Colonisation, diversificationand extinctionof birds in Macaronesia

Transcription

1 Colonisation, diversificationand extinctionof birds in Macaronesia Juan Carlos Illera Research Unit of Biodiversity (UO-PA-CSIC) /

2 MACARONESIA Azores (0-8 My) Madeira (0-14 My) Selvagens (24 My) Canary Islands (1-22 My) Cape Verde (6-25 My) 668 km

3

4 Colonisation: When? From where????

5 Colonisation and diversification 1) Mitochondrial DNA (maternal inheritance) 1. Phylogeny (among species) 2. Phylogeography (within species) 2) Nuclear DNA (maternal and paternal) 1. Population genetics (genetic structure, gene flow) 2. Phylogeography (origin, dispersal) Flanking region Short tandem repeats (CAC) Flanking region AGTCCTGGCCTGAACACCACCACCACCACCACCACCACCACCCTTAACTGGTAA TCAGGACCGGACTTGTGGTGGTGGTGGTGGTGGTGGTGGTGGGAATTGACCATT

6 3) Next-generation sequencing Colonisation and diversification

7 Origin and diversification of island biota a) A small group of individuals arrive B C A D

8 Colonisation: How? When? From where? F. c. moreletii? Fringilla coelebs F. c. maderensis F. c. palmae F. c. ombriosa F. c. canariensis Marshall & Baker, Mol.Phy.Evol.

9 Fringilla coelebs Rando et al PloS ONE.

10 Character displacement among finches Carduelis aurelioi Rando et al PloS ONE

11 Character displacement among finches Carduelis aurelioi A beak size comparison among the blue chaffinch (F. teydea), the common chaffinch (F. coelebs) and the extinct slender-billed greenfinch (C. aurelioi) Rando et al PloS ONE

12 Colonisation: How? When? From where? Madeira Anthus berthelotii Selvagens? Canary Islands a) mtadnmt: one haplotipe CR & four with cyt-b b) Microsatellites and MHC: Significant genetic structure among archipelagos Illera et al., Mol. Ecol. Spurgin et al., 2011; Mol. Ecol.

13 Colonisation: How? When? From where? Madeira Anthus berthelotii Selvagens? Canary Islands c) Founder effects are responsible for both genetic and phenotypic changes across archipelagos Spurgin et al., Mol. Ecol.

14 Origin and diversification of island biota b) Multiple invasion waves A B A D A F

15 Colonisation: How? When? From where? 0.7 My (R. r. azoricus/inermis) Regulus regulus (R. Madeirensis) 1.8 My (R. r. Ellenthalerae) 2 My (R. r. Teneriffae) Regulus regulus teneriffae Päckert et al., J.Avian Biology

16 Origin and diversification of island biota c) Diversification due to vicariance Brown et al., Mol. Ecol. A A A Milá et al., BMC Evol. Biol. B C B C

17 Origin and diversification of island biota d) Diversification in sympatry A B A

18 Diversification by allochrony Breeding areas of Oceanodroma castro/monteiroi (circles) 1) Allochronic populations genetically structured 2) Allochrony in four archipelagos Friesen V. L. et.al. (2007). PNAS

19 Complex colonisation: How? When? From where? Distibution genus Cyanistes C. caeruleus C. cyanus C. teneriffae Illera et al.,

20 Complex colonisation: How? When? From where? Stervander et al., Mol.Ecol.

21 Complex colonisation: How? When? From where? 1st wave ( my) Spit of cyanus-caeruleus ( my) 2nd wave ( my) 3rd wave (0.27 my) Stervander et al., Mol.Ecol.

22 Colonisation: When? a) Recent colonisation ( My) b) Recent lineages in relation to reptils c) Significant diference in relation to similar archipelagos Mammals Birds My Skinks Geckos My Lizards

23 Conclusions 1) Recent colonisation of extant lineages 2) Complex evolutionary histories 3) Lower diversification than other archipelagos

24 Extinction of birds in Macaronesia Conclusions Ok, but is that all?

25 Extinction of birds in Macaronesia Emberiza alcoveri Ratites Coturnix gomerae Carduelis aurelioi

26 Extinction of birds in Macaronesia Extinction dates of macaronesian birds estimated with radiocarbon and historical records plotted in relation with human occupation of the archipelagos Illera et al., Quaternary Science Reviews

27 Extinction of birds in Macaronesia Puffinus olsoni 0,6-0,4 m.a. Puffinus puffinus Ramírez et al., PLoS ONE

28 Extinction of birds in Macaronesia

29 Acknowledgements Postdoctoral research associated positions JuandelaCiervaandRamónyCajalfellowships Mercibeaucoup!!