Colonisation, diversificationand extinctionof birds in Macaronesia

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Colonisation, diversificationand extinctionof birds in Macaronesia"

Transcription

1 Colonisation, diversificationand extinctionof birds in Macaronesia Juan Carlos Illera Research Unit of Biodiversity (UO-PA-CSIC) /

2 MACARONESIA Azores (0-8 My) Madeira (0-14 My) Selvagens (24 My) Canary Islands (1-22 My) Cape Verde (6-25 My) 668 km

3

4 Colonisation: When? From where????

5 Colonisation and diversification 1) Mitochondrial DNA (maternal inheritance) 1. Phylogeny (among species) 2. Phylogeography (within species) 2) Nuclear DNA (maternal and paternal) 1. Population genetics (genetic structure, gene flow) 2. Phylogeography (origin, dispersal) Flanking region Short tandem repeats (CAC) Flanking region AGTCCTGGCCTGAACACCACCACCACCACCACCACCACCACCCTTAACTGGTAA TCAGGACCGGACTTGTGGTGGTGGTGGTGGTGGTGGTGGTGGGAATTGACCATT

6 3) Next-generation sequencing Colonisation and diversification

7 Origin and diversification of island biota a) A small group of individuals arrive B C A D

8 Colonisation: How? When? From where? F. c. moreletii? Fringilla coelebs F. c. maderensis F. c. palmae F. c. ombriosa F. c. canariensis Marshall & Baker, Mol.Phy.Evol.

9 Fringilla coelebs Rando et al PloS ONE.

10 Character displacement among finches Carduelis aurelioi Rando et al PloS ONE

11 Character displacement among finches Carduelis aurelioi A beak size comparison among the blue chaffinch (F. teydea), the common chaffinch (F. coelebs) and the extinct slender-billed greenfinch (C. aurelioi) Rando et al PloS ONE

12 Colonisation: How? When? From where? Madeira Anthus berthelotii Selvagens? Canary Islands a) mtadnmt: one haplotipe CR & four with cyt-b b) Microsatellites and MHC: Significant genetic structure among archipelagos Illera et al., Mol. Ecol. Spurgin et al., 2011; Mol. Ecol.

13 Colonisation: How? When? From where? Madeira Anthus berthelotii Selvagens? Canary Islands c) Founder effects are responsible for both genetic and phenotypic changes across archipelagos Spurgin et al., Mol. Ecol.

14 Origin and diversification of island biota b) Multiple invasion waves A B A D A F

15 Colonisation: How? When? From where? 0.7 My (R. r. azoricus/inermis) Regulus regulus (R. Madeirensis) 1.8 My (R. r. Ellenthalerae) 2 My (R. r. Teneriffae) Regulus regulus teneriffae Päckert et al., J.Avian Biology

16 Origin and diversification of island biota c) Diversification due to vicariance Brown et al., Mol. Ecol. A A A Milá et al., BMC Evol. Biol. B C B C

17 Origin and diversification of island biota d) Diversification in sympatry A B A

18 Diversification by allochrony Breeding areas of Oceanodroma castro/monteiroi (circles) 1) Allochronic populations genetically structured 2) Allochrony in four archipelagos Friesen V. L. et.al. (2007). PNAS

19 Complex colonisation: How? When? From where? Distibution genus Cyanistes C. caeruleus C. cyanus C. teneriffae Illera et al.,

20 Complex colonisation: How? When? From where? Stervander et al., Mol.Ecol.

21 Complex colonisation: How? When? From where? 1st wave ( my) Spit of cyanus-caeruleus ( my) 2nd wave ( my) 3rd wave (0.27 my) Stervander et al., Mol.Ecol.

22 Colonisation: When? a) Recent colonisation ( My) b) Recent lineages in relation to reptils c) Significant diference in relation to similar archipelagos Mammals Birds My Skinks Geckos My Lizards

23 Conclusions 1) Recent colonisation of extant lineages 2) Complex evolutionary histories 3) Lower diversification than other archipelagos

24 Extinction of birds in Macaronesia Conclusions Ok, but is that all?

25 Extinction of birds in Macaronesia Emberiza alcoveri Ratites Coturnix gomerae Carduelis aurelioi

26 Extinction of birds in Macaronesia Extinction dates of macaronesian birds estimated with radiocarbon and historical records plotted in relation with human occupation of the archipelagos Illera et al., Quaternary Science Reviews

27 Extinction of birds in Macaronesia Puffinus olsoni 0,6-0,4 m.a. Puffinus puffinus Ramírez et al., PLoS ONE

28 Extinction of birds in Macaronesia

29 Acknowledgements Postdoctoral research associated positions JuandelaCiervaandRamónyCajalfellowships Mercibeaucoup!!

Biodiversity and Distributions. Lecture 2: Biodiversity. The process of natural selection

Biodiversity and Distributions. Lecture 2: Biodiversity. The process of natural selection Lecture 2: Biodiversity What is biological diversity? Natural selection Adaptive radiations and convergent evolution Biogeography Biodiversity and Distributions Types of biological diversity: Genetic diversity

More information

Lecture 11 Wednesday, September 19, 2012

Lecture 11 Wednesday, September 19, 2012 Lecture 11 Wednesday, September 19, 2012 Phylogenetic tree (phylogeny) Darwin and classification: In the Origin, Darwin said that descent from a common ancestral species could explain why the Linnaean

