation cats appear to be a "commensal". This relationship arose based on their feeding on rodents in farm grain repositories (Clutton- Brock, 1999) and was formed with tolerance of two species. It was known that the cats were first domesticated in the ancient Egypt around century and this was well known and accepted worldwide. However, archeological findings in Neolithic site of Chirokitia-Cyprus, which show the first co-occurrence of cat-human association and their first co-occurrence, suggest that the origin of cats was different and taming was earlier (~9500 years ago) (Vigne et al., 2004). The cat mummies and human-animal relationships that appear in grave paintings in the Egypt are interpreted as a human-animal relationship reminiscent of taming and provide resources for the follow-up of the domestication process (Kurushima et al., 2012). This archaeological evidence places the timeline for this between the years 9500 and 3600 BC and the most likely region as Central Asia (Driscoll et al., 2009). Felis silvestris which is the origin of the cats, is known as a polytypic wild species with three or more distinct subtypes, F. s. silvestris in Europe, F. s. lybica in Africa and Near East, F. s. ornata in Middle East and F. s. bieti in China (Clutton-Brock, 1999; Driscoll et al., 2009). Molecular genetic studies are frequently used in the molecular characterization of breeds or in the conservation of animal gene resources that are at risk of extinction (Toro and Caballero, 2005). These studies are generally focused on mitochondrial DNA (mtdna) genes, short tandem repeats (STR), single nucleotide polymorphisms (SNPs) and Y chromosome genes (Driscoll et al., 2009). mtdna is especially preferred in taxonomic studies of breeds and used in the follow-up of the maternal line. Angora and Van cat breeds are the Anatolian native genetic resources grown in different geographical regions in Turkey. Both have been raised worldwide and registered breeds by Cat Fanciers Association (CFA) and World Cat Federation (WCF). Even though Angora cats are known for their white fur, there are colour varieties such as black, calico and orange. Odd-eye phenotype is common for both breeds. Since the two breeds are visually very similar there is speculation that they are actually Cite This Article as: Bilgen N, MY Akkurt, ÖŞ Çıldır, O Ertuğrul and B Çınar Kul, Maternal phylogeny of anatolian cats. Inter J Vet Sci, 6(4): ( 2017 IJVS. All rights reserved) 191

2 varieties. The objective of this study was to illuminate the maternal relationship between Anatolian Cat breeds and characterize the variation within and between breeds. To this purpose a total of 130 cats were sampled and were analyzed using the sequences of the CYTb and CR regions. MATERIALS AND METHODS Cheek swap samples were collected from unrelated male and female cats phenotypically representing specific cat breeds of, Angora (n=29), Van (n=50) and Stray cats (n=51) (Ankara University Ethical Committee ). DNAs were extracted using a commercial DNA extraction kit following manufacturer s instructions (Zymo, Quick-DNATM Universal Kit, US). DNA quantities and qualities were measured then all the obtained DNAs were stored at -20 C. Previously described oligonucleotides were used in PCR (Table 1). PCRs were performed in a 25μl reaction mixture, containing 200 μm of the four dntps, 10 pmol of each primer, 1 PCR buffer, 2 IU Taq polymerase (MBI Fermentas, Vilnius, Lithuania) 50ng of genomic DNA template and 2.5 μm and 1.5 μm MgCl 2 for CYTb and CR respectively. Thermal cycle conditions were as follows: an initial denaturation step at 94 C for 4 min was followed by 35 cycles of 94 C for 30 s, annealing 61 C for 30 s, 72 C for 30 s and a final extension at 72 C for 5 min. The PCR products were purified and sequenced using a BigDye Terminator v3.1 cycle sequencing kit and an ABI 310 automatic sequencer (Applied Biosystems, Foster City, CA, USA). Amplification primers were used for sequencing, and additional primer was used for CYTb region (Table 1). Each fragment was sequenced in both directions. CYTb sequences were aligned to AB , AB , AB , AB , AB , AB , AB , KT , AY , AB , EF , KP and NC CR sequences were aligned to A-L haplotypes defined by Grahn et al., (2011) in Bioedit software (Hall, 1999). The variable nucleotide positions and determined haplotype frequencies within and between breeds were calculated by DNAsp (Librado and Rozas, 2009), MEGA 6 (Tamura et al., 2011), Arlequin (Excofier and Lischer, 1997). Network 5 (Fluxus Technology Ltd., Clare, Suffolk, UK) was used to visualize major haplotypes and the relationship between haplotypes. Also, FST (Wright, 1965) was used to estimate distances between the breeds. RESULTS Even though 130 samples were collected from Angora (n=29), Van (n=50) and stray cats (n=51). 