More information

6. The lifetime Darwinian fitness of one organism is greater than that of another organism if: A. it lives longer than the other B. it is able to outc

6. The lifetime Darwinian fitness of one organism is greater than that of another organism if: A. it lives longer than the other B. it is able to outc 1. The money in the kingdom of Florin consists of bills with the value written on the front, and pictures of members of the royal family on the back. To test the hypothesis that all of the Florinese $5

More information

Fringilla coelebs all others

Fringilla coelebs all others Period 2008-2012 European Environment Agency European Topic Centre on Biological Diversity Annex I International action plan No No Eurasian Chaffinch, Fringilla coelebs, is a species of passerine bird

More information

The Galapagos Islands: Crucible of Evolution.

The Galapagos Islands: Crucible of Evolution. The Galapagos Islands: Crucible of Evolution. I. The Archipelago. 1. Remote - About 600 miles west of SA. 2. Small (13 main; 6 smaller); arid. 3. Of recent volcanic origin (5-10 Mya): every height crowned

More information

Name: Per. Date: 1. How many different species of living things exist today?

Name: Per. Date: 1. How many different species of living things exist today? Name: Per. Date: Life Has a History We will be using this website for the activity: http://www.ucmp.berkeley.edu/education/explorations/tours/intro/index.html Procedure: A. Open the above website and click

More information

Modern Evolutionary Classification. Lesson Overview. Lesson Overview Modern Evolutionary Classification

Modern Evolutionary Classification. Lesson Overview. Lesson Overview Modern Evolutionary Classification Lesson Overview 18.2 Modern Evolutionary Classification THINK ABOUT IT Darwin s ideas about a tree of life suggested a new way to classify organisms not just based on similarities and differences, but

More information

Temporal changes in mitochondrial diversity highlights contrasting population events in Macaronesian honey bees

Temporal changes in mitochondrial diversity highlights contrasting population events in Macaronesian honey bees Temporal changes in mitochondrial diversity highlights contrasting population events in Macaronesian honey bees Irene Muñoz, Maria Pinto, Pilar De La Rúa To cite this version: Irene Muñoz, Maria Pinto,

More information

Darwin s Finches: A Thirty Year Study.

Darwin s Finches: A Thirty Year Study. Darwin s Finches: A Thirty Year Study. I. Mit-DNA Based Phylogeny (Figure 1). 1. All Darwin s finches descended from South American grassquit (small finch) ancestor circa 3 Mya. 2. Galapagos colonized

More information

A review on the impacts of feral cats (Felis silvestris catus) in the Canary Islands: implications for the conservation of its endangered fauna

A review on the impacts of feral cats (Felis silvestris catus) in the Canary Islands: implications for the conservation of its endangered fauna Biodivers Conserv (2009) 18:829 846 DOI 10.1007/s10531-008-9503-4 REVIEW PAPER A review on the impacts of feral cats (Felis silvestris catus) in the Canary Islands: implications for the conservation of

More information

Temporal mitochondrial DNA variation in honeybee populations from Tenerife (Canary Islands, Spain)

Temporal mitochondrial DNA variation in honeybee populations from Tenerife (Canary Islands, Spain) Temporal mitochondrial DNA variation in honeybee populations from Tenerife (Canary Islands, Spain) Mª Jesús Madrid-Jiménez, Irene Muñoz, Pilar De la Rúa Dpto. de Zoología y Antropología Física, Facultad

More information

Phylogeographic assessment of Acanthodactylus boskianus (Reptilia: Lacertidae) based on phylogenetic analysis of mitochondrial DNA.

Phylogeographic assessment of Acanthodactylus boskianus (Reptilia: Lacertidae) based on phylogenetic analysis of mitochondrial DNA. Zoology Department Phylogeographic assessment of Acanthodactylus boskianus (Reptilia: Lacertidae) based on phylogenetic analysis of mitochondrial DNA By HAGAR IBRAHIM HOSNI BAYOUMI A thesis submitted in

More information

Evolution as Fact. The figure below shows transitional fossils in the whale lineage.

Evolution as Fact. The figure below shows transitional fossils in the whale lineage. Evolution as Fact Evolution is a fact. Organisms descend from others with modification. Phylogeny, the lineage of ancestors and descendants, is the scientific term to Darwin's phrase "descent with modification."

More information

VIERAEA Vol Santa Cruz de Tenerife, noviembre 2006 ISSN X

VIERAEA Vol Santa Cruz de Tenerife, noviembre 2006 ISSN X VIERAEA Vol. 34 65-70 Santa Cruz de Tenerife, noviembre 2006 ISSN 0210-945X On the scientific name of the extant Giant Lizard of La Gomera (Canary Islands): Gallotia gomerana Hutterer, 1985 vs. G. bravoana

More information

Prof. Neil. J.L. Heideman

Prof. Neil. J.L. Heideman Prof. Neil. J.L. Heideman Position Office Mailing address E-mail : Vice-dean (Professor of Zoology) : No. 10, Biology Building : P.O. Box 339 (Internal Box 44), Bloemfontein 9300, South Africa : heidemannj.sci@mail.uovs.ac.za

More information

Museu de História Natural do Funchal. Madeira 31.XII.2012 No. 235

Museu de História Natural do Funchal. Madeira 31.XII.2012 No. 235 1 ISSN 0523-7904 B O C A G I A N A Museu de História Natural do Funchal Madeira 31.XII.2012 No. 235 FIRST DATA ON BREEDING OF MANDARIN DUCK AIX GALERICULATA IN THE MADEIRAN ARCHIPELAGO BY DOMINGO TRUJILLO

More information

Phylogeography of the Madeiran endemic lizard Lacerta dugesii inferred from mtdna sequences

Phylogeography of the Madeiran endemic lizard Lacerta dugesii inferred from mtdna sequences Molecular Phylogenetics and Evolution 26 (2003) 222 230 MOLECULAR PHYLOGENETICS AND EVOLUTION www.elsevier.com/locate/ympev Phylogeography of the Madeiran endemic lizard Lacerta dugesii inferred from mtdna

More information

History of Lineages. Chapter 11. Jamie Oaks 1. April 11, Kincaid Hall 524. c 2007 Boris Kulikov boris-kulikov.blogspot.

History of Lineages. Chapter 11. Jamie Oaks 1. April 11, Kincaid Hall 524. c 2007 Boris Kulikov boris-kulikov.blogspot. History of Lineages Chapter 11 Jamie Oaks 1 1 Kincaid Hall 524 joaks1@gmail.com April 11, 2014 c 2007 Boris Kulikov boris-kulikov.blogspot.com History of Lineages J. Oaks, University of Washington 1/46

More information

2015 Artikel. article Online veröffentlicht / published online: Deichsel, G., U. Schulte and J. Beninde

2015 Artikel. article Online veröffentlicht / published online: Deichsel, G., U. Schulte and J. Beninde Deichsel, G., U. Schulte and J. Beninde 2015 Artikel article 7 - Online veröffentlicht / published online: 2015-09-21 Autoren / Authors: Guntram Deichsel, Biberach an der Riß, Germany. E-Mail: guntram.deichsel@gmx.de

More information

Biology of the Galapagos

Biology of the Galapagos Biology of the Galapagos Wikelski reading, Web links 26 March 2009, Thurs ECOL 182R UofA K. E. Bonine Alan Alda Video? 1 Student Chapter of the Tucson Herpetological Society COME JOIN!!!!! 2 General Information

More information

Are reptile and amphibian species younger in the Northern Hemisphere than in the Southern Hemisphere?

Are reptile and amphibian species younger in the Northern Hemisphere than in the Southern Hemisphere? doi: 1.1111/j.142-911.211.2417.x SHORT COMMUNICATION Are reptile and amphibian species younger in the Northern Hemisphere than in the Southern Hemisphere? S. DUBEY & R. SHINE School of Biological Sciences,

More information

Wild: Amazing animals in a changing world

Wild: Amazing animals in a changing world Wild: Amazing animals in a changing world Worldwide biodiversity Begin this trail looking over the balcony from Darwin to DNA into Wild. While looking from the balcony, consider the following: Are there

More information

Quiz Flip side of tree creation: EXTINCTION. Knock-on effects (Crooks & Soule, '99)

Quiz Flip side of tree creation: EXTINCTION. Knock-on effects (Crooks & Soule, '99) Flip side of tree creation: EXTINCTION Quiz 2 1141 1. The Jukes-Cantor model is below. What does the term µt represent? 2. How many ways can you root an unrooted tree with 5 edges? Include a drawing. 3.

More information

Bird Species Fact Sheets

Bird Species Fact Sheets MODULE 1: LEARNING ABOUT BIRDS Bird Species Fact Sheets The following fact sheets cover 4 different birds, Blue tit, Chaffinch, Sand martin and House martin. These 4 species are featured because they can

More information

Comparing DNA Sequence to Understand

Comparing DNA Sequence to Understand Comparing DNA Sequence to Understand Evolutionary Relationships with BLAST Name: Big Idea 1: Evolution Pre-Reading In order to understand the purposes and learning objectives of this investigation, you

More information

Centre of Macaronesian Studies, University of Madeira, Penteada, 9000 Funchal, Portugal b

Centre of Macaronesian Studies, University of Madeira, Penteada, 9000 Funchal, Portugal b Molecular Phylogenetics and Evolution 34 (2005) 480 485 www.elsevier.com/locate/ympev Phylogenetic relationships of Hemidactylus geckos from the Gulf of Guinea islands: patterns of natural colonizations

More information

Bi156 Lecture 1/13/12. Dog Genetics

Bi156 Lecture 1/13/12. Dog Genetics Bi156 Lecture 1/13/12 Dog Genetics The radiation of the family Canidae occurred about 100 million years ago. Dogs are most closely related to wolves, from which they diverged through domestication about

More information

CLADISTICS Student Packet SUMMARY Phylogeny Phylogenetic trees/cladograms

CLADISTICS Student Packet SUMMARY Phylogeny Phylogenetic trees/cladograms CLADISTICS Student Packet SUMMARY PHYLOGENETIC TREES AND CLADOGRAMS ARE MODELS OF EVOLUTIONARY HISTORY THAT CAN BE TESTED Phylogeny is the history of descent of organisms from their common ancestor. Phylogenetic

More information

How can one species become two?

How can one species become two? Speciation How can one species become two? Species: a group of organisms that can interbreed and produce viable offspring Speciation: the process of forming new species Reproductive Isolation Reproductive

More information

Hybridization among Three Native North American Canis Species in a Region of Natural Sympatry

Hybridization among Three Native North American Canis Species in a Region of Natural Sympatry University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Other Publications in Wildlife Management Wildlife Damage Management, Internet Center for 10-2008 Hybridization among Three

More information

The application of genetic research to the conservation of fruit bats in the western Indian Ocean

The application of genetic research to the conservation of fruit bats in the western Indian Ocean O BRIAN, J., T.J. HAYDEN 2004. The application of genetic research to the conservation of fruit bats... Phelsuma 12: 141 146 The application of genetic research to the conservation of fruit bats in the

More information

Introduction Histories and Population Genetics of the Nile Monitor (Varanus niloticus) and Argentine Black-and-White Tegu (Salvator merianae) in

Introduction Histories and Population Genetics of the Nile Monitor (Varanus niloticus) and Argentine Black-and-White Tegu (Salvator merianae) in Introduction Histories and Population Genetics of the Nile Monitor (Varanus niloticus) and Argentine Black-and-White Tegu (Salvator merianae) in Florida JARED WOOD, STEPHANIE DOWELL, TODD CAMPBELL, ROBERT

More information

Chapter 22 Darwin and Evolution by Natural Selection

Chapter 22 Darwin and Evolution by Natural Selection Anaerobic Bacteria Photosynthetic Bacteria Dinosaurs Green Algae Multicellular Animals Flowering Molluscs Arthropods Chordates Jawless Fish Teleost Fish Amphibians Insects Reptiles Mammals Birds Land Plants

More information

2016 CHARLES DARWIN ORATION. Evolution in action - Charles Darwin and the Galápagos Finches

2016 CHARLES DARWIN ORATION. Evolution in action - Charles Darwin and the Galápagos Finches 2016 CHARLES DARWIN ORATION Evolution in action - Charles Darwin and the Galápagos Finches Emeritus Professor Peter Grant Charles Darwin s life and legacy are well known. You get the impression that not

More information

What is the evidence for evolution?

What is the evidence for evolution? What is the evidence for evolution? 1. Geographic Distribution 2. Fossil Evidence & Transitional Species 3. Comparative Anatomy 1. Homologous Structures 2. Analogous Structures 3. Vestigial Structures

More information

2015 Artikel. article Online veröffentlicht / published online: Ron Peek

2015 Artikel. article Online veröffentlicht / published online: Ron Peek 2015 Artikel article 1 - Online veröffentlicht / published online: 2015-01-20 Autor / Author:, The Netherlands. E-Mail: ron.peek@hotmail.com Zitat / Citation: Peek, R. (2015): Sound as part of courtship

More information

Evolution of Birds. Summary:

Evolution of Birds. Summary: Oregon State Standards OR Science 7.1, 7.2, 7.3, 7.3S.1, 7.3S.2 8.1, 8.2, 8.2L.1, 8.3, 8.3S.1, 8.3S.2 H.1, H.2, H.2L.4, H.2L.5, H.3, H.3S.1, H.3S.2, H.3S.3 Summary: Students create phylogenetic trees to

More information

Biometrics, ageing, sexing and moult of the Blue Chaffinch Fringilla teydea teydea on Tenerife (Canary Islands)

Biometrics, ageing, sexing and moult of the Blue Chaffinch Fringilla teydea teydea on Tenerife (Canary Islands) Ringing & Migration (2005) 22, 177-184 Biometrics, ageing, sexing and moult of the Blue Chaffinch Fringilla teydea teydea on Tenerife (Canary Islands) EDUARDO GARCIA-DEL-REY 1 * and ANDREW G. GOSLER 2

More information

Ibridazione naturale e antropogenica

Ibridazione naturale e antropogenica Ibridazione naturale e antropogenica Ettore Randi Laboratorio di Genetica ISPRA, sede di Ozzano Emilia (BO) ettore.randi@isprambiente.it Foto Davide Palumbo Foto Giancarlo Tedaldi Images dowloaded for

More information

INQUIRY & INVESTIGATION

INQUIRY & INVESTIGATION INQUIRY & INVESTIGTION Phylogenies & Tree-Thinking D VID. UM SUSN OFFNER character a trait or feature that varies among a set of taxa (e.g., hair color) character-state a variant of a character that occurs

More information

Comparing DNA Sequences Cladogram Practice

Comparing DNA Sequences Cladogram Practice Name Period Assignment # See lecture questions 75, 122-123, 127, 137 Comparing DNA Sequences Cladogram Practice BACKGROUND Between 1990 2003, scientists working on an international research project known

More information

Phylogeography and diversification history of the day-gecko genus Phelsuma in the Seychelles islands. Rocha et al.

Phylogeography and diversification history of the day-gecko genus Phelsuma in the Seychelles islands. Rocha et al. Phylogeography and diversification history of the day-gecko genus Phelsuma in the Seychelles islands Rocha et al. Rocha et al. BMC Evolutionary Biology 2013, 13:3 Rocha et al. BMC Evolutionary Biology

More information

LIZARD RADIATIONS. On major land-bridge islands with favorable climates (i.e., in the tropical, dry, and temperate zones) both liz- MIGUEL VENCES

LIZARD RADIATIONS. On major land-bridge islands with favorable climates (i.e., in the tropical, dry, and temperate zones) both liz- MIGUEL VENCES FURTHER READING Agardy, D. T. 2001. Scientific research opportunities at Palmyra atoll. A report submitted to The Nature Conservancy. Cobb, K. M., C. D. Charles, H. Cheng, and R. L. Edwards. 2003. El Niño

More information

NAME: DATE: SECTION:

NAME: DATE: SECTION: NAME: DATE: SECTION: MCAS PREP PACKET EVOLUTION AND BIODIVERSITY 1. Which of the following observations best supports the conclusion that dolphins and sharks do not have a recent common ancestor? A. Dolphins

More information

Interpreting Evolutionary Trees Honors Integrated Science 4 Name Per.

Interpreting Evolutionary Trees Honors Integrated Science 4 Name Per. Interpreting Evolutionary Trees Honors Integrated Science 4 Name Per. Introduction Imagine a single diagram representing the evolutionary relationships between everything that has ever lived. If life evolved

More information

BIRD RADIATIONS JEFFREY PODOS AND DAVID C. LAHTI THE FUTURE BIRD RADIATIONS ON ISLANDS: ECOLOGICAL AND EVOLUTIONARY INSIGHTS

BIRD RADIATIONS JEFFREY PODOS AND DAVID C. LAHTI THE FUTURE BIRD RADIATIONS ON ISLANDS: ECOLOGICAL AND EVOLUTIONARY INSIGHTS by endemic mosquitoes in a human-modified landscape with relatively few native birds. Its original host remains unknown, but unlike many islands, New Zealand had endemic mosquitoes, which could have coevolved

More information

Species: Panthera pardus Genus: Panthera Family: Felidae Order: Carnivora Class: Mammalia Phylum: Chordata

Species: Panthera pardus Genus: Panthera Family: Felidae Order: Carnivora Class: Mammalia Phylum: Chordata CHAPTER 6: PHYLOGENY AND THE TREE OF LIFE AP Biology 3 PHYLOGENY AND SYSTEMATICS Phylogeny - evolutionary history of a species or group of related species Systematics - analytical approach to understanding

More information

Tenerife, 38206, Canary Islands, Spain b Department of Zoology, Edward Grey Institute of Field Ornithology, South Parks Rd,

Tenerife, 38206, Canary Islands, Spain   b Department of Zoology, Edward Grey Institute of Field Ornithology, South Parks Rd, This article was downloaded by: [the Bodleian Libraries of the University of Oxford] On: 02 August 2013, At: 08:28 Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number:

More information

Molecular evidence for hybridisation between the two living species of South American ratites: potential. conservation implications

Molecular evidence for hybridisation between the two living species of South American ratites: potential. conservation implications Molecular evidence for hybridisation between the two living species of South American ratites: potential conservation implications Frédéric Delsuc, Mariella Superina, Guillermo Ferraris, Marie-Ka Tilak,

More information

UNIT III A. Descent with Modification(Ch19) B. Phylogeny (Ch20) C. Evolution of Populations (Ch21) D. Origin of Species or Speciation (Ch22)

UNIT III A. Descent with Modification(Ch19) B. Phylogeny (Ch20) C. Evolution of Populations (Ch21) D. Origin of Species or Speciation (Ch22) UNIT III A. Descent with Modification(Ch9) B. Phylogeny (Ch2) C. Evolution of Populations (Ch2) D. Origin of Species or Speciation (Ch22) Classification in broad term simply means putting things in classes

More information

Lab 7. Evolution Lab. Name: General Introduction:

Lab 7. Evolution Lab. Name: General Introduction: Lab 7 Name: Evolution Lab OBJECTIVES: Help you develop an understanding of important factors that affect evolution of a species. Demonstrate important biological and environmental selection factors that

More information

Introduction to phylogenetic trees and tree-thinking Copyright 2005, D. A. Baum (Free use for non-commercial educational pruposes)

Introduction to phylogenetic trees and tree-thinking Copyright 2005, D. A. Baum (Free use for non-commercial educational pruposes) Introduction to phylogenetic trees and tree-thinking Copyright 2005, D. A. Baum (Free use for non-commercial educational pruposes) Phylogenetics is the study of the relationships of organisms to each other.

More information

Biol 160: Lab 7. Modeling Evolution

Biol 160: Lab 7. Modeling Evolution Name: Modeling Evolution OBJECTIVES Help you develop an understanding of important factors that affect evolution of a species. Demonstrate important biological and environmental selection factors that

More information

17.2 Classification Based on Evolutionary Relationships Organization of all that speciation!

17.2 Classification Based on Evolutionary Relationships Organization of all that speciation! Organization of all that speciation! Patterns of evolution.. Taxonomy gets an over haul! Using more than morphology! 3 domains, 6 kingdoms KEY CONCEPT Modern classification is based on evolutionary relationships.

More information

Geo 302D: Age of Dinosaurs LAB 4: Systematics Part 1

Geo 302D: Age of Dinosaurs LAB 4: Systematics Part 1 Geo 302D: Age of Dinosaurs LAB 4: Systematics Part 1 Systematics is the comparative study of biological diversity with the intent of determining the relationships between organisms. Humankind has always

More information

Lizard Surveying and Monitoring in Biodiversity Sanctuaries

Lizard Surveying and Monitoring in Biodiversity Sanctuaries Lizard Surveying and Monitoring in Biodiversity Sanctuaries Trent Bell (EcoGecko Consultants) Alison Pickett (DOC North Island Skink Recovery Group) First things first I am profoundly deaf I have a Deaf

More information

Level 2 Biology, 2017

Level 2 Biology, 2017 91157 911570 2SUPERVISOR S Level 2 Biology, 2017 91157 Demonstrate understanding of genetic variation and change 2.00 p.m. Wednesday 22 November 2017 Credits: Four Achievement Achievement with Merit Achievement

More information

The Brazilian Barcode of Life (BrBOL) initiative and its potential to aid in biodiversity conservation

The Brazilian Barcode of Life (BrBOL) initiative and its potential to aid in biodiversity conservation DNA Barcodes 2015 Guelph, Canada, August 21st, 2015 The Brazilian Barcode of Life (BrBOL) initiative and its potential to aid in biodiversity conservation Eduardo Eizirik Faculdade de Biociências, PUCRS,

More information

Genes What are they good for? STUDENT HANDOUT. Module 4

Genes What are they good for? STUDENT HANDOUT. Module 4 Genes What are they good for? Module 4 Genetics for Kids: Module 4 Genes What are they good for? Part I: Introduction Genes are sequences of DNA that contain instructions that determine the physical traits

More information

Animal Traits and Behaviors that Enhance Survival. Copyright 2010:PEER.tamu.edu

Animal Traits and Behaviors that Enhance Survival. Copyright 2010:PEER.tamu.edu Animal Traits and Behaviors that Enhance Survival Copyright 2010:PEER.tamu.edu What We Are Going To Learn: What are traits? Inherited vs. Learned Response to stimuli Evolutionary Adaptations Natural Selection

More information

426 Common Chaffinch. Put your logo here. COMMON CHAFFINCH (Fringilla coelebs) IDENTIFICATION

426 Common Chaffinch. Put your logo here. COMMON CHAFFINCH (Fringilla coelebs) IDENTIFICATION Summer. Adult. Male (01-VI). COMMON CHAFFINCH (Fringilla coelebs) IDENTIFICATION 14-16 cm. Male with head and neck grey; breast and cheeks pinkish, duller in winter. Female and juveniles brownish. Both

More information

Animal Diversity wrap-up Lecture 9 Winter 2014

Animal Diversity wrap-up Lecture 9 Winter 2014 Animal Diversity wrap-up Lecture 9 Winter 2014 1 Animal phylogeny based on morphology & development Fig. 32.10 2 Animal phylogeny based on molecular data Fig. 32.11 New Clades 3 Lophotrochozoa Lophophore:

More information

Testing Phylogenetic Hypotheses with Molecular Data 1

Testing Phylogenetic Hypotheses with Molecular Data 1 Testing Phylogenetic Hypotheses with Molecular Data 1 How does an evolutionary biologist quantify the timing and pathways for diversification (speciation)? If we observe diversification today, the processes

More information

Turtles (Testudines) Abstract

Turtles (Testudines) Abstract Turtles (Testudines) H. Bradley Shaffer Department of Evolution and Ecology, University of California, Davis, CA 95616, USA (hbshaffer@ucdavis.edu) Abstract Living turtles and tortoises consist of two

More information

Motuora island reptile monitoring report for common & Pacific gecko 2016

Motuora island reptile monitoring report for common & Pacific gecko 2016 Motuora island reptile monitoring report for common & Pacific gecko 6 Prepared by Su Sinclair August 7 Work on this monitoring project was carried out under a Wildlife Act Authority issued by the Department

More information

Global comparisons of beta diversity among mammals, birds, reptiles, and amphibians across spatial scales and taxonomic ranks

Global comparisons of beta diversity among mammals, birds, reptiles, and amphibians across spatial scales and taxonomic ranks Journal of Systematics and Evolution 47 (5): 509 514 (2009) doi: 10.1111/j.1759-6831.2009.00043.x Global comparisons of beta diversity among mammals, birds, reptiles, and amphibians across spatial scales

More information

LABORATORY #10 -- BIOL 111 Taxonomy, Phylogeny & Diversity

LABORATORY #10 -- BIOL 111 Taxonomy, Phylogeny & Diversity LABORATORY #10 -- BIOL 111 Taxonomy, Phylogeny & Diversity Scientific Names ( Taxonomy ) Most organisms have familiar names, such as the red maple or the brown-headed cowbird. However, these familiar names

More information

Differential human impact on the survival of genetically distinct avian lineages

Differential human impact on the survival of genetically distinct avian lineages Bird Conservation International (1999) 9:147-154. BirdLife International 1999 Differential human impact on the survival of genetically distinct avian lineages AUSTIN L. HUGHES Summary At the present time

More information

Do the traits of organisms provide evidence for evolution?

Do the traits of organisms provide evidence for evolution? PhyloStrat Tutorial Do the traits of organisms provide evidence for evolution? Consider two hypotheses about where Earth s organisms came from. The first hypothesis is from John Ray, an influential British

More information

18th century - first to propose that could change over time and that changes could - proposed that relatively had formed many through.

18th century - first to propose that could change over time and that changes could - proposed that relatively had formed many through. Early Ideas About Evolution 1795 proposed Same occurring in the also occurred in the. - Hutton explained the of landforms as the result of. Contrasts 18th century - first to propose that could change over

More information

Activity 1: Changes in beak size populations in low precipitation

Activity 1: Changes in beak size populations in low precipitation Darwin s Finches Lab Work individually or in groups of -3 at a computer Introduction The finches on Darwin and Wallace Islands feed on seeds produced by plants growing on these islands. There are three

More information

Field Guide: Student Worksheet

Field Guide: Student Worksheet Field Guide: Student Worksheet Bob Winters Classification (Level 7) 1 1. What is classification? 2. Scientists have divided living things into six kingdoms. The plant and animal kingdom are two of these.

More information

Title: Phylogenetic Methods and Vertebrate Phylogeny

Title: Phylogenetic Methods and Vertebrate Phylogeny Title: Phylogenetic Methods and Vertebrate Phylogeny Central Question: How can evolutionary relationships be determined objectively? Sub-questions: 1. What affect does the selection of the outgroup have

More information

Evolution by Natural Selection

Evolution by Natural Selection Evolution by Natural Selection 2006-2007 DOCTRINE But the Fossil record OBSERVATION Quaternary 1.5 Tertiary 63 Cretaceous 135 Jurassic 180 Triassic 225 Permian 280 Carboniferous 350 Devonian 400 Silurian

More information

2013 Holiday Lectures on Science Medicine in the Genomic Era

2013 Holiday Lectures on Science Medicine in the Genomic Era INTRODUCTION Figure 1. Tasha. Scientists sequenced the first canine genome using DNA from a boxer named Tasha. Meet Tasha, a boxer dog (Figure 1). In 2005, scientists obtained the first complete dog genome

More information

Seeds. Rough pastures. Insects. Worms. Farmland. Larvae. Sand-dunes. Insects. Farmland. Worms. Moorland Sand-dunes. Seeds. Berries. Insects.

Seeds. Rough pastures. Insects. Worms. Farmland. Larvae. Sand-dunes. Insects. Farmland. Worms. Moorland Sand-dunes. Seeds. Berries. Insects. Common Name Skylark Meadow pipit Rook Scientific Name Alauda arvensis Anthus pratensis Corvus frugilegus Irish Name Resident/ Migrant Habitat Food Distinctive features Fuiseog Resident Moorland Long streaked

More information

Evolution by Natural Selection

Evolution by Natural Selection Evolution by Natural Selection 225 Permian Seed Plants Flowering Plants Birds Land Plants Mammals Insects Reptiles Teleost Fish Amphibians Chordates Molluscs Arthropods Dinosaurs 180 Triassic Jawless Fish

More information

Our ref: Your ref: PPL - D. Clendon. Date: 1/10/2015. From: Technical Advisor Ecology - J. Marshall. Waitaha Hydro - Lizards

Our ref: Your ref: PPL - D. Clendon. Date: 1/10/2015. From: Technical Advisor Ecology - J. Marshall. Waitaha Hydro - Lizards Internal Correspondence To: PPL - D. Clendon Our ref: Your ref: Date: 1/10/2015 From: Technical Advisor Ecology - J. Marshall Subject: Waitaha Hydro - Lizards Summary The applicant has employed a respected

More information

Motuora island reptile monitoring report for common & Pacific gecko 2017

Motuora island reptile monitoring report for common & Pacific gecko 2017 Motuora island reptile monitoring report for common & Pacific gecko 7 Prepared by Su Sinclair August 7 Work on this monitoring project was carried out under a Wildlife Act Authority issued by the Department

More information

Lineage Classification of Canine Title Disorders Using Mitochondrial DNA 宮原, 和郎, 鈴木, 三義. Journal of Veterinary Medical Sci Citation

Lineage Classification of Canine Title Disorders Using Mitochondrial DNA 宮原, 和郎, 鈴木, 三義. Journal of Veterinary Medical Sci Citation ' ' Lineage Classification of Canine Title Disorders Using Mitochondrial DNA TAKAHASI, Shoko, MIYAHARA, Kazuro Author(s) Hirosi, ISHIGURO, Naotaka, SUZUKI 宮原, 和郎, 鈴木, 三義 Journal of Veterinary Medical Sci

More information

Extinction. Extinction occurs when all individuals of a species are gone and have left no descendants. If all the species within a genus are

Extinction. Extinction occurs when all individuals of a species are gone and have left no descendants. If all the species within a genus are Extinction Extinction occurs when all individuals of a species are gone and have left no descendants. If all the species within a genus are extinct then the genus is extinct. If all genera in a family

More information

Drivers of Extinction Risk in Terrestrial Vertebrates

Drivers of Extinction Risk in Terrestrial Vertebrates LETTER Drivers of Extinction Risk in Terrestrial Vertebrates Simon Ducatez & Richard Shine School of Biological Sciences, University of Sydney, NSW 2006, Australia Keywords Amphibians; birds; endangerment;

More information

Darwin s Finches and Natural Selection

Darwin s Finches and Natural Selection Darwin s Finches and Natural Selection by Cheryl Heinz, Dept. of Biological Sciences, Benedictine University, and Eric Ribbens, Dept. of Biological Sciences, Western Illinois University 1 The Galapagos

More information

Life s Natural History = a record of Successions & Extinctions. Anaerobic Bacteria. Photosynthetic Bacteria. Green Algae. Multicellular Animals

Life s Natural History = a record of Successions & Extinctions. Anaerobic Bacteria. Photosynthetic Bacteria. Green Algae. Multicellular Animals Evolution by Natural Selection (Chapter 22) DOCTRINE TINTORETTO The Creation of the Animals 1550 The Fossil record OBSERVATION mya Quaternary 1.5 Tertiary 63 Cretaceous 135 Jurassic 180 Triassic 225 Permian

More information

Name: Date: Hour: Fill out the following character matrix. Mark an X if an organism has the trait.

Name: Date: Hour: Fill out the following character matrix. Mark an X if an organism has the trait. Name: Date: Hour: CLADOGRAM ANALYSIS What is a cladogram? It is a diagram that depicts evolutionary relationships among groups. It is based on PHYLOGENY, which is the study of evolutionary relationships.

More information

Linking speciation to extinction: Diversification raises contemporary extinction risk in amphibians

Linking speciation to extinction: Diversification raises contemporary extinction risk in amphibians LETTER doi:10.1002/evl3.4 Linking speciation to extinction: Diversification raises contemporary extinction risk in amphibians Dan A. Greenberg 1,2,3,4 and Arne Ø. Mooers 1,3 1 Department of Biological

More information

Biology of the Galapagos

Biology of the Galapagos Biology of the Galapagos Why can you get so close to the wildlife in the Galapagos? 23 March 2010, Thurs ECOL 182R UofA K. E. Bonine Alan Alda Video? 1 9 Galapagos 1000 km Ecuador S. America Origins of

More information

Bones, Stones, and Genes: The Origin of Modern Humans Lecture 2- Genetics of Human Origins and Adaptation Sarah A. Tishkoff, Ph.D.

Bones, Stones, and Genes: The Origin of Modern Humans Lecture 2- Genetics of Human Origins and Adaptation Sarah A. Tishkoff, Ph.D. Bones, Stones, and Genes: The Origin of Modern Humans Lecture 2- Genetics of Human Origins and Adaptation Sarah A. Tishkoff, Ph.D. 1. Start of Lecture 2 (0:00) [ Music ] [ANNOUNCER:] From the Howard Hughes

More information

Types of Evolution: Punctuated Equilibrium vs Gradualism

Types of Evolution: Punctuated Equilibrium vs Gradualism Biology Types of Evolution: Punctuated Equilibrium vs Gradualism Use the information below AND YOUR NOTES to answer the questions that follow. READ the information before attempting to do the work. You

More information

Rode Pool Bird Report 2013

Rode Pool Bird Report 2013 Rode Pool Bird Report 2013 RODE POOL BIRD REPORT 2013 ## denotes that the species was seen using the feeding station at the bird hide. Little Grebe (Tachybaptus ruficollis) An increase in records, but

More information

AP Biology. AP Biology

AP Biology. AP Biology Evolution by Natural Selection 2006-2007 DOCTRINE TINTORETTO The Creation of the Animals 1550 But the Fossil record OBSERVATION mya Quaternary 1.5 Tertiary 63 Cretaceous 135 Jurassic 180 Triassic 225 Permian

More information

Final Report for Research Work Order 167 entitled:

Final Report for Research Work Order 167 entitled: Final Report for Research Work Order 167 entitled: Population Genetic Structure of Marine Turtles, Eretmochelys imbricata and Caretta caretta, in the Southeastern United States and adjacent Caribbean region

More information

Evolution of Biodiversity

Evolution of Biodiversity Long term patterns Evolution of Biodiversity Chapter 7 Changes in biodiversity caused by originations and extinctions of taxa over geologic time Analyses of diversity in the fossil record requires procedures

More information

Which Came First: The Lizard or the Egg? Robustness in Phylogenetic Reconstruction of Ancestral States

Which Came First: The Lizard or the Egg? Robustness in Phylogenetic Reconstruction of Ancestral States RESEARCH ARTICLE Which Came First: The Lizard or the Egg? Robustness in Phylogenetic Reconstruction of Ancestral States APRIL M. WRIGHT 1 *, KATHLEEN M. LYONS 1, MATTHEW C. BRANDLEY 2,3, AND DAVID M. HILLIS

More information

Evidence of high longevity in an Island lacertid, Teira dugesii (Milne-Edwards, 1829). First data on wild specimens

Evidence of high longevity in an Island lacertid, Teira dugesii (Milne-Edwards, 1829). First data on wild specimens Acta Herpetologica 7(2): 309-313, 2012 Evidence of high longevity in an Island lacertid, Teira dugesii (Milne-Edwards, 1829). First data on wild specimens J. Jesus Centro de Competências de Ciências da

More information

Daniel J. Newhouse * and Christopher N. Balakrishnan

Daniel J. Newhouse * and Christopher N. Balakrishnan Newhouse and Balakrishnan BMC Evolutionary Biology (2015) 15:265 DOI 10.1186/s12862-015-0546-3 RESEARCH ARTICLE Open Access High major histocompatibility complex class I polymorphism despite bottlenecks

More information