3 DNA samples from breed cats and stray cat were not pure enough for further analysis thus the haplotype frequencies calculated for CYTb and CR regions for 127 samples. In the MJ tree, all examined cats were found to be originated from F. silvestris lybica, except 4 cats (1 and 3 individuals from Van and stray cats, respectively) were clustered in the same branch with F silvestris caffra, and 3 cats (2 and 1 individuals from Angora and stray cats, respectively) were clustered in the same branch with F silvestris ornata (Figure 1). The topology of the phylogenetic trees was similar therefore only CYTb tree was shown and trees didn t allow discriminating the breeds. Fig. 1: CYTb region HKY model, 2000 bootstrap Median Joining (MJ) Tree. Colors specified different group of cat samples: Reference sequences grey, Angora cats green, Van cats blue and Stray cats purple. Determined haplotypes was stated H in brackets. 192

3 Table 1: CR and CYTb region oligonucleotide sequences Oligonucleotide sequences (5-3 ) Amplified region Reference CYTb-F CTCACATGGAATTTAACCATGAC CYTb-F ACAGGTTGGCCACCGATTCAT 1140bp CR-F ATAGTGCTTAATCGTGC CR-R GTCCTGTGGAACAATAGG 400bp Kurushima et al., 2012 CYTb-FS* sequence TCAGACACAATAACCGCCTTT This study * This oligonucleotide is used only for sequencing. DISCUSSION Fig. 2: Network analysis result of CR region. Filled circles represent haplotypes and areas within circles are proportional to the number of individuals According to figure 3, 2 major haplotypes determined A (H1) and D (H3). Table 2: Distribution of the haplotypes determined for the CYTb region in the study groups. Haplotype Van Angora Stray Frequency (n:48) (n:28) (n:51) (n=127) H_ ,9 H_ ,7 H_ ,6 H_ ,6 H_ ,8 H_ ,6 H_ ,6 H_ ,1 H_ ,6 H_ ,8 H_ ,8 H_ ,8 H_ ,8 H_ ,8 H_ ,4 H_ ,8 H_ ,8 H_ ,8 H_ ,8 Total haplotype In 127 samples for CYTb, a total of 24 regions were polymorphic and according to these regions, 19 haplotypes were identified and haplotype diversity was calculated as 0.71 (Table 2). For CR region, a total of 29 regions were polymorphic and according to these regions, 24 haplotypes were identified and haplotype diversity was calculated as 0.77 (Table 3). For CYTb region, highest haplotype diversity was determined in Stray cats 19 (1.8%) followed by Angora and Van 15 (1.45%). The haplotypes were visualized by NETWORK 5 (Fluxus Technology Ltd., Clare, Suffolk, UK) (Figure 2 and 3). New haplotypes were found in Stray cats (n=8), followed by Angora (n=3) and Van (n=1). CR region revealed two main haplotypes A (n=52) and D (n=42) and J (n=11) haplotype, which is specific for Mediterranean region. Our aim was to investigate phylogenetic relationship between Angora, Van cat breeds and stray cats of Anatolia and to determine the maternal origin of the Anatolian cats. According to mtdna analyzes, all examined cats in this study were found to be originated from Near Eastern wildcat (F. silvestris lybica). However, when all three groups were examined within themselves, we found high haplotype diversity, which suggests multiple-maternal ancestry for the analyzed cats. Which correlates with the studies on cat phylogeny (Tamada et al., 2005; Driscoll et al., 2009; Grahn et al., 2011). However, the phylogenetic tree didn t indicate breed discrimination suggesting introgression as a result of the crossing between breeds. In the MJ tree, unlike in the current literature, it was observed that 4 cats were clustered in the same branch with F silvestris caffra, which is defined as African wild cats and 3 cats were clustered in the same branch with F silvestris ornata, which known as Asian wild cats, living in the Asian countries such as Kazakhstan, Mongolia and the desserts of India. Due to the lack of genetic information on CR region reference sequences for F silvestris caffra and F silvestris ornata comparison was not possible however except for one individual from Van cat population from the same branch with F silvestris caffra others shared the same branch with F silvestris bieti which are considered as subtypes of F silvestris ornata (Driscoll et al., 2007). In concordance with this information the main branch group evaluated as F silvestris ornata. According to sequence data of CR region the one individual from Van cat population included in F silvestris lybica. Despite the lowest sample size, Angora cats resulted with high haplotype and nucleotide diversity, supporting multiple-maternal origin suggestion whereas Van cats results showed inbreeding. Masuda and Yoshida (1994) analyzed CYTb between bp and determined 91 informative of 123 variations. But CYTb region is located between 15038bç-16177bp (Lopez et al., 1996). Which shows that Masuda and Yoshida, (1994) analyzed a small portion of CYTb. Tamada et al. (2005) investigated 50 domestic cats and 8 leopards from Tsushima Island and reported polymorphic regions on CYTb is 1.67%. They determined 6 different haplotypes and submit the sequences to the gene bank database however we didn t identify any of their A-F haplotypes in our study as expected. Highest haplotype diversity was determined on CR region in Stray cats, which suggests that high individual number and uncontrolled mating of these cats. Similarly, Tarditi et al. (2011) determined high nucleotide diversity and unique haplotypes in the Stray cats of Texas. Also, Tarditi et al. (2011) suggested determination of two close major haplotypes in Network analysis as a sign of main common ancestor which our data also supports this suggestion. 193

4 Fig. 3: Network analysis result of CYTb region. Filled circles represent haplotypes and areas within circles are proportional to the number of individuals According to figure 4, 2 major haplotypes determined H10 (H1) and H2 (H15). Table 3: Distribution of the haplotypes determined for the CR region in the study groups. This study Grahn et al. (2011) Haplotype Van (n:49) Angora (n:28) Stray (n:50) Frequency (n=127) Van (n:16) Angora (n:15) Stray* (n=56) Frequency (n= 87) A , ,4 A ,3 A , ,3 A6b ,4 B , ,7 C ,1 D , ,3 D ,1 D ,1 D , ,0 D , ,3 E - 1-0, ,0 F , ,5 G , H , J , ,3 L ,1 OL , ,3 New , New , New , New , New , New , New , New , New , New , New , New , Total *Grahn et al. (2011) determined 3 New Haplotype in Stray cats but because authors didn t share the DNA sequence of the gene regions frequencies lower than 1% thus they are not added to the table. Grahn et al. (2011) determined a total of 12 (A-L) haplotype CR region with frequency higher than 1% and they argued that these haplotypes could be grouped into two main haplotypes, A and D, because the other haplotypes separated by three or fewer base pairs from these main groups. When the haplotype distribution and new haplotypes investigated in the current study, highest diversity and new haplotypes found in Stray cats (n=8), followed by Angora (n=3) and Van (n=1). CR region revealed two main haplotypes A (n=52) and D (n=42) and J (n=11) haplotype, which is specific for Mediterranean region. Strikingly we determined high J haplotype distribution in Van Cats, which are bred in east of Turkey. According to the mtdna haplotype findings, it is not possible to separate pure cat breeds except Maine Coon (C- CR region) (Grahn et al., 2011). To discriminate populations by mtdna results should be combined with genomic DNA data. Eroglu et al. (2015) studied a total of 96 individuals to investigate the genetic structures via 10 STR loci. Among these cats, the genetic diversity was found higher in Van and Angora but cats were clustered in the same branch in the phylogenetic tree. They argued that the accumulation in the same branch was due to the low number of studied samples. But Lipinski et al. (2008) studied 32 STR and despite the low number of individuals, successfully discriminate Angora and Van cats. Therefore, we argue that not only sampling size but also high number of STR loci is needed for breed discrimination. Besides, Driscoll et al. (2007) analyzed NAD5, NAD6, small proportion (200bp) of CYTb on mtdna and 32 STRs and stated F. s. silvestris as the origin of Angora and Van cats, F.s. lybica as the origin of Near Eastern cats also Near East as the cat domestication center. Although the CYTb analysis is insufficient to support a comparison 194

5 to their study, but our data strongly support their result on Near East being the center of cat domestication. Conclusion This study showed that Anatolian cats originated from two major lines of F. s. lybica. We observed multiple maternal origins, supported by the high variety of haplotypes. It was not possible to distinguish between Angora, Van and the stray cats based on CYTb and CR regions for this the mtdna data would need be supported by genomic DNA. Due to the decreasing number in population and levels of breed purity, we recommend that it is urgent to form a breeding program for both cat breeds in order to maintain high diversity and that pet owners and breeders should be informed on alternative ways for sterilization. Acknowledgements The Scientific and Technological Research Council of Turkey (TUBITAK) supported this study with the grant number 114O768. Authors would like to thank to Martin Krzywinski for English editing, to cat owners and veterinary clinics, contributing samples to our study. REFERENCES Clutton-Brock J, A natural history of domesticated mammals. Cambridge University Press (CUP), pp:133 Driscoll CA, D Macdonald and SJ O'Brien, From wild animals to domestic pets, an evolutionary view of domestication. Proc Natl Acad Sci USA, 106 (Supplement 1): Driscoll CA, M Menotti-Raymond, AL Roca, K Hupe, WE Johnson, E Geffen and N Yamaguchi, The Near Eastern origin of cat domestication. Science, 317: Eroğlu T, Y Ozsensoy, E Kurar, V Altunok, M Nizamlıoğlu and M Yüksek, Genetic characterization of various cat breeds in Turkey by using microsatellites. J Cell Mol Bio, 13: Excoffier L and HL Lischer, Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows. Mol Ecol Resour, 10: Grahn RA, JD Kurushima, NC Billings, JC Grahn, JL Halverson, E Hammer, CK Ho, TJ Kun, JK Levy, MJ Lipinski, JM Mwenda, H Ozpinar, RK Schuster, SJ Shoorijeh, CR Tarditi, NE Waly, EJ Wictum and LA Lyons, Feline non-repetitive mitochondrial DNA control region database for forensic evidence. Forensic Sci Int Genet Suppl Ser, 5: Hall T, Bio Edit: Biological sequence alignment editor for Win95/98/NT/2K/XP. Kurushima JD, S Ikram, J Knudsen, E Bleiberg, RA Grahn and LA Lyons, Cats of the pharaohs: genetic comparison of Egyptian cat mummies to their feline contemporaries. J Archaeol Sci, 39: Librado P and J Rozas, DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics, 25: Lipinski MJ, L Froenicke, KC Baysac, NC Billings, CM Leutenegger, AM Levy and NC Pedersen, The ascent of cat breeds: genetic evaluations of breeds and worldwide random-bred populations. Genomics, 91: Lopez JV, S Cevario, SJ O'Brien, Complete nucleotide sequences of the domestic cat (Felis catus) mitochondrial genome and a transposed mtdna tandem repeat (Numt) in the nuclear genome. Genomics, 33: Masuda R and MC Yoshida, A molecular phylogeny of the family Mustelidae (Mammalia, Carnivora), based on comparison of mitochondrial cytochrome b nucleotide sequences. Zool Sci, 11: Tamada T, N Kurose and R Masuda, Genetic diversity in domestic cats Felis catus of the Tsushima Islands, based on mitochondrial DNA cytochrome b and control region nucleotide sequences. Zool Sci, 22: Tamura K, G Stecher, D Peterson, A Filipski and S Kumar, MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol, 30: Tarditi CR, RA Grahn, JJ Evans, JD Kurushima and LA Lyons, Mitochondrial DNA sequencing of cat hair: an informative forensic tool. J Forensic Sci, 56(S1):36-46 Toro M and A Caballero, Characterization and conservation of genetic diversity in subdivided populations. Philos Trans R Soc Lond B Biol Sci. 360(1459): Vigne JD, J Guilaine, K Debue, L Haye and P Gérard, Early taming of the cat in Cyprus. Science, 304: Wright S, The interpretation of population structure by F-statistics with special regard to systems of mating. Evolution, 